CN115521877B

CN115521877B - Penicillium strain and application thereof in preparation of brefeldin A

Info

Publication number: CN115521877B
Application number: CN202210119913.XA
Authority: CN
Inventors: 桑夏楠; 曹岗; 韩欣; 单琪媛; 华凯
Original assignee: Zhejiang Chinese Medicine University ZCMU
Current assignee: Zhejiang Chinese Medicine University ZCMU
Priority date: 2022-01-25
Filing date: 2022-01-25
Publication date: 2024-04-19
Anticipated expiration: 2042-01-25
Also published as: CN115521877A

Abstract

The invention relates to the technical field of microorganisms, in particular to a penicillium strain and application thereof in preparation of brefeldin A. Penicillium strain (Penicillium glaucoroseum), deposited on China general microbiological culture Collection center, accession number, under the year 08 and 20: CGMCC No.20244, named Penicillium BT-38. Deposit unit address: the institute of microorganisms at national academy of sciences of China, national academy of sciences, no. 1, beichen West way, beijing, chao's area. The invention is specifically applied to the fermentation culture of penicillium BT-38 at the temperature of 20-35 ℃ by taking worm-eaten or moldy rice as a substrate, wherein the culture time is 3-11 days, and the obtained fermentation product is separated and purified to obtain the high-purity brefeldin A.

Description

Penicillium strain and application thereof in preparation of brefeldin A

Technical Field

The invention relates to the technical field of microorganisms, in particular to a penicillium strain and application thereof in preparation of brefeldin A.

Background

Rice plays a leading role in providing people with food. Farmers often use conventional storage containers to store rice, but a portion of the rice in the storage containers is damaged or rotted by various biological factors. Biological factors include fungi, mites, molds, insects, pests, rodents, lizards, birds, and the like. Among the common biological agents, beetles and moths are the major rice storage pests found in tropical countries that cause loss and deterioration of stored rice. Mycotoxin contamination is another significant factor in rice loss, and large numbers of grains are contaminated with mycotoxins produced by fungi in global storage. Mould and mycotoxins can cause rice losses and are a risk factor in the food value chain. Where high concentrations of aflatoxin can lead to aflatoxin poisoning and thus serious illness and even death. Therefore, when people encounter rice insects or mildews, the rice is discarded and irradiated into great waste. Therefore, the worm-eaten and moldy rice is utilized to produce the microorganism secondary metabolite, so that the worm-eaten and moldy rice can be reused, and the method is greener, ecological and environment-friendly.

Microbial fermentation includes solid fermentation (SSF) and liquid fermentation (SmF). Among them, solid fermentation has been a thousand years old and has been the only means of microbial fermentation for a long time. However, in the 40 s of the 20 th century, as scientists produced penicillin by liquid fermentation methods, more and more antibiotics were separated by liquid fermentation, so that liquid fermentation is an absolute place in the production of antibiotics. In recent years, solid fermentation has been increasingly emphasized, but is basically focused on agricultural production. The present patent is the first case of antibiotic production by solid fermentation, and provides reference for the production of antibiotics by subsequent solid fermentation. The most remarkable difference of solid fermentation over liquid fermentation is that a large amount of water is not added to the culture medium, and thus has disadvantages of long fermentation time and poor fermentation fluidity, and difficulty in precisely controlling the fermentation process. At the same time, the solid fermentation has a lot of advantages because the moisture content in the fermentation tank is low, the volume of the fermentation tank used for the solid fermentation is smaller, the moisture heat absorption energy consumption in the sterilization process is low, and the extraction and concentration cost is low. Typically, the product is concentrated immersed in the matrix, the fermented solids can be immediately extracted by direct addition of solvent, and capital and operating costs of sewage treatment are reduced or eliminated.

Several studies have shown that fungi grown under SSF are able to meet the growing global demand for secondary metabolites. Still other examples show that SSF produces large amounts of secondary metabolites in a short time, yielding antibiotics that are more stable than liquid fermentation. SSF provides an environment for the cultured microorganism as close as possible to its natural environment, which is the main reason why microorganisms perform well in SSF and achieve higher product yields. However, since a large amount of solids are extracted, one also extracts more concentrated impurities, and the cost of purification is proportional to the concentration of inert compounds. This may in fact lead to increased recovery costs, especially in terms of extraction of secondary metabolites. Thus, isolation and purification of the final product is generally considered a challenge in this technology, often accounting for 70% -80% of the overall fermentation process.

Brefeldin a (BFA), a naturally occurring macrolide antibiotic with a 13-membered ring, has the efficacy of inhibiting protein transport from the endoplasmic reticulum to the golgi complex. BFA has been found to have antibacterial, antifungal and antitumor activity. BFA is used as a protein transport inhibitor, can influence the protein transport and processing process, becomes an important molecular tool for cell biologists to study the signal transduction pathway of mammalian cells, has good inhibition effect on partial tumor cells of human beings, can be further developed into antitumor drugs or used as lead compounds of antitumor drugs, and has certain market demands. The reports on BFA fermentation production are all liquid fermentation, and the method has the advantages of complex process, low efficiency, complicated extraction and separation process, poor economy, large wastewater yield and serious environmental pollution. The Chinese patent publication No. CN101445784A discloses a technology for producing BFA by liquid fermentation, which adopts high-purity chemical products as raw materials, has high price and poor environmental protection, and the liquid fermentation process uses more water, occupies large area and generates more waste water.

Disclosure of Invention

The invention aims to provide a penicillium strain which can be used for producing high-purity brefeldin A by taking worm-eaten or moldy rice as a substrate for fermentation.

Another object of the invention is to provide the use of said penicillium strain for the preparation of brefeldin a.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

Penicillium strain (Penicillium glaucoroseum), deposited on China general microbiological culture Collection center, accession number, under the year 08 and 20: CGMCC No.20244, named Penicillium BT-38. Deposit unit address: the institute of microorganisms at national academy of sciences of China, national academy of sciences, no. 1, beichen West way, beijing, chao's area. The penicillium BT-38 is obtained by separating rhizosphere soil bacteria of medicinal plant bighead atractylodes rhizome collected in Zhejiang.

The application of the penicillium strain in preparing the brefeldin A.

Preferably, the method comprises the steps of fermenting and culturing the penicillium BT-38 at 20-35 ℃ for 3-11 days by taking worm-eaten or moldy rice as a substrate, and separating and purifying the obtained fermentation product to obtain the brirafenib A.

Preferably, the worm-eaten or moldy rice is mixed with water to prepare a solid culture medium for fermentation culture.

Preferably, the fermentation culture steps are:

Inoculating penicillium BT-38 to PDA culture medium, culturing at 25-35 deg.C for 2-7 days, inoculating strain to fungus liquid culture medium, culturing at 25-35 deg.C for 2-9 days to obtain seed liquid;

The seed liquid is inoculated to the rice culture medium with worm-eaten or moldy by 1-50% of the volume ratio.

Preferably, the main components of the worm-eaten or moldy rice culture medium are water and worm-eaten or moldy rice, wherein the initial water content of the worm-eaten or moldy rice is 46-61%, and the rice is sterilized at 121 ℃ for 20min.

Preferably, the composition of the fungal liquid medium is: peptone 5.0g, glucose: 20.0g, yeast powder: 2.0g of dipotassium hydrogen phosphate 1.0g, magnesium sulfate 0.5g and pH value of 6.4+/-0.2 are added into 1000ml of distilled water.

Preferably, the separation and purification comprises the following steps:

Extracting and concentrating the fermentation product by using 60-100% ethanol by volume percent to obtain an extracting solution and solid residues, distilling an extracting phase obtained by extracting the extracting solution by using ethyl acetate under reduced pressure, adding petroleum ether into the obtained crude extract containing the brefeldin A, centrifuging, taking out a precipitate to obtain a crude product of the brefeldin A, adding methanol or ethanol, preparing Cheng Bulei phenanthrenedectin A saturated solution, filtering while the solution is hot, and cooling and crystallizing to obtain the brefeldin A. The brefeldin A with the purity more than or equal to 99 percent can be obtained after separation and purification.

Preferably, the ethanol extraction control temperature is 20-100 ℃, and the mass volume ratio of the fermentation product in the ethanol extraction step to ethanol is 1: 0.5-32 (g: ml), and the extraction time is 5-60 min.

Preferably, the purity of the separated brefeldin A is more than or equal to 99 percent.

Preferably, the broglifehrin A in the fermentation product,

The yield of the rice in the worm-eaten rice culture medium is more than or equal to 2.88mg/g (worm-eaten rice quantity);

The yield in the mildewed rice culture medium is more than or equal to 2.37mg/g (mildewed rice amount);

The yield of BFA with purity of > 99% after separation and purification in rice culture medium is 1.58mg/g (rice amount).

The use of the present invention eliminates capital and operating costs of wastewater treatment and produces a solid residue with a high nutrient content. And the aflatoxin is added, the rice containing the aflatoxin is simulated to mould, and the extraction process of the aflatoxin in the rice is examined. Experimental results prove that 98% of aflatoxin is extracted, and the content of the residual solid residue aflatoxin is remarkably reduced, so that the method can be further applied to feed or biological bacterial fertilizer, and potential benefit of reuse of moldy rice is provided.

The application of the invention has very low cost of separating and purifying the target product, which is as low as 10% of the fermentation cost. Compared with the common solid fermentation separation and purification cost, the method reduces 50% -60%. The solid fermentation process has short fermentation time which is only 8 days, and is 1/4 of the common solid fermentation time.

Compared with the prior art, the invention has the beneficial effects that:

1. The invention prepares the brefeldin A by utilizing the strain fermentation, the yield is not less than 2.88mg/g (worm-eaten rice amount), and the yield of BFA which is more than 99% is 1.58mg/g (rice amount). The process is simple, the strain is a wild strain with strong activity, the amount of the analog of the brefeldin A is small, the nutrition content of the generated waste residue is high, and the availability is high;

2. The invention adopts solid fermentation to produce BFA, takes worm-eaten and moldy rice as a culture medium, is equivalent to directly using agricultural products for fermentation, has low price, and is more economical and environment-friendly; in addition, the carbon source and the nitrogen source contained in each liter of the worm-eaten and moldy rice culture medium are about ten times that of the liquid culture medium with the same volume, the waste water is hardly generated in the production process, and the generated solid waste residues contain protein, fat and carbohydrate which are about 10.0%,1.1% and 80.8%, respectively, so that the solid waste residues can be further applied to animal feed or agricultural fertilizers, are pollution-free and are more environment-friendly;

3. the invention has very low cost of separating and purifying the target product, which is as low as 10% of the fermentation cost. Compared with the common cost of solid fermentation, separation and purification, the cost is reduced by 50% -60%;

4. in the invention, the extraction, separation and purification of the solvent by adopting the solid fermentation process can be completed by only ethanol, ethyl acetate and petroleum ether, and the method has low toxicity and environmental protection. The solid fermentation process has short fermentation time, the maximum yield is only 8 days, which is 1/4 of the common solid fermentation time, and the fermentation period is greatly shortened. The solid fermentation process has low quality requirement on rice, even the rice containing low content of aflatoxin can be used as a raw material, and the aflatoxin is extracted and concentrated into petroleum ether supernatant fluid and can be used for treating the rice products. The solid fermentation process of the invention is similar to the monascus fermentation process, the monascus fermentation process is developed and matured in China, but the process can be fully utilized due to repeated construction and surplus productivity of certain natural pigment products in the natural pigment industry in China.

Drawings

FIG. 1 shows colony morphology of Penicillium BT-38 of example 1;

FIG. 2 shows a seed liquid pattern of Penicillium BT-38 of example 1;

FIG. 3 shows a schematic diagram of fermentation of the rice culture medium in example 2;

FIG. 4 shows an HPLC plot of the fermentation product of example 2;

FIG. 5 shows an HPLC plot of ethyl acetate extract of the fermentation product containing brefeldin A of example 2;

FIG. 6 shows an HPLC chart of the supernatant of example 2 after centrifugation of crude extract containing brefeldin A with petroleum ether;

FIG. 7 shows an HPLC plot of the precipitate of example 2 after centrifugation of a crude extract containing brefeldin A with petroleum ether;

FIG. 8 shows the results of the detection of the content of the solid residue after extraction in example 2;

FIG. 9 shows an HPLC plot of greater than 99% of brefeldin A in example 2;

FIG. 10 shows a crystalline diagram of brefeldin A having a content of greater than 99% in example 2;

FIG. 11 shows a hydrogen profile of brefeldin A in example 2;

FIG. 12 shows a carbon spectrum of brefeldin A in example 2;

Fig. 13 shows a basic flowchart in embodiment 2.

Detailed Description

The technical scheme of the invention is further specifically described by the following specific examples. It should be understood that the practice of the invention is not limited to the following examples, but is intended to be within the scope of the invention in any form and/or modification thereof.

In the present invention, unless otherwise specified, all parts and percentages are by weight, and the equipment, materials, etc. used are commercially available or are conventional in the art. The methods in the following examples are conventional in the art unless otherwise specified.

Example 1: identification of Penicillium BT-38

Penicillium, designated Penicillium BT-38, deposited on China general microbiological culture Collection center, accession number: CGMCC No.20244.

The penicillium was obtained by the following procedure:

Adding sterile water into root soil samples of medicinal plant bighead atractylodes rhizome collected in Zhejiang, taking supernatant, inoculating the supernatant into a PDA culture medium, and culturing at 28 ℃ for 6 days; separating single bacterial colony, inoculating single bacterial strain to PDA culture medium one by one, culturing at 28deg.C for 6 days to obtain Penicillium BT-38; preserving at 4 ℃ for later use.

Wherein, the PDA culture medium comprises the following components: potato starch: 11.0g, glucose: 20.0g of agar 15.0g, pH 5.6.+ -. 0.2 was added to 1000ml of distilled water.

The characteristics of the Penicillium BT-38 strain are as follows: colony morphology: the strain BT-38 is well produced on a solid PDA culture medium, and the bacterial colony is white villus at the initial growth stage and has villus edges; then the middle of the colony is gradually changed into middle green yellow; the colony has wrinkles, is opaque, and the back is brown yellow. The colony morphology is specifically shown in FIG. 1.

ITS-DNA sequence of

CTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCATACCTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGGCACCCGCCCCCGGGCCCGCGCCCGCCGAAGCCCCCCCTGAACGCTGTCTGAAGATTGCTGTCTGAGCGATTAGCTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGCCCCCCGGCTCCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCCTCAATCTTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA( Nucleotide sequence is SEQ ID No. 1), GENBANK is compared in NCBI website by MEGA4 software to obtain 100.00% homology with Penicillium (Penicillium), and BT-38 strain is identified as Penicillium.

Example 2: application of penicillium BT-38 in fermentation production of briaferin A

The specific steps for producing the briephemeral fungus A by using the penicillium BT-38 fermentation are as follows:

1. Inoculating Penicillium BT-38 to PDA culture medium, culturing at 28deg.C for 5 days, inoculating strain to 200ml fungus liquid culture medium, and culturing at 28deg.C for 5 days to obtain seed solution, the photograph is shown in figure 2; inoculating the seed solution into 200g of rice culture medium; after 8 days of fermentation at 28 ℃, a fermentation product is obtained, and a physical photograph is shown in figure 3. HPLC diagrams of the fermentation products are shown in FIG. 4.

Wherein, the components of PDA culture medium: potato starch: 11.0g, glucose: 20.0g of agar 15.0g, pH 5.6.+ -. 0.2 was added to 1000ml of distilled water.

The components of the fungal liquid medium: peptone 5.0g, glucose: 20.0g, yeast powder: 2.0g of dipotassium hydrogen phosphate 1.0g, magnesium sulfate 0.5g and pH value of 6.4+/-0.2 are added into 1000ml of distilled water.

The rice culture medium comprises water and rice, wherein the rice has an initial water content of 45%, and is sterilized at 121deg.C for 20min.

2. The obtained fermentation product is separated and purified to obtain the brefeldin A.

The separation and purification steps are as follows: reflux-extracting the fermented product obtained after the fermentation of the penicillium BT-38 with 3.2L of 95% (volume) ethanol, concentrating to 150ml, and adding 150ml of ethyl acetate for extraction twice (the HPLC chart of the ethyl acetate extract is shown in figure 5); the obtained extract phase is distilled under reduced pressure, about 2.9 g of crude extract containing the brefeldin A is obtained, 5ml of petroleum ether is added, the precipitate is taken after centrifugation, methanol is added to prepare a saturated solution of the brefeldin A, the saturated solution is filtered, and the brefeldin A is obtained after being crystallized overnight at room temperature, and about 312mg of the brefeldin A is obtained.

In this example, the temperature of 95% ethanol extraction was 100 ℃, and the mass to volume ratio of fermentation product to 95% ethanol was 1:8 (g: ml), the extraction time was 60min.

HPLC diagrams of the supernatant and the precipitate obtained after centrifugation of petroleum ether are shown in FIG. 6 and FIG. 7, respectively.

The solid residue is obtained after ethanol extraction, the detection result of the content of the solid residue is shown in fig. 8, and fig. 8 illustrates: the solid waste residue produced by the method contains about 10.0 percent of protein, about 1.1 percent of fat and about 80.8 percent of carbohydrate respectively;

The HPLC diagram of the final product brefeldin a is shown in fig. 9, and fig. 9 illustrates: the purity of the brefeldin A obtained by the method is more than 99 percent.

The hydrogen spectrum of brefeldin A is shown in figure 11, and the carbon spectrum of B is shown in figure 12. The resulting carbon spectrum of brefeldin A (DMSO-d ₆) reveals that the compound contains 16 carbon signals ：C16(δ20.7),C13(δ26.4),C12(δ31.4),C14(δ33.4),C6(δ40.9),C8(δ43.0),C9(δ43.3),C5(δ51.7),C7(δ70.5),C15(δ70.8),C4(δ74.3),C2(δ116.2),C11(δ129.2),C10(δ137.1),C3(δ154.4),C1(δ165.6), and is identified as brefeldin A as compared to known compounds.

The yield of the brefeldin A in the rice solid culture medium is 2.88mg/g (rice amount) through detection; the yield of BFA with purity of greater than 99% of the obtained brefeldin A after separation and purification is 1.58mg/g (rice).

The BFA of the embodiment does not need to use macroporous resin for purification, the BFA content in the extract liquid obtained by extracting the strain with ethyl acetate after extracting the strain with 95% ethanol is high, other impurities are less, the BFA is separated out only in the volatilization process of the ethyl acetate extract solvent, and the BFA with purity not less than 73.4% can be obtained by separating through the simple crystal washing process of petroleum ether.

Example 3: application of 5L conical flask amplified fermentation penicillium BT-38 strain in preparation of brefeldin A

(1) Inoculating penicillium BT-38 to PDA slant culture medium, culturing at 28deg.C for 2 days, inoculating strain to fungus liquid culture medium, and culturing at 28deg.C for 9 days to obtain seed solution; inoculating the seed liquid into a rice culture medium in a volume ratio of 50%; fermenting at 28 deg.c for 5 days to obtain fermented product.

The components of the worm-eaten rice culture medium are as follows: water and worm-eaten rice, wherein the ratio of worm-eaten rice to water is 20:22.5g/ml, sterilized at 121℃for 20min.

(2) The obtained fermentation product is separated and purified to obtain the brefeldin A.

The separation and purification comprises the following steps: extracting and concentrating the fermentation product by using 95% ethanol, and extracting by using ethyl acetate; and (3) distilling the obtained extract phase under reduced pressure, adding petroleum ether into the obtained crude extract containing the brefeldin A, centrifuging, taking precipitate, adding ethanol, heating to prepare a brefeldin A saturated solution, filtering, cooling for crystallization, and recrystallizing to obtain the brefeldin A.

The extraction temperature of 95% ethanol is 60 ℃, and the volume ratio of the fermentation product to 95% ethanol is 1: the extraction time of the 16, 95% ethanol is 30min.

(3) The concentration of brefeldin a was analyzed by high performance liquid chromatography: mashing the fermented culture medium, taking out 5g, adding 40ml of 95% ethanol, heating and refluxing for 20min at 100deg.C, taking 1ml of supernatant, volatilizing, adding 1.0ml of methanol to dissolve sample, filtering with 0.45 μm microfiltration membrane, and analyzing filtrate by using Shimadzu HPLC; HPLC analysis conditions: the chromatographic column is a 250mm×4.6mm Rascil C18 reverse phase column; the mobile phase is methanol/water (65:35, v/v flow rate 1.0mL/min, sample injection amount 2.0 μl, and the effluent after the column is sequentially subjected to UV detection with UV detection wavelength of 230nm.

The yield of brefeldin A in the rice solid medium is 3.16mg/g (worm-eaten rice).

Example 4: application of penicillium BT-38 strain in preparation of brefeldin A by using moldy rice

(1) Inoculating penicillium BT-38 to PDA slant culture medium, culturing at 28deg.C for 4 days, inoculating strain to fungus liquid culture medium, and culturing at 28deg.C for 5 days to obtain seed solution; inoculating the seed solution into a mildewed rice culture medium in a volume ratio of 25%; fermenting at 28 ℃ for 10 days to obtain a fermentation product;

wherein the PDA culture medium comprises the following components: potato starch: 11.0g, glucose: 20.0g of agar 15.0g, pH 5.6.+ -. 0.2 in 1000ml of distilled water;

Preparation of mildewed rice: soaking rice in water, and culturing in culture medium at 37deg.C to maintain the temperature and humidity required for microorganism growth to mold rice. And taking out the rice after 5 days, drying the rice to constant weight, and carrying out experiments.

The components of the mildewed rice culture medium are water and mildewed rice, wherein the concentration of the mildewed rice is 20:22.5g/L, and the mildewed rice is sterilized at 121 ℃ for 20min.

(2) The concentration of brefeldin a was analyzed by high performance liquid chromatography: mashing the fermented culture medium, taking out 5g, adding 40ml of 95% ethanol, heating and refluxing at 70 ℃ for 20min, taking 1ml of supernatant, volatilizing and drying, adding 1.0ml of methanol to dissolve a sample, filtering with a 0.45 μm microfiltration membrane, and analyzing the filtrate by using Shimadzu HPLC; HPLC analysis conditions: the chromatographic column is a 250mm×4.6mm Rascil C18 reverse phase column; the mobile phase is methanol-water (65:35, v/v flow rate 1.0mL/min, sample injection amount 2.0 μL, UV detection of effluent after column, UV detection wavelength 230nm;

the yield of briadelphax striatellum A in the mildewed rice culture medium is 2.37mg/g (mildewed rice amount).

Example 5: the distribution of aflatoxin during BFA production of rice containing aflatoxin is simulated by adding aflatoxin

(1) Taking 1g of worm-eaten rice culture medium fermented by penicillium BT-38 in the first experimental case, adding 0.5mg of aflatoxin, simulating the production of BFA by using rice containing aflatoxin, and examining the distribution of aflatoxin;

(2) The obtained solid fermentation culture medium is subjected to the distribution of the isolated and purified aflatoxin;

the separation and purification comprises the following steps: extracting and concentrating the fermentation product by using 95% ethanol, and extracting by using ethyl acetate; and (3) distilling the obtained extract phase under reduced pressure, adding petroleum ether into the obtained crude extract containing the brefeldin A, centrifuging, taking precipitate, adding methanol to prepare a brefeldin A saturated solution, filtering, crystallizing overnight at room temperature, and recrystallizing to obtain the brefeldin A.

(3) The concentration of aflatoxin was analyzed by high performance liquid chromatography: mashing the fermented culture medium, taking out 1g, adding 0.5g of aflatoxin, adding 8ml of 95% ethanol, heating and refluxing at 70 ℃ for 20min for three times, volatilizing and drying 1ml of each supernatant, adding 1.0ml of methanol to dissolve a sample, filtering by using a 0.45 mu m microfiltration membrane, and analyzing the filtrate by using Shimadzu HPLC; HPLC analysis conditions: the chromatographic column is a 250mm×4.6mm Rascil C18 reverse phase column; the mobile phase is methanol-water (65:35, v/v flow rate 1.0mL/min, sample injection amount 2.0 μL, UV detection of effluent after column, UV detection wavelength 230nm;

the first extraction of aflatoxin in the rice solid fermentation product is 96% of the total three extractions.

The invention has been described above in connection with preferred embodiments, which are, however, exemplary only and for illustrative purposes. On this basis, the invention can be subjected to various substitutions and improvements, and all fall within the protection scope of the invention.

Sequence listing

<110> Zhejiang university of Chinese medicine

<120> Penicillium brefeldianum strain and application thereof in preparation of brefeldin A

<130> WHLY22-025

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 565

<212> DNA

<213> Penicillium branchii BT-38 Strain ITS (Penicillium glaucoroseum)

<400> 1

ctgcggaagg atcattaccg agtgagggcc ctctgggtcc aacctcccac ccgtgtttat 60

catacctagt tgcttcggcg ggcccgccgt catggccgcc ggggggcacc cgcccccggg 120

cccgcgcccg ccgaagcccc ccctgaacgc tgtctgaaga ttgctgtctg agcgattagc 180

taaatcagtt aaaactttca acaacggatc tcttggttcc ggcatcgatg aagaacgcag 240

cgaaatgcga taagtaatgt gaattgcaga attcagtgaa tcatcgagtc tttgaacgca 300

cattgcgccc cctggtattc cggggggcat gcctgtccga gcgtcattgc tgccctcaag 360

cacggcttgt gtgttgggcc cccgcccccc ggctcccggg gggcgggccc gaaaggcagc 420

ggcggcaccg cgtccggtcc tcgagcgtat ggggcttcgt cacccgctct gtaggcccgg 480

ccggcgcccg ccggcgaccc ccctcaatct ttctcaggtt gacctcggat caggtaggga 540

tacccgctga acttaagcat atcaa 565

Claims

1. Penicillium strain, deposited in China general microbiological culture Collection center, accession number: CGMCC No.20244, named Penicillium BT-38, classified as Penicillium glaucoroseum.

2. Use of a penicillium strain according to claim 1 for the preparation of brefeldin a.

3. The use according to claim 2, characterized in that: the method comprises the steps of taking worm-eaten or moldy rice as a substrate, fermenting and culturing the penicillium BT-38 at the temperature of 20-35 ℃ for 3-11 days, and separating and purifying the obtained fermentation product to obtain the brefeldin A.

4. A use according to claim 3, characterized in that: the worm-eaten or moldy rice is mixed with water to prepare a solid culture medium for fermentation culture.

5. The use according to claim 3, wherein the step of fermentation culture is:

6. The use according to claim 5, characterized in that: the main components of the worm-eaten or moldy rice culture medium are water and worm-eaten or moldy rice, wherein the initial water content of the worm-eaten or moldy rice is 46-61%, and the rice is sterilized at 121 ℃ for 20min;

Composition of the fungal liquid medium: peptone 5.0 g, glucose: 20.0 g, yeast powder: 2.0 g, dipotassium hydrogen phosphate 1.0 g g, magnesium sulfate 0.5 g and pH value 6.4+/-0.2 are added into 1000ml of distilled water.

7. Use according to claim 3, characterized in that the separation and purification comprises the following steps:

Extracting and concentrating the fermentation product by ethanol with the volume percentage of 60-100% to obtain an extracting solution and solid residues, and extracting the extracting solution by ethyl acetate; and (3) distilling the obtained extract phase under reduced pressure, adding petroleum ether into the obtained crude extract containing the brefeldin A, centrifuging, taking the precipitate to obtain a crude product of the brefeldin A, adding methanol or ethanol, preparing Cheng Bulei phenanthrenedere A saturated solution, filtering while the solution is hot, and cooling for crystallization to obtain the brefeldin A.

8. The use according to claim 7, characterized in that: the ethanol extraction control temperature is 20-100 ℃, and the mass volume ratio of the fermentation product in the ethanol extraction step to ethanol is 1: 0.5-32 (g: ml), and the extraction time is 5-60 min.

9. The use according to any one of claims 2-8, characterized in that: the purity of the separated brefeldin A is more than or equal to 99 percent.

10. Use according to any one of claims 3-7, characterized in that: the broglifehrin A in the fermentation product,

The yield of the rice in the worm-eaten rice culture medium is more than or equal to 2.88 mg/g (worm-eaten rice quantity);

the yield of the mildewed rice culture medium is more than or equal to 2.37 mg/g (mildewed rice quantity).