CN103374537B - Method for preparing enduracidin and strain produced thereby - Google Patents
Method for preparing enduracidin and strain produced thereby Download PDFInfo
- Publication number
- CN103374537B CN103374537B CN201210124398.0A CN201210124398A CN103374537B CN 103374537 B CN103374537 B CN 103374537B CN 201210124398 A CN201210124398 A CN 201210124398A CN 103374537 B CN103374537 B CN 103374537B
- Authority
- CN
- China
- Prior art keywords
- enramycin
- enduracidin
- fermentation
- strain
- sodium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a method for preparing enduracidin and a strain produced thereby. The strain disclosed by the invention is streptomyces fungicidius (Streptomyces fungicidius) BJX002; the preservation number is CGMCC No.6026. The method comprises the following steps: 1) inoculating seed solution of the strain into fermentation medium to ferment and cultivate, so as to obtain a fermentation liquor; 2) extracting the enduracidin from the fermentation liquor. The strain disclosed by the invention has strong ability of producing effective components A and B of the enduracidin; 10,000 mug/ml of fermentation liquor can be achieved; furthermore, the ability of producing the effective components A and B of the enduracidin is still kept at the original level after the strain disclosed by the invention is continuously inherited five generations; the genetic stability is good. By adopting the method for preparing the enduracidin by the strain disclosed by the invention, the efficiency of producing the enduracidin can be improved; the method is simple, low in cost and suitable for popularization and application in production of the enduracidin.
Description
Technical field
The present invention relates to a kind of method and the production bacterial strain thereof of preparing enramycin.
Background technology
Enramycin (Enramycin), has another name called Enramycin, enramycin, enramycin, enramycin.It is a kind of polypeptide antibiotics be combined into by unsaturated fatty acids and 17 seed amino acids produced by the actinomycetes of separating in soil (Streptomyces fungicidicus No.B5477) fermentation, be divided into enramycin A and enramycin B according to the difference of terminal aliphatic acid molecule, enramycin is the mixture of these two kinds of components.This medicine was researched and developed in 1966 by Japanese Takede Chemical Industries Ltd, within 1974, at Japanese official registration, was registered and widely used thereafter in many countries.1993, the Ministry of Agriculture of China ratified this medicine and registers in China.2005, domestic production enterprise and Schering Plough animal health company limited of the U.S. (Schering Plough Anima Health Corp.) started joint production enramycin premix.
Enramycin is polypeptide antibiotics, and its Antibacterial mechanism is the synthesis of anti-bacteria cell walls.Enramycin has very strong activity to gram positive bacterium, particularly has very strong inhibitory or killing effect to the harmful clostridium in enteron aisle, is 0.39 ~ 3.12g/ml to the minimum inhibition concentration (MIC) of gram positive bacterium.Enramycin can also change the colony balance in enteron aisle by the Growth and reproduction of unwanted bacteria in suppression enteron aisle, and absorption and the utilization of feed Middle nutrition material increase.Life-time service enramycin, bacterium also not easily produces resistance to it, does not also produce obvious crossing drug resistant between enramycin and other microbiotic.Because enramycin possesses above plurality of advantages, make it have good social benefit and environmental benefit, be a kind of novel green antibiotic, there are wide market outlook.
And in fermentation industry, improve the production efficiency of unit bacterial classification, under existing installation condition, output can be improved in the basis not increasing raw materials cost, power cost, human cost.
Summary of the invention
The object of this invention is to provide a strain kabicidin streptomycete to improve the efficiency of producing enramycin.
Another object of the present invention is to provide the method that application bacterial strain of the present invention produces enramycin.
Kabicidin streptomycete provided by the present invention is kabicidin streptomycete (Streptomyces fungicidicus) BJX002, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on April 23rd, 2012 and (be called for short CGMCC, address: Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101), Classification And Nomenclature is kabicidin streptomycete (Streptomyces fungicidicus), and preserving number is: CGMCC No.6026.
Twist, spore is spherical to oval, intermediate projections, smooth surface for the fibrillae of spores of kabicidin streptomycete BJX002, and on synthetic medium, aerial hyphae is canescence, and substrate mycelium is khaki color.On glycerine nitrate nutrient agar, gas silk is white to grey, and base silk is colourless.On glucose asparagine nutrient agar, gas silk is white extremely micro-grey, and base silk is colourless, can lysochrome be micro-yellow sometimes.On starch agar medium, gas silk is white extremely micro-grey, and base silk is colourless to micro-yellow.On calcium malate nutrient agar, gas silk is white extremely micro-grey, and base silk is colourless to micro-yellow.Can lysochrome without, some strain is pink colour, rear disappearance.On glycerine asparagine agar (ISP), inorganic salt Starch Agar (ISP), yeastex malt extract agar (ISP), oatmeal agar (ISP) substratum gas silk without or few, be white.Base silk reverse side is without discriminating pigment: light yellow or light lark.Can not lysochrome.On nutrient agar can lysochrome without or slightly tawny.On potato ball substratum gas silk without or white to micro-grey, the micro-yellow of base silk, to micro-grey, may have Vandyke brown element around base silk.This bacterial strain can make gelatine liquefication, and milk solidifies and peptonizes weak, and hydrolyzed starch is strong.Nitrate does not reduce or suspicious.Do not produce Melanoidins, tyrosine oxidase and H
2s.Utilize D-glucose, D-wood sugar, D-fructose, inositol, D-N.F,USP MANNITOL; Utilize suspicious to L-pectinose, sucrose, rhamnosyl, raffinose.
The invention provides a kind of method preparing enramycin, comprise the steps:
1) fermentation culture: the seed liquor of described bacterial strain is inoculated in fermentation culture in fermention medium and obtains fermented liquid;
2) from fermented liquid, enramycin is extracted.
Wherein, described strain culturing is cultivate 192-240 hour under the condition of temperature 25-30 DEG C.
Described fermentation medium components is: W-Gum 7.0-13.0g/L, glucose 9.1-16.9g/L, dipotassium hydrogen phosphate 0.14-0.26g/L, magnesium sulfate heptahydrate 0.7-1.3g/L, sodium-chlor 10.5-19.5g/L, calcium carbonate 1.54-2.86g/L.PH to 7.2 is regulated with 100g/L sodium hydroxide solution before described fermention medium sterilizing.
Described fermention medium is preferably as follows substratum: W-Gum 10g/L, glucose 13g/L, dipotassium hydrogen phosphate 0.2g/L, magnesium sulfate heptahydrate 1g/L, sodium-chlor 15.2g/L, calcium carbonate 2.2g/L.PH to 7.2 is regulated with 100g/L sodium hydroxide solution before described fermention medium sterilizing.
Inoculum size is preferably 5 ~ 15% (V/V), and described seed liquor is the seed liquor being cultured to logarithmic phase.
Described fermentation can be carried out under the condition of vibration, and the rotating speed of described vibration can be 170-210rpm, and rotation radius is 50mm.The rotating speed of described vibration is preferably 190rpm.
In order to prevent fermented liquid from concentrating because too much evaporating, causing false fermentation unit, keeping ambient relative humidity described in fermenting process to be 50-60%.
The temperature of described fermentation is preferably 28 DEG C.
The time of described fermentation is preferably 240 hours.
The ability that bacterial strain of the present invention produces enramycin is strong, and can reach 10000 μ g/ml fermented liquids, active princlple A and B ratio reach more than 3.0.And bacterial strain of the present invention passed for 5 generations continuously after it produces the ability of enramycin and A/B ratio all also remains on previous level, show that its genetic stability is good.Prepare the method for enramycin with bacterial strain of the present invention, the efficiency of producing enramycin can be improved, and method is simple, with low cost.Therefore, bacterial strain of the present invention and the method for preparing enramycin are suitable for applying in the production of enramycin.
Accompanying drawing explanation
Fig. 1 is the high-efficient liquid phase chromatogram of enramycin standard substance.
Fig. 2 is the high-efficient liquid phase chromatogram of enramycin in ferment filtrate.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.
W-Gum is purchased from Heilongjiang Longfeng Corn Development Co., Ltd., glucose is purchased from Jingpo Lake, Heilongjiang Province agricultural development company limited, corn starch is purchased from Zouping, Shandong crane concomitant product Science and Technology Ltd., peptone is purchased from various schools of thinkers Trade Co., Ltd. of Yanshi City, sodium-chlor is purchased from imperial salt (Mudanjiang) salt industry company limited, calcium carbonate is Long Gai industry company limited purchased from Hebei province's hole diameter, dipotassium hydrogen phosphate and magnesium sulfate heptahydrate are purchased from the huge chemicals factory in Dongli District, Tianjin, agar is purchased from Qingdao whale marine life company limited, yeast extract paste is purchased from Wuxue City Guo Bang biotechnology company limited, asparagine is purchased from traditional Chinese medicines group chemical reagent Beijing company limited.
The preparation of embodiment 1 bacterial strain
One, the preparation of bacterial strain
The high-throughput prescreening method used in this experiment is as follows:
Fermentation stage: adopt 96 hole depth orifice plates, fill substratum 0.3ml in every hole.Every hole access bacterial classification, 28 DEG C of quiescent culture 10 days.Used medium is by W-Gum 10g/L, and glucose 13g/L, dipotassium hydrogen phosphate 0.2g/L, magnesium sulfate heptahydrate 1g/L, sodium-chlor 15.2g/L, calcium carbonate 2.2g/L and agar 2.5g/L form, and solvent is water.PH to 7.2 is regulated with 100g/L sodium hydroxide solution before sterilizing.
The extraction stage: every hole 1ml methyl alcohol is soaked, smashs to pieces, get supernatant.
The mensuration stage: measure the UV absorption value of supernatant under 267nm by microplate reader.
1, isolated strains from soil
Get the soil on limit, Jingpo Lake, Ningan City, Heilongjiang Province, soil is made suspension, be inoculated in isolation medium by Soil Slurry and cultivate, picking list bacterium colony carries out dilution line separation and purification, obtains pure culture bacterial strain; Isolation medium by glucose 20g/L (adding after independent sterilizing), agar 20g/L, yeast extract paste 2g/L, asparagine 0.5g/L and K
2hPO
40.5g/L forms, and solvent is water; PH is 7.2; 115 DEG C, sterilizing 20 minutes;
Primary dcreening operation: the pure culture bacterial strain of acquisition carries out shake flask fermentation cultivation, centrifugal 5 minutes of fermentation liquor 8000rpm, supernatant liquor obtains ferment filtrate through the filtering with microporous membrane of 0.45 μm; Whether HPLC analytical method detects in fermented liquid containing enramycin; The bacterial strain that can produce enramycin carries out following serial mutagenesis respectively.
2, mutagenesis
(1) ultraviolet compounded Streptomycin sulphate mutagenesis
Get bacteria suspension 7ml, add in sterile petri dish, irradiate in 30cm place with the uv irradiating instrument of 30W.Setting irradiation time is respectively 60s, 90s.After isolation medium sterilizing, add the Streptomycin sulphate that final concentration 0.1 μ g/ml, 0.2 μ g/ml are degerming after filtration, paved plate, cultivate 10d for 28 DEG C.Picking list bacterium colony carries out high flux screening, shaking flask retrial according to the method described above.The superior strain obtained carries out next step mutagenesis.
(2) ultraviolet compounded Streptomycin sulphate mutagenesis (the 2nd takes turns)
The superior strain mutagenic obtained to the first round ultraviolet compounded Streptomycin sulphate uses the same method and again carries out ultraviolet compounded Streptomycin sulphate mutagenesis.Cultivate 10d for 28 DEG C.Picking list bacterium colony carries out high-throughput primary dcreening operation, shaking flask retrial.The superior strain obtained carries out next step mutagenesis.
(3) 5 FU 5 fluorouracil
By bacterial strain inclined plane inoculating in without in the starvation media of organic nitrogen source, overnight incubation, by inoculation in the 5 FU 5 fluorouracil plate containing different concns, the final concentration of 5 FU 5 fluorouracil is respectively in the 5 FU 5 fluorouracil plate of 50 μ g/ml, 100 μ g/ml.Cultivate 10d for 28 DEG C.Picking list bacterium colony carries out high-throughput primary dcreening operation, shaking flask retrial.The superior strain obtained carries out next step mutagenesis.
(4) microwave combined streptomycin mutagenesis
Take pulse-repetition as the 650W household microwave oven of 2450MHz, respectively radiotreatment is carried out to bacteria suspension in plate.After each irradiation 5s, plate is cooled, then irradiate, and irradiation time added up, accumulative irradiation time is respectively 60s, 90s.After isolation medium sterilizing, add the Streptomycin sulphate that final concentration 0.1 μ g/ml, 0.2 μ g/ml are degerming after filtration, paved plate.Cultivate 10d for 28 DEG C.Picking list bacterium colony carries out high-throughput primary dcreening operation, shaking flask retrial.The superior strain obtained carries out next step mutagenesis.
(5) NTG (nitrosoguanidine) combined streptomycin mutagenesis
Nitrosoguanidine (NTG) mutagenesis 0.1mol/L, the phosphate buffered saline buffer of pH6.0 prepares spore suspension, be the NTG process monospore suspension of 1mg/ml, 2mg/ml and 4mg/ml concentration respectively with final concentration, in 28 DEG C of concussion 30min, with physiological saline centrifuge washing spore 3 times, after dilution, coat the plate containing final concentration 0.1 μ g/ml, 0.2 μ g/ml Streptomycin sulphate degerming after filtration.Cultivate 10d for 28 DEG C.Picking list bacterium colony carries out high-throughput primary dcreening operation, shaking flask retrial.The superior strain of enramycin is obtained from screening.
Through above-mentioned series methods, finally obtain enramycin superior strain BJX002.
Two, the qualification of bacterial strain
Kabicidin streptomycete bacterial strain BJX002 is aerobic actinomycetes, and twist, spore is spherical to oval, intermediate projections, smooth surface for fibrillae of spores, and on synthetic medium, aerial hyphae is canescence, and substrate mycelium is khaki color.
The primer sequence used by the 16SrDNA of this bacterium of pcr amplification, PCR is:
Forward primer: 5 ' AGAGTTTGATCCTGGCTCAG3 '
Reverse primer: 5 ' AAGTCGTAACAAGGTAGCCGTA3 '
PCR primer is carried out gel electrophoresis, and finding identical with object stripe size, is 1481bp.Sequence is as shown in sequence table 1.
Above physiological and biochemical property shows that the mutant strain that the present invention obtains belongs to kabicidin streptomycete (Streptomyces fungicidicus), by its called after BJX002, this bacterial strain is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on April 23rd, 2012 and (is called for short CGMCC, address: Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101), preserving number is CGMCC No.6026.
Embodiment 2 ferment kabicidin streptomycin B JX002 produce enramycin
Application Response Surface Method optimizes superior strain BJX002 fermentation culture conditions.
Slant medium forms: by W-Gum 10g/L, glucose 13g/L, corn starch 10g/L, dipotassium hydrogen phosphate 0.2g/L, magnesium sulfate heptahydrate 1g/L, sodium-chlor 15g/L, calcium carbonate 2.2g/L form, and solvent is water.The pH value of slant medium is 7.2,121 DEG C, sterilizing 30min.
Seed culture medium forms: by W-Gum 20g/L, glucose 25g/L, corn starch 10g/L, peptone 5g/L, dipotassium hydrogen phosphate 0.1g/L, sodium-chlor 10g/L, calcium carbonate 5g/L form, and solvent is water.The pH value of seed culture medium is 7.2,121 DEG C, sterilizing 30min.
Fermention medium I forms: by W-Gum 7.0g/L, glucose 9.1g/L, dipotassium hydrogen phosphate 0.14g/L, magnesium sulfate heptahydrate 0.7g/L, sodium-chlor 10.5g/L, and calcium carbonate 1.54g/L forms, and solvent is water.PH to 7.2 is regulated with 100g/L sodium hydroxide solution before sterilizing.
Fermention medium II forms: by W-Gum 13.0g/L, glucose 16.9g/L, dipotassium hydrogen phosphate 0.26g/L, magnesium sulfate heptahydrate 1.3g/L, sodium-chlor 19.5g/L, and calcium carbonate 2.86g/L forms, and solvent is water.PH to 7.2 is regulated with 100g/L sodium hydroxide solution before sterilizing.
Fermention medium III forms: by W-Gum 10g/L, glucose 13g/L, dipotassium hydrogen phosphate 0.2g/L, magnesium sulfate heptahydrate 1g/L, sodium-chlor 15.2g/L, and calcium carbonate 2.2g/L forms, and solvent is water.PH to 7.2 is regulated with 100g/L sodium hydroxide solution before sterilizing.
One, the fermention medium I kabicidin streptomycete BJX002 that ferments is utilized to prepare enramycin
(1) ferment kabicidin streptomycete BJX002
1, slant culture:
Kabicidin streptomycete BJX002 is inoculated on slant medium, 28 DEG C, ambient relative humidity cultivates 10-12 days under being 50-60% condition.
2, seed culture
Take the inclined-plane lawn 1cm obtained in step one
2accessed the seed bottle that the sterilized seed culture medium of 30ml is housed, cultivate 44-48 hour (to logarithmic phase) under the following conditions: temperature is 28 DEG C, ambient relative humidity is 50-60%, rotating speed is 180-200rpm, rotation radius is 50mm, obtains seed culture fluid.
3, fermentation culture
Fermentation culture method: get above-mentioned seed culture fluid and be inoculated in by the inoculum size of 10% (V/V) in the triangular flask that the sterilized fermention medium of 30ml I is housed, fermentation culture 240 hours under the following conditions: temperature is 28 DEG C, humidity is 55%, rotating speed is 200rpm, rotation radius is 50mm, obtains fermented liquid.
(2) enramycin and output detection is extracted
1, extracting method is as follows:
(1) get 2ml fermented liquid, add and fill in the 10ml ground colorimetric cylinder of 8ml methyl alcohol, ultrasonic echography 20min, with the centrifugation 10min of 4000rpm, get supernatant solution, obtain 9.2-9.4ml supernatant altogether.
(2) get 1ml supernatant, with the organic phase filtering with microporous membrane of 0.45 μm, obtain fermentation vat liquor, to be measured.
2, HPLC analyzes:
Adopt Shimadzu LC-10A type high performance liquid chromatograph, 250mm × 4.6mm (id) stainless steel column, inside fills out the C18 reversed-phase column that Reliasil Cl8 model is Wondasil, column temperature 35 DEG C, get the fermentation vat liquor of step (2), sample size 20 μ l; With phosphate-buffered salt (pH8.2): acetonitrile (volume ratio is for 7:3) is separated for moving phase, and flow velocity is 1ml/min, UV detector is utilized to detect at wavelength 267nm place and automatically form separating spectrum; Under this chromatographic condition, as shown in Figure 1, the retention time of enramycin active princlple A and B is respectively about 16.5min and 28.5min to the color atlas of enramycin standard substance.
Calculating retention time in ferment filtrate is the elution peak area that about 16.5min and 28.5min locates, and calculates the content of enramycin A and B.In ferment filtrate, the color atlas of enramycin as shown in Figure 2.
3 repetitions are established in experiment, and result is taken the mean.Result shows, obtains the component A of 162.6 μ g/ml and the B component of 34.6 μ g/ml, A:B=4.7 in 20 μ l ferment filtrates.Adjust enramycin output is 9858 μ g/ml.
Two, the fermention medium II kabicidin streptomycete BJX002 that ferments is utilized to prepare enramycin
(1) ferment kabicidin streptomycete BJX002
1, slant culture:
With consistent described in step one.
2, seed culture:
With consistent described in step one.
3, fermentation culture:
Fermentation culture method: get above-mentioned seed culture fluid and be inoculated in by the inoculum size of 7% (V/V) in the bottle that the sterilized fermention medium of 30ml II is housed, fermentation culture 192 hours under the following conditions: temperature is 26 DEG C, ambient relative humidity is 50%, rotating speed is 200rpm, rotation radius is 50mm, obtains fermented liquid.
(2) enramycin and output detection is extracted
1, extracting method is as follows:
With consistent described in step one.9.4-9.5ml supernatant is obtained by 2ml broth extraction.Get 2ml supernatant, with the filtering with microporous membrane of 0.45 μm, obtain fermentation vat liquor, to be measured.
2, HPLC analyzes
Method is with consistent described in step one.
3 repetitions are established in experiment, and result is taken the mean.Result shows, obtains the component A of 156.7 μ g/ml and the B component of 34.8 μ g/ml, A:B=4.5 in 20 μ l ferment filtrates.Adjust enramycin output is 9576 μ g/ml.
Three, the fermention medium III kabicidin streptomycete BJX002 that ferments is utilized to prepare enramycin
(1) ferment kabicidin streptomycete BJX002
1, slant culture:
With consistent described in step one.
2, seed culture:
With consistent described in step one.
3, fermentation culture:
Fermentation culture method: get above-mentioned seed culture fluid and be inoculated in by the inoculum size of 10% (V/V) in the bottle that the sterilized fermention medium of 30ml III is housed, fermentation culture 216 hours under the following conditions: temperature is 30 DEG C, ambient relative humidity is 60%, rotating speed is 190rpm, rotation radius is 50mm, obtains fermented liquid.
(2) enramycin and output detection is extracted
1, extracting method is as follows:
With consistent described in step one.9.2-9.4ml supernatant is obtained by 2ml broth extraction.Get 1ml supernatant, with the filtering with microporous membrane of 0.45 μm, obtain fermentation vat liquor.
2, HPLC analyzes
Method is with consistent described in step one.
3 repetitions are established in experiment, and result is taken the mean.Result shows, obtains the component A of 166.8 μ g/ml and the B component of 36.3 μ g/ml, A:B=4.6 in 20 μ l ferment filtrates.Adjust enramycin output is 10156 μ g/ml.
Embodiment 3 bacterial strain genetic stability of the present invention detects
Mutant strain BJX002 is carried out inclined-plane go down to posterity, passed for 5 generations altogether, cultural method often for bacterium is consistent all as described in example 2 above, and the bacterium that every culture obtains all carries out fermenting and extracting according to method described in step one in embodiment 2, and calculates the ability of the enramycin that bacterial strain produces.
3 repetitions are established in experiment, and result is taken the mean.After result bacterial strain BJX002 of the present invention goes down to posterity at 5 times, throughput can also keep original level, shows that the genetic stability of bacterial strain BJX002 of the present invention is good.
Claims (6)
1. kabicidin streptomycete (Streptomyces fungicidicus) BJX002, its preserving number is CGMCC No.6026.
2. adopt kabicidin streptomycete described in claim 1 to prepare a method for enramycin, it is characterized in that, comprise the following steps:
1) fermentation culture: the seed liquor of described bacterial strain is inoculated in fermentation culture in fermention medium and obtains fermented liquid;
2) from fermented liquid, enramycin is extracted;
Described step 1) fermentation culture be cultivate 192-240 hour under the condition of temperature 25-30 DEG C;
Described fermentation medium components is: W-Gum 7.0-13.0g/L, glucose 9.1-16.9g/L, dipotassium hydrogen phosphate 0.14-0.26g/L, magnesium sulfate heptahydrate 0.7-1.3g/L, sodium-chlor 10.5-19.5g/L, calcium carbonate 1.54-2.86g/L, regulate pH to 7.2 before described fermention medium sterilizing;
Described fermentation is carried out under the condition of vibration, and the rotating speed of described vibration is 170-210rpm, and rotation radius is 50mm; Yeasting relative humidity is 50-60%.
3. method according to claim 2, it is characterized in that, described fermentation medium components is: W-Gum 10g/L, glucose 13g/L, dipotassium hydrogen phosphate 0.2g/L, magnesium sulfate heptahydrate 1g/L, sodium-chlor 15.2g/L, calcium carbonate 2.2g/L, regulates pH to 7.2 with 100g/L sodium hydroxide solution before described fermention medium sterilizing.
4. method according to claim 2, is characterized in that, the rotating speed of described vibration is 190rpm.
5. method according to claim 2, is characterized in that, described temperature is 28 DEG C, and incubation time is 240 hours.
6. kabicidin streptomycete described in claim 1 is producing the application in enramycin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210124398.0A CN103374537B (en) | 2012-04-25 | 2012-04-25 | Method for preparing enduracidin and strain produced thereby |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210124398.0A CN103374537B (en) | 2012-04-25 | 2012-04-25 | Method for preparing enduracidin and strain produced thereby |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103374537A CN103374537A (en) | 2013-10-30 |
| CN103374537B true CN103374537B (en) | 2015-01-07 |
Family
ID=49460370
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210124398.0A Active CN103374537B (en) | 2012-04-25 | 2012-04-25 | Method for preparing enduracidin and strain produced thereby |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103374537B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148460A (en) * | 2015-04-27 | 2016-11-23 | 牡丹江佰佳信生物科技有限公司 | A kind of fermentation medium improving enramycin B component yield and fermentation process |
| RU2773311C2 (en) * | 2016-12-06 | 2022-06-01 | Интервет Интернэшнл Б.В. | Modified streptomyces fungicidicus isolates and their applications |
| US11858967B2 (en) | 2016-12-06 | 2024-01-02 | Oregon State University | Compositions and methods for enhanced production of enduracidin in a genetically engineered strain of streptomyces fungicidicus |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103740612A (en) * | 2013-12-19 | 2014-04-23 | 河北圣雪大成制药有限责任公司 | High-yield enramycin strain and screening method thereof |
| MX2019006586A (en) * | 2016-12-06 | 2019-08-22 | Intervet Int Bv | Modified streptomyces fungicidicus isolates and their use. |
| CN110876797A (en) * | 2019-12-02 | 2020-03-13 | 广东容大生物股份有限公司 | Method for preparing enramycin dry suspension |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101899490A (en) * | 2010-07-14 | 2010-12-01 | 山东胜利股份有限公司 | Method for producing enramycin by using microbial fermentation |
| CN101974469A (en) * | 2010-10-22 | 2011-02-16 | 安徽丰原发酵技术工程研究有限公司 | Streptomyces fungicidious mutant strain and application thereof |
| CN102174624A (en) * | 2010-12-31 | 2011-09-07 | 安徽丰原发酵技术工程研究有限公司 | Method for producing enramycin by fermentation |
-
2012
- 2012-04-25 CN CN201210124398.0A patent/CN103374537B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101899490A (en) * | 2010-07-14 | 2010-12-01 | 山东胜利股份有限公司 | Method for producing enramycin by using microbial fermentation |
| CN101974469A (en) * | 2010-10-22 | 2011-02-16 | 安徽丰原发酵技术工程研究有限公司 | Streptomyces fungicidious mutant strain and application thereof |
| CN102174624A (en) * | 2010-12-31 | 2011-09-07 | 安徽丰原发酵技术工程研究有限公司 | Method for producing enramycin by fermentation |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148460A (en) * | 2015-04-27 | 2016-11-23 | 牡丹江佰佳信生物科技有限公司 | A kind of fermentation medium improving enramycin B component yield and fermentation process |
| RU2773311C2 (en) * | 2016-12-06 | 2022-06-01 | Интервет Интернэшнл Б.В. | Modified streptomyces fungicidicus isolates and their applications |
| US11858967B2 (en) | 2016-12-06 | 2024-01-02 | Oregon State University | Compositions and methods for enhanced production of enduracidin in a genetically engineered strain of streptomyces fungicidicus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103374537A (en) | 2013-10-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104342390B (en) | A kind of Sinorhizobium meliloti strain and combinations thereof and application | |
| CN102161975B (en) | Streptomyces sp. GSDX-1318, and fermentation method for producing oligosaccharide antibiotic avilamycin | |
| CN103436450B (en) | Alkaline-tolerant and halophilic aspergillus strain and application thereof in environmental management | |
| CN101597578B (en) | Enramycin producing strain and method for extracting same by using macroporous resin | |
| CN101792727B (en) | Bacillus coagulans and application thereof in L-sodium lactate preparation | |
| CN103374537B (en) | Method for preparing enduracidin and strain produced thereby | |
| CN103243044B (en) | Bacillus amyloliquefaciens and application thereof | |
| Pradeep et al. | Optimization of pigment and biomass production from Fusarium moniliforme under submerged fermentation conditions | |
| CN105087444B (en) | The bacillus amyloliquefaciens of degrading zearalenone and its application | |
| CN101245362B (en) | Method for producing polypeptide antibiotic enramycin by fermentation method | |
| CN103952362A (en) | Citrus endophytic actinomycetes with antibacterial activity on various plant pathogens | |
| CN109182147B (en) | Penicillium and method for producing fumagillin by using same | |
| CN108410744A (en) | A kind of fusant bacterial strain producing polysaccharide, adenosine and cordycepin | |
| CN102181370B (en) | South China sea mangrove endophytic fungus BL321 | |
| CN110157623A (en) | A kind of method of reaping hook bacteria strain and its fermenting and producing D-pantoyl lactone hydrolase | |
| WO2006075395A1 (en) | β-LACTAM ANTIBIOTIC ACTIVITY ENHANCER AND PROCESS FOR PRODUCING THE SAME | |
| CN110129216A (en) | A kind of bacillus subtilis mutagenic strain and its cultural method suitable for solid fermentation production gamma-polyglutamic acid | |
| CN103305430B (en) | Laccase generation cerrena and application thereof | |
| CN108300677B (en) | One plant of streptomyces albus and its preparing the application in microbialpreservatives | |
| CN104560766B (en) | A kind of Actinoplanes bacteria strain and its application | |
| Adedayo et al. | Pectinolytic activity of aspergillus Niger and Aspergillus flavus grown on grapefruit (citrus Parasidis) peel in solid state fermentation | |
| CN117736944A (en) | Streptomyces griseus as well as microbial inoculum and application thereof | |
| CN104745654A (en) | Method and strain for preparing Nemadectin | |
| CN112175871A (en) | Marigold flower and fresh flower compound leavening agent and application thereof | |
| CN103305481B (en) | Method for producing laccase by fermenting cerrena unicolor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |