CN115521877A

CN115521877A - Penicillium brefeldianum strain and application thereof in preparation of brefeldin A

Info

Publication number: CN115521877A
Application number: CN202210119913.XA
Authority: CN
Inventors: 桑夏楠; 曹岗; 韩欣; 单琪媛; 华凯
Original assignee: Zhejiang Chinese Medicine University ZCMU
Current assignee: Zhejiang Chinese Medicine University ZCMU
Priority date: 2022-01-25
Filing date: 2022-01-25
Publication date: 2022-12-27
Anticipated expiration: 2042-01-25
Also published as: CN115521877B

Abstract

The invention relates to the technical field of microorganisms, and particularly relates to a penicillium brefeldianum strain and application thereof in preparation of brefeldin A. A Penicillium bracteatum strain (Penicillium glaucoseum) is preserved in China general microbiological culture Collection center in 20 months in 2020 year in 08, with the preservation number: CGMCC No.20244, named as Penicillium bracteatum BT-38. The address of the depository: the institute of microbiology, national academy of sciences No. 3, xilu No.1, beijing, chaoyang, beijing. The application of the invention is specifically that the method takes worm-eaten or moldy rice as a substrate, performs fermentation culture on the penicillium brefeldianum BT-38 at the temperature of 20-35 ℃, the culture time is 3-11 days, and the obtained fermentation product is separated and purified to obtain the high-purity brefeldin A.

Description

Penicillium brefeldianum strain and application thereof in preparation of brefeldin A

Technical Field

The invention relates to the technical field of microorganisms, and particularly relates to a penicillium brefeldianum strain and application thereof in preparation of brefeldin A.

Background

Rice plays a leading role in providing food to people. Farmers generally use conventional storage containers to store rice, but a part of the rice in the storage container is damaged or rotted by various biological factors. Biological factors include fungi, mites, molds, insects, pests, rodents, lizards, birds and the like. Among the common biologies, beetles and moths are the major rice storage pests found in tropical countries that cause loss and deterioration of stored rice. Mycotoxin contamination is another significant factor in rice loss, and large quantities of grain are contaminated with mycotoxins produced by storage fungi worldwide. Mold and mycotoxins cause rice loss and are a risk factor in the food value chain. Wherein high concentrations of aflatoxin can lead to aflatoxin poisoning, leading to serious illness and even death. Therefore, when people suffer from the growth of insects or mildew of rice, the rice can be discarded to cause huge waste. Therefore, the microbial secondary metabolite is produced by utilizing the worm-eaten and moldy rice, so that the worm-eaten and moldy rice is recycled, and is more green, ecological and environment-friendly.

Microbial fermentation includes solid fermentation (SSF) and liquid fermentation (SmF). Among them, solid fermentation has been a thousand years old and has been the only means of microbial fermentation for a long time. However, in the 40's of the 20 th century, as scientists produced penicillins through liquid fermentation, more and more antibiotics were isolated through liquid fermentation, making liquid fermentation an absolute position in antibiotic production. In recent years, solid fermentation has been more and more regarded, but has been focused on agricultural production. To our knowledge this patent provides reference to the first case where antibiotics can be produced using the solid fermentation industry for subsequent solid fermentation production of antibiotics. The most significant difference between solid fermentation and liquid fermentation is that no large amount of water is added to the culture medium, and thus the method has the disadvantages of long fermentation time, poor fermentation fluidity and difficulty in accurately controlling the fermentation process. Meanwhile, the solid fermentation has many advantages because the water content in the fermentation tank is low, the volume of the fermentation tank used for the solid fermentation is smaller, the water heat absorption and energy consumption in the sterilization process are low, and the extraction and concentration cost is low. Typically, the product is concentrated and submerged in the substrate, the fermented solids can be immediately extracted by direct addition of solvent, and capital and operating costs of wastewater treatment are reduced or eliminated.

Several studies have shown that fungi grown under SSF can meet the increasing global demand for secondary metabolites. Still other examples show that SSF produces large amounts of secondary metabolites over a short period of time, producing antibiotics that are more stable than liquid fermentations. SSF provides the cultured microorganisms with an environment as close as possible to their natural environment, which is the main reason why microorganisms perform well in SSF and achieve higher product yields. However, because of the large amount of solids extracted, one also extracts more concentrated impurities, and the cost of purification is proportional to the concentration of inert compounds. This may in fact lead to an increase in the recovery costs, in particular in terms of the extraction of secondary metabolites. Therefore, the isolation and purification of the final product is generally considered a challenge of this technology, often accounting for 70-80% of the total fermentation process.

Brefeldin a (BFA) is a naturally occurring macrolide antibiotic with 13-membered ring, which has the effect of inhibiting the process of protein transport from the endoplasmic reticulum to the golgi complex. BFA has been found to have antibacterial, antifungal and antitumor activity. BFA is used as a protein transport inhibitor, can influence the protein transport and processing processes, has become an important molecular tool for cell biologists to research the signal transduction pathway of mammalian cells, has a good inhibition effect on part of human tumor cells, can be further developed into an anti-tumor medicament or can be used as a lead compound of the anti-tumor medicament for development, and has certain market requirements. The reports about BFA fermentation production are liquid fermentation, and the method has the advantages of complex process, low efficiency, complex extraction and separation process, poor economy, large amount of generated wastewater and serious environmental pollution. The Chinese patent with publication number CN101445784A discloses a technology for producing BFA by liquid fermentation, wherein the raw materials are all high-purity chemical products, the price is high, the environmental protection is poor, and the liquid fermentation process has the disadvantages of much water, large occupied area and much generated wastewater.

Disclosure of Invention

One of the purposes of the invention is to provide a penicillium brefeldianum strain which can be used for producing high-purity brefeldin A by fermenting with worm-eaten or moldy rice as a substrate.

The invention also aims to provide an application of the penicillium brefeldianum strain in preparation of brefeldin A.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

a Penicillium bracteatum strain (Penicillium glaucosum) is preserved in China general microbiological culture Collection center in 20 months and 08 months in 2020, with the preservation number: CGMCC No.20244, named as Penicillium bracteatum BT-38. The address of the depository: the institute of microbiology, national academy of sciences No. 3, xilu No.1, beijing, chaoyang, beijing. The penicillium brevicornum BT-38 is separated from rhizosphere soil bacteria of a medicinal plant, namely bighead atractylodes rhizome, collected in Zhejiang.

The application of the penicillium brefeldianum strain in preparing brefeldin A is provided.

Preferably, taking worm-eaten or mildewed rice as a substrate, carrying out fermentation culture on the penicillium brefeldianum BT-38 at the temperature of 20-35 ℃, wherein the culture time is 3-11 days, and separating and purifying the obtained fermentation product to obtain the brefeldin A.

Preferably, the worm-eaten or mildewed rice is mixed with water to prepare a solid culture medium for fermentation culture.

Preferably, the fermentation culture step is:

inoculating penicillium brevicornum BT-38 into a PDA culture medium, culturing for 2-7 days at 25-35 ℃, selecting strains, inoculating into a fungus liquid culture medium, and culturing for 2-9 days at 25-35 ℃ to obtain a seed solution;

the seed liquid is inoculated to a culture medium of the worm-eaten or mildewed rice by the volume ratio of 1-50%.

Preferably, the culture medium for the worm-eaten or mildewed rice mainly comprises water and the worm-eaten or mildewed rice, wherein the initial water content of the worm-eaten or mildewed rice is 46-61%, and the worm-eaten or mildewed rice is sterilized at 121 ℃ for 20min.

Preferably, the composition of the fungal liquid medium is: peptone 5.0g, glucose: 20.0g, yeast powder: 2.0g, 1.0g of dipotassium hydrogen phosphate, 0.5g of magnesium sulfate and a pH value of 6.4 +/-0.2 were added to 1000ml of distilled water.

Preferably, the separation and purification comprises the following steps:

extracting the fermentation product with 60-100% ethanol by volume percentage, concentrating to obtain an extracting solution and solid residues, extracting the extracting solution with ethyl acetate to obtain an extract phase, distilling under reduced pressure, adding petroleum ether into the obtained crude extract containing brefeldin A, centrifuging, taking the precipitate to obtain a crude product of brefeldin A, adding methanol or ethanol to prepare a saturated solution of brefeldin A, filtering while hot, cooling and crystallizing to obtain the brefeldin A. After separation and purification, brefeldin A with the purity of more than or equal to 99 percent can be obtained.

Preferably, the ethanol extraction temperature is controlled to be 20-100 ℃, and the mass volume ratio of the fermentation product to the ethanol in the ethanol extraction step is 1: 03-32 (g: m 1), and the extraction time is 5-60 min.

Preferably, the purity of the separated brefeldin A is more than or equal to 99%.

Preferably, brefeldin A in the fermentation product,

the yield in the culture medium of the worm-eaten rice is more than or equal to 2.88mg/g (the amount of the worm-eaten rice);

the yield in the moldy rice culture medium is more than or equal to 2.37mg/g (moldy rice amount);

the yield of BFA with purity of more than 99% after separation and purification in rice culture medium was 138mg/g (rice amount).

The application of the present invention eliminates capital and operating costs of sewage treatment and produces a high nutrient content of solid residue. And the aflatoxin is added to simulate the mould of the rice containing the aflatoxin, and the extraction process of the aflatoxin in the rice is investigated. Experimental results prove that 98% of aflatoxin is extracted, and the content of aflatoxin in the remaining solid residue is remarkably reduced, so that the aflatoxin can be further applied to feeds or biological bacterial manure, and potential benefits of reuse of mildewed rice are provided.

The application of the invention has very low cost for separating and purifying the target product, which is as low as 10% of the fermentation cost. Compared with the common solid fermentation separation and purification cost, the method reduces the cost by 50 to 60 percent. The solid fermentation process has short fermentation time which only needs 8 days, and is 1/4 of the common solid fermentation time.

Compared with the prior art, the invention has the beneficial effects that:

1. the brefeldin A prepared by fermenting the strain has the yield of not less than 2.88mg/g (the amount of worm-eaten rice), and the yield of BFA with the yield of more than 99 percent is 1.58mg/g (the amount of rice). The process is simple, the strain is a wild strain, the activity is strong, the quantity of produced brefeldin A analogues is small, the produced waste residue has high nutrition content, and the utilization degree is high;

2. the BFA is produced by adopting solid fermentation, and the worm-eaten and moldy rice is taken as a culture medium, so that the BFA is fermented by directly using agricultural products, has low price and is more economic and environment-friendly; moreover, each liter of the culture medium of the worm-eaten and mildewed rice contains about ten times of the volume of the liquid culture medium, wastewater is hardly generated in the production process, and the generated solid waste residues contain about 10.0 percent of protein, about 1.1 percent of fat and about 80.8 percent of carbohydrate, can be further applied to animal feed or agricultural fertilizers, are pollution-free and are more environment-friendly;

3. the separation and purification cost of the target product by the application of the method is very low, and is as low as 10% of the fermentation cost. Compared with the common solid fermentation separation and purification cost, the cost is reduced by 50 to 60 percent;

4. in the invention, the adopted solid fermentation process for extracting, separating and purifying the solvent can be completed only by ethanol, ethyl acetate and petroleum ether, and has low toxicity and environmental protection. The solid fermentation process of the invention has short fermentation time, the maximum yield only needs 8 days, which is 1/4 of the common solid fermentation time, and the fermentation period is greatly shortened. The solid fermentation process has low quality requirement on rice, even the rice containing low content of aflatoxin can be used as a raw material, and the aflatoxin is extracted and concentrated into petroleum ether supernatant, so that the solid fermentation process can be used for treating the rice products. The solid fermentation process of the invention is amplified and fermented similarly to a red yeast fermentation process, the red yeast fermentation process develops well in China, but in the natural pigment industry of China, the process can be fully utilized due to repeated construction and excess production capacity of certain natural pigment products.

Drawings

FIG. 1 shows a colony morphology of Penicillium Brevibacterium BT-38 of example 1;

FIG. 2 shows a seed liquid diagram of Penicillium Brevibacillus BT-38 of example 1;

FIG. 3 shows a schematic fermentation diagram of a rice medium in example 2;

FIG. 4 shows an HPLC plot of the fermentation product in example 2;

FIG. 5 shows HPLC plots of ethyl acetate extracts of fermentation products containing brefeldin A in example 2;

FIG. 6 shows an HPLC chart of the supernatant after centrifugation of crude brefeldin A-containing extract with petroleum ether in example 2;

FIG. 7 shows an HPLC chart of the precipitate of the crude brefeldin A-containing extract of example 2 after centrifugation with petroleum ether;

FIG. 8 shows the results of measurement of the content of solid residue after extraction in example 2;

FIG. 9 shows an HPLC plot of brefeldin A at greater than 99% in example 2;

FIG. 10 shows a crystal pattern of brefeldin A at a content of more than 99% in example 2;

FIG. 11 shows a hydrogen spectrum of brefeldin A in example 2;

FIG. 12 shows the carbon spectrum of brefeldin A in example 2;

fig. 13 shows a basic flowchart in embodiment 2.

Detailed Description

The technical solution of the present invention will be further specifically described below by way of specific examples. It is to be understood that the practice of the invention is not limited to the following examples, and that any variations and/or modifications may be made thereto without departing from the scope of the invention.

In the present invention, all parts and percentages are by weight, unless otherwise specified, and the equipment and materials used are commercially available or commonly used in the art. The methods in the following examples are conventional in the art unless otherwise specified.

Example 1: identification of Penicillium bracteatum BT-38

The Penicillium bracteatum is named as Penicillium bracteatum BT-38, is preserved in China general microbiological culture Collection center in 20 months of 08 in 2020, and has the preservation number: CGMCC No.20244.

The penicillium brefeldianum is obtained by the following procedure:

adding sterile water into a root soil sample of medicinal plant rhizoma Atractylodis Macrocephalae collected in Zhejiang, taking supernatant, inoculating into PDA culture medium, and culturing at 28 deg.C for 6 days; separating single bacterial colony, inoculating single bacterial strain to PDA culture medium one by one, and culturing at 28 deg.C for 6 days to obtain penicillium brejust BT-38; preserving at 4 ℃ for later use.

Wherein, the PDA culture medium comprises the following components: potato starch: 11.0g, glucose: 20.0g of agar, 15.0g of agar, pH 5.6. + -. 0.2 was added to 1000m1 of distilled water.

The characteristics of the Penicillium bracteatum BT-38 strain are as follows: colony morphology: the strain BT-38 is well produced on a solid PDA culture medium, and the colony is white villous in the early growth stage and has villous edges; then the middle of the colony gradually becomes green yellow; the colonies had wrinkles, were opaque, and the back was brownish yellow. The colony morphology is shown in FIG. 1.

ITS-DNA sequence of

<xnotran> CTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCATACCTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGGCACCCGCCCCCGGGCCCGCGCCCGCCGAAGCCCCCCCTGAACGCTGTCTGAAGATTGCTGTCTGAGCGATTAGCTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGCCCCCCGGCTCCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCCTCAATCTTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA ( SEQ ID No. 1), MEGA 4 NCBI GENBANK , (Penicillium) 100.00%, BT-38 . </xnotran>

Example 2: application of fermentation production of brefeldin A by using penicillium brefeldianum BT-38

The method for producing brefeldin A by fermenting the penicillium brevum BT-38 comprises the following specific steps:

1. inoculating Penicillium brevicornum BT-38 into PDA culture medium, culturing at 28 deg.C for 5 days, selecting strain, inoculating into 200ml fungus liquid culture medium, and culturing at 28 deg.C for 5 days to obtain seed solution, the picture is shown in FIG. 2; inoculating the seed liquid to 200g of rice culture medium; after fermenting at 28 ℃ for 8 days, a fermentation product was obtained, and the physical photograph is shown in FIG. 3. The HPLC profile of the fermentation product is shown in FIG. 4.

Wherein, the components of the PDA culture medium are as follows: potato starch: 11.0g, glucose: 20.0g of agar, 15.0g of agar, pH 5.6. + -. 0.2 was added to 1000ml of distilled water.

Composition of fungal liquid medium: peptone 5.0g, glucose: 20.0g, yeast powder: 2.0g, 1.0g of dipotassium hydrogen phosphate, 0.5g of magnesium sulfate and a pH value of 6.4 +/-0.2 were added to 1000ml of distilled water.

The rice culture medium comprises water and rice, wherein the rice has an initial water content of 45%, and is sterilized at 121 deg.C for 20min.

2. And separating and purifying the obtained fermentation product to obtain brefeldin A.

The separation and purification steps are as follows: reflux-extracting the fermented product obtained after fermentation of Penicillium bracteatum BT-38 with 3.2L of 95% (volume) ethanol, concentrating to 150ml, and extracting twice with 150ml ethyl acetate (HPLC chart of ethyl acetate extract is shown in FIG. 5); and distilling the obtained extract phase under reduced pressure to obtain about 2.9 g of crude extract containing brefeldin A, adding 5ml of petroleum ether, centrifuging to obtain precipitate, adding methanol to prepare a saturated solution of brefeldin A, filtering, and crystallizing at room temperature overnight to obtain about 312mg of brefeldin A.

In this example, the temperature of 95% ethanol extraction was 100 ℃, and the mass-to-volume ratio of the fermentation product to 95% ethanol was 1:8 (g: m 1), and the extraction time is 60min.

HPLC charts of the supernatant and the precipitate obtained after petroleum ether centrifugation are shown in FIG. 6 and FIG. 7, respectively.

The solid residue obtained after ethanol extraction, the content of which is measured in FIG. 8, FIG. 8 illustrates: the solid waste residue produced by the method contains about 10.0 percent of protein, 1.1 percent of fat and 80.8 percent of carbohydrate respectively;

the HPLC chart of the final product brefeldin A is shown in FIG. 9, and FIG. 9 illustrates that: the brefeldin A obtained by the method has the purity of more than 99 percent.

The hydrogen spectrum and carbon spectrum of brefeldin A are shown in FIG. 11 and 12, respectively. The resulting carbon spectrum of brefeldin A (DMSO-d) ₆ ) The compound was shown to contain 16 carbon signals: c16 (δ 20.7), C13 (δ 26.4), C12 (δ 031.4), C14 (δ 1.4), C6 (δ 2.9), C8 (δ 3.0), C9 (δ 4.3), C5 (δ 5.7), C7 (δ 70.5), C15 (δ 70.8), C4 (δ 74.3), C2 (δ 116.2), C11 (δ 129.2), C10 (δ 137.1), C3 (δ 154.4), C1 (δ 165.6), determined as brefeldin A compared to known compounds.

Through detection, the yield of brefeldin A in the rice solid culture medium is 2.88mg/g (rice amount); the yield of BFA with purity of brefeldin A more than 99% obtained by separation and purification is 1.58mg/g (rice weight).

The BFA of the embodiment does not need to be purified by using macroporous resin, after the strain is extracted by 95% ethanol, the extract obtained by extracting with ethyl acetate has high BFA content and less other impurities, the BFA is separated out only in the volatilization process of an ethyl acetate extract solvent, and the BFA with the purity of not less than 73.4% can be separated and obtained by a simple petroleum ether crystal washing process.

Example 3: application of 5L conical flask amplification fermentation penicillium brefeldianum BT-38 strain in preparation of brefeldin A

(1) Inoculating Penicillium bracteatum BT-38 to a PDA slant culture medium, culturing at 28 deg.C for 2 days, selecting strains, inoculating to a fungus liquid culture medium, and culturing at 28 deg.C for 9 days to obtain a seed solution; inoculating the seed liquid to a rice culture medium by 50 percent of volume ratio; fermenting at 28 deg.C for 5 days to obtain fermented product.

Composition of fungal liquid medium: peptone 5.0g, glucose: 20.0g, yeast powder: 2.0g, dipotassium hydrogenphosphate 1.0g, magnesium sulfate 0.5g, pH 6.4. + -. 0.2 were added to 1000ml of distilled water.

The components of the worm-eaten rice culture medium are as follows: water and worm-eaten rice, wherein the ratio of the worm-eaten rice to the water is 20:22.5g/ml, and sterilizing at 121 deg.C for 20min.

(2) And separating and purifying the obtained fermentation product to obtain brefeldin A.

The separation and purification comprises the following steps: extracting the fermentation product with 95% ethanol, concentrating, and extracting with ethyl acetate; and carrying out reduced pressure distillation on the obtained extract phase, adding petroleum ether into the obtained crude extract containing brefeldin A, centrifuging, taking the precipitate, adding ethanol, heating to prepare a brefeldin A saturated solution, filtering, cooling, crystallizing and recrystallizing to obtain the brefeldin A.

The extraction temperature of 95% ethanol is 60 deg.C, the volume ratio of fermentation product and 95% ethanol is 1: 16, and the extraction time of 95% ethanol is 30min.

(3) The concentration of brefeldin a was analyzed by high performance liquid chromatography: mashing the fermented culture medium, taking out 5g, adding 40ml 95% ethanol, heating and refluxing at 100 deg.C for extracting for 20min, taking out 1ml of supernatant, evaporating to dryness, adding 1.0ml of methanol to dissolve the sample, filtering with 0.45 μm microfiltration membrane, and analyzing the filtrate by Shimadzu HPLC; conditions for HPLC analysis: the chromatographic column is a 250mm multiplied by 4.6mm Rascil C18 reversed phase column; the mobile phase is methanol and water (65: 35, v/v flow rate 1.0mL/min, sample amount is 2.0 μ L, and the effluent after column is sequentially subjected to UV detection with wavelength of 230nm.

The yield of brefeldin A in the rice solid medium was 3.16mg/g (amount of worm-eaten rice).

Example 4: application of penicillium brevipedunculatum BT-38 strain in preparation of brefeldin A by using moldy rice

(1) Inoculating eupenicillium brevicornum BT-38 to a PDA slant culture medium, culturing at 28 ℃ for 4 days, selecting strains, inoculating to a fungus liquid culture medium, and culturing at 28 ℃ for 5 days to obtain a seed liquid; inoculating the seed liquid to a moldy rice culture medium by 25% of volume ratio; fermenting at 28 deg.C for 10 days to obtain fermented product;

wherein the components of the PDA culture medium are as follows: potato starch: 11.0g, glucose: 20.0g of agar and 15.0g of agar are added into 1000ml of distilled water with the pH value of 5.6 +/-0.2;

Preparation of the mildewed rice: soaking rice eaten by worms in water, putting the rice into a culture medium in an incubator at 37 ℃, and keeping the temperature and humidity required by the growth of microorganisms to make the rice mildewed. After 5 days, the rice was taken out, dried to constant weight and subjected to the experiment.

The moldy rice culture medium comprises water and moldy rice, wherein the concentration of moldy rice is 20:22.5 g/L, and the moldy rice is sterilized at 121 deg.C for 20min.

(2) The concentration of brefeldin a was analyzed by high performance liquid chromatography: mashing the fermented culture medium, taking out 5g, adding 40ml 95% ethanol, heating and refluxing at 70 deg.C for extraction for 20min, taking out 1ml of supernatant, volatilizing and drying, adding 1.0ml of methanol to dissolve the sample, filtering with 0.45 μm microfiltration membrane, and analyzing the filtrate by Shimadzu HPLC; conditions for HPLC analysis: the chromatographic column is a 250mm multiplied by 4.6mm rassil C18 reversed phase column; the mobile phase is methanol and water (65: 35, v/v flow rate is 1.0mL/min, sample injection amount is 2.0 μ L, and effluent after column is detected by UV, wherein the wavelength of UV detection is 230nm;

the yield of brefeldin A in the moldy rice medium was 2.37mg/g (amount of moldy rice).

Example 5: aflatoxin addition to simulate the distribution of aflatoxin in BFA production of rice containing aflatoxin

(1) Taking 1g of a worm-eaten rice culture medium fermented by Penicillium brevibacillus BT-38 in the experimental case I, adding 0.5mg of aflatoxin, simulating the production of BFA by rice containing the aflatoxin, and inspecting the distribution of the aflatoxin;

(2) The distribution of the aflatoxin is separated and purified by the obtained solid fermentation medium;

the separation and purification comprises the following steps: extracting the fermentation product with 95% ethanol, concentrating, and extracting with ethyl acetate; and (3) carrying out reduced pressure distillation on the obtained extract phase, adding petroleum ether into the obtained crude extract containing brefeldin A, centrifuging, taking the precipitate, adding methanol to prepare a saturated solution of brefeldin A, filtering, carrying out overnight crystallization at room temperature, and recrystallizing to obtain the brefeldin A.

(3) The concentration of aflatoxin is analyzed by high performance liquid chromatography: mashing the fermented culture medium, taking out 1g, adding 0.5g of aflatoxin, adding 8ml of 95% ethanol, heating and refluxing at 70 ℃ for extraction for three times for 20min, volatilizing 1ml of supernatant, adding 1.0ml of methanol to dissolve a sample, filtering by using a 0.45-micrometer microfiltration membrane, and analyzing the filtrate by adopting Shimadzu HPLC; conditions for HPLC analysis: the chromatographic column is a 250mm multiplied by 4.6mm rassil C18 reversed phase column; the mobile phase is methanol and water (65: 35, v/v flow rate is 1.0mL/min, sample injection amount is 2.0 μ L, and effluent after column is detected by UV, wherein the wavelength of UV detection is 230nm;

the first extraction of the aflatoxin in the rice solid fermentation product is 96 percent of the total amount of the three extractions.

The present invention has been described above in connection with preferred embodiments, but these embodiments are merely exemplary and merely illustrative. On the basis of the above, the invention can be subjected to various substitutions and modifications, and the substitutions and the modifications are all within the protection scope of the invention.

Sequence listing

<110> Zhejiang university of traditional Chinese medicine

<120> Penicillium braumhenicum strain and application thereof in preparation of brefeldin A

<130> WHLY22-025

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 565

<212> DNA

<213> Penicillium breve BT-38 strain ITS (Penicillium glaucoseum)

<400> 1

ctgcggaagg atcattaccg agtgagggcc ctctgggtcc aacctcccac ccgtgtttat 60

catacctagt tgcttcggcg ggcccgccgt catggccgcc ggggggcacc cgcccccggg 120

cccgcgcccg ccgaagcccc ccctgaacgc tgtctgaaga ttgctgtctg agcgattagc 180

taaatcagtt aaaactttca acaacggatc tcttggttcc ggcatcgatg aagaacgcag 240

cgaaatgcga taagtaatgt gaattgcaga attcagtgaa tcatcgagtc tttgaacgca 300

cattgcgccc cctggtattc cggggggcat gcctgtccga gcgtcattgc tgccctcaag 360

cacggcttgt gtgttgggcc cccgcccccc ggctcccggg gggcgggccc gaaaggcagc 420

ggcggcaccg cgtccggtcc tcgagcgtat ggggcttcgt cacccgctct gtaggcccgg 480

ccggcgcccg ccggcgaccc ccctcaatct ttctcaggtt gacctcggat caggtaggga 540

tacccgctga acttaagcat atcaa 565

Claims

1. A strain of eupenicillium brevicompactum is preserved in China general microbiological culture Collection center at 20 months 08 and 2020, and the preservation number is as follows: CGMCC No.20244, named as Penicillium bracteatum BT-38.

2. Use of the strain penicillium brefeldianum according to claim 1 for the preparation of brefeldin a.

3. Use according to claim 2, characterized in that: taking worm-eaten or mildewed rice as a substrate, carrying out fermentation culture on the penicillium brefeldianum BT-38 at the temperature of 20-35 ℃, wherein the culture time is 3-11 days, and separating and purifying the obtained fermentation product to obtain brefeldin A.

4. Use according to claim 3, characterized in that: the worm-eaten or mildewed rice is mixed with water to prepare a solid culture medium for fermentation culture.

5. Use according to claim 3, characterized in that the step of fermentative culture is:

6. Use according to claim 5, characterized in that: the culture medium for the worm-eaten or mildewed rice mainly comprises water and the worm-eaten or mildewed rice, wherein the initial water content of the worm-eaten or mildewed rice is 46-61 percent, and the worm-eaten or mildewed rice is sterilized for 20min at 121 ℃; the composition of the fungus liquid culture medium is as follows: peptone 5.0g, glucose: 20.0g, yeast powder: 2.0g, 1.0g of dipotassium hydrogen phosphate, 0.5g of magnesium sulfate and a pH value of 6.4 +/-0.2 were added to 1000ml of distilled water.

7. The use according to claim 3, wherein the separation and purification comprises the steps of:

extracting the fermentation product by using 60-100% ethanol by volume percentage, concentrating to obtain an extracting solution and solid residues, and extracting the extracting solution by using ethyl acetate; and (3) carrying out reduced pressure distillation on the obtained extract phase, adding petroleum ether into the obtained crude extract containing brefeldin A, centrifuging, taking the precipitate to obtain a crude product of brefeldin A, adding methanol or ethanol to prepare a saturated solution of brefeldin A, filtering while hot, cooling and crystallizing to obtain the brefeldin A.

8. Use according to claim 7, characterized in that: the temperature of ethanol extraction is controlled to be 20-100 ℃, the mass volume ratio of the fermentation product to the ethanol in the ethanol extraction step is 1: 0.5-32 (g: ml), and the extraction time is 5-60 min.

9. Use according to any one of claims 2-8, characterized in that: the purity of the brefeldin A obtained by separation is more than or equal to 99 percent.

10. Use according to any one of claims 3 to 7, characterized in that: the yield of brefeldin A in the fermentation product in a culture medium of the worm-eaten rice is more than or equal to 2.88mg/g (the worm-eaten rice quantity);

the yield in the moldy rice culture medium is more than or equal to 2.37mg/g (the amount of moldy rice);

the yield of BFA with the purity of more than or equal to 99 percent after separation and purification in the rice culture medium is 1.58mg/g (the amount of rice).