CN112760233B

CN112760233B - Deep-sea-derived aspergillus aculeatus, metabolite thereof and application

Info

Publication number: CN112760233B
Application number: CN202110125440.XA
Authority: CN
Inventors: 王颖; 李欢欢
Original assignee: China Pharmaceutical University
Current assignee: China Pharmaceutical University
Priority date: 2021-01-29
Filing date: 2021-01-29
Publication date: 2022-06-07
Anticipated expiration: 2041-01-29
Also published as: CN112760233A

Abstract

The invention discloses aspergillus aculeatus from deep sea, a metabolite thereof and application thereof, and belongs to the technical field of microorganisms. The Aspergillus aculeatus (Aspergillus aculeatus) B18 is preserved in China Center for Type Culture Collection (CCTCC) in 2021, 15.01, with the preservation number of CCTCC NO: m2021075. The Xylarinol A is obtained by separating and purifying secondary metabolites of Aspergillus aculeatus B18 from deep sea, and the compound has no obvious bacteriostatic action, but can have obvious synergistic action with aminoglycoside antibiotic isepamicin, and has the potential of being developed into an antibacterial adjuvant of Acinetobacter baumannii.

Description

Deep-sea-derived aspergillus aculeatus, metabolite thereof and application

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to deep-sea aspergillus aculeatus, a metabolite thereof, a preparation method and application.

Background

The marine microorganism is the most evolved and diversified organism in the biosphere, has the characteristics of high salinity, high pressure, less nutrition, weak illumination, low temperature, partial high temperature and the like due to the special living environment, has different growth and metabolism mechanisms with other microorganisms, and endows the metabolite with unique biological activity, so that more natural products with novel structures and high-efficiency activity are expected to be found. In fact, this has also been confirmed by several studies: the marine microorganism natural products which are found at present comprise phenolic acid, flavonoid, quinone, steroid, benzopyrone, tetralone, xanthone, polypeptide and the like, have antibacterial, antifungal, antitumor, antiviral, antioxidant and other activities, have wide biological activities in medicine and agriculture, and are always the research hotspots of medicine lead compounds or natural medicines and the like. Among them, marine fungi have the characteristics of fast growth speed, easy culture, large-scale fermentation, no influence of seasons, resource sustainability and the like, and are widely concerned by people, and secondary metabolites of the marine fungi are various in types, and mainly comprise polyketones, terpenoids, steroids, alkaloids, peptides, other nitrogen-containing compounds and the like.

Acinetobacter baumannii is an opportunistic human pathogen, primarily infecting critically ill patients, whose broad drug resistance is growing globally at a rapid rate in the medical setting. In the united states and europe, acinetobacter baumannii causes infections that account for approximately 2% of all health care related infections, however, these rates are twice as high in asia and the middle east. About 45% of all isolates worldwide are considered to have multidrug resistance (MDR), up to 70% in latin america and the middle east. These daunting MDR incidences are nearly four times higher than observed with other gram-negative pathogens such as MDR pseudomonas aeruginosa and klebsiella pneumoniae. In view of this, the center for disease control and prevention (CDC) has classified acinetobacter multidrug resistance as a serious threat, thus prompting continued public health monitoring and prevention activities. In addition, the world health organization has placed acinetobacter baumannii, which is resistant to carbapenems, as a key group in a list of bacteria that pose the greatest threat to human health, placing research and development efforts as the focus of new antibacterial therapies.

Disclosure of Invention

The invention aims to provide a deep-sea aspergillus aculeatus strain which is separated from a south-China-sea sponge sample by an inventor.

Another object of the present invention is to provide a secondary metabolite of Aspergillus aculeatus.

It is a further object of the present invention to provide the use of said secondary metabolites.

In order to achieve the purpose, the invention adopts the following technical scheme:

an Aspergillus aculeatus strain (Aspergillus aculeatus) B18 preserved in China Center for Type Culture Collection (CCTCC) of eight Lodofloweringjia mountains in Wuchang district, Wuhan, Hubei province in 2021, 01 month and 15 days, wherein the preservation number is CCTCC NO: m2021075.

The application of the secondary metabolite obtained after fermentation culture of Aspergillus aculeatus B18 as a synergist of antibiotic isepamicin;

the secondary metabolite is Xylarinol A, and the structural formula of the secondary metabolite is shown as the following formula:

in particular, the secondary metabolite may reduce the Minimal Inhibitory Concentration (MIC) of the antibiotic isepamicin against acinetobacter baumannii.

The preparation method of the secondary metabolite comprises the following steps:

step 1, preparing spores, inoculating Aspergillus aculeatus (Aspergillus aculeatus) B18 on a PDA (personal digital assistant) plate, and culturing for 3 days at 28 ℃ in the dark;

step 2, preparing seed liquid: after a single colony grows on a PDA flat plate, scraping spores and hyphae into a PDB liquid culture medium, and culturing for 3-4 days at the conditions of 200rpm and 28 ℃ to obtain a seed solution;

step 3, strain fermentation: inoculating the seed liquid into a solid fermentation culture medium according to the proportion of 1mL of seed liquid to 10g of culture medium, and standing for culture;

step 4, secondary metabolite extraction: soaking the solid fermentation product in ethanol according to the proportion of 10L/1kg, performing ultrasonic extraction, performing suction filtration to obtain an extract, and performing rotary evaporation to remove liquid to obtain a fermentation extract;

and 5, separation and purification: and sequentially carrying out ethyl acetate extraction, silica gel column chromatography and ODS reverse phase column separation and purification on the fermented extract to obtain a secondary metabolite.

Further, the formula of the solid fermentation medium is as follows: 1000.0g corn, 33g sea crystal, 20.0g maltose, 20.0g sorbitol, 3.0g yeast, 0.5g tryptophan, 10.0g sodium glutamate, 0.5gK₂H_PO₄，0.3g MgSO₄·7H₂O， 1000.0mL H₂O，pH7.0-7.5。

Further, the fermentation conditions in step 3 are as follows: fermenting at 28 deg.C in dark for 15 days.

Has the advantages that:

(1) the Xylarinol A is obtained by separating and purifying secondary metabolites of aspergillus aculeatus from deep sea, and the compound has no obvious bacteriostatic action, but has obvious synergistic action with aminoglycoside antibiotic ipramine, and has the potential of being developed into an antibacterial adjuvant of acinetobacter baumannii.

(2) Before a large amount of fermentation, the invention optimizes the culture medium and culture conditions, selects the culture medium and culture conditions with higher Xylarinol A yield for fermentation, aims to obtain more target products, and has simple operation and low cost.

Drawings

FIG. 1 is a photograph showing the growth of Aspergillus aculeatus (Aspergillus aculeatus) B18 on MEA medium for 5 days.

FIG. 2 is a micrograph of the A.aculeatus (Aspergillus aculeatus) B18 strain Yucca schidigera staining (magnification 40 times).

FIG. 3 is an HPLC chromatogram of the secondary metabolite Xylarinol A.

FIG. 4 is a diagram of the secondary metabolite Xylarinol A¹H-NMR spectrum.

FIG. 5 is a diagram of the secondary metabolite Xylarinol A¹³C-NMR spectrum.

Detailed Description

The invention is described in further detail below with reference to the figures and the specific examples, which should not be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention. The experimental methods and reagents of the formulations not specified in the examples are in accordance with the conventional conditions in the art.

Example 1

Morphological identification and molecular biological identification of Aspergillus aculeatus (Aspergillus aculeatus) B18 strain

(1) Preparing a seed solution: inoculating the strain B18 separated from sponge sample of south China sea stored in an ultra-low temperature refrigerator of-80 deg.C to PDA plate, and standing at 28 deg.C for 3 days. Preparing PDA plate (fungus culture medium: 5.0g potato extract powder, 20.0g glucose, 20.0g agar, seawater crystal 33.0g, H₂O1L; pH was adjusted to 6.0), after significant hyphae growth, an appropriate amount of sterile water was added, hyphae were washed off with a sterile inoculating loop, and the spore suspension was inoculated into 200mL of PDB liquid medium (fungal medium: 10.0g of potato extract powder; 20.0g glucose; sea quartz 33.0 g; h₂O1L; pH was adjusted to 6.0), 28 ℃, 200rpm, 3 days.

(2) And (3) morphological identification: the seed solution was inoculated at 2. mu.L/spot onto an MEA plate (20.0g maltose extract; 1.0g peptone; 20.0g glucose; 0.005g CuSO) by a three-point method₄·5H₂O；0.01g ZnSO₄·7H₂O; 20.0g agar; sea quartz 33.0 g; h₂O1L; adjusting the pH to 7.0-7.5). After the seed liquid is completely absorbed by the MEA culture medium, the seed liquid is inversely cultured for 5 days at 28 ℃ in a constant temperature incubator. Preparing hypha slides: by inserting into a piece, 1.0cm × 1.0cm coverslip is autoclaved, inserted at 45 ° to the vicinity of the inoculation point, and cultured in a constant temperature incubator at 28 ℃ for 5 days in an inverted manner.

The morphological characteristics of the strain are as follows: after 5 days of inverted culture at 28 ℃ on MEA medium, the colony diameter was 1.5 cm. As shown in figure 1, the surface of the colony is dense velvet or flocculent, the front side is white and then turns into black brown, the back side is gray-white to black, the color is not uniform, a large number of round black spore clusters can be released on the hyphae, the central area is slightly raised, the color of the edge area is white, pigment is generated, and the back side of the colony is tan. After the hypha slide is dyed by cotton blue, observing the hypha slide by a microscope (the magnification is 40 times), wherein as shown in figure 2, conidium fruits are spherical, the cross section of the conidium fruits is fan-shaped, the diameter of the conidium fruits is 100-150 mu m, and the top sacs are about 50 mu m after the conidia fall off; the spore stalks are not forked, and the section diameter is 10-15 mu m; the spore is spherical or oval, the diameter is 3-5 μm, and thorns on the surface can adhere to the spore stalk. The morphological characteristics are similar to those of the aspergillus terreus.

(3) Molecular biological identification: mycelia on The MEA plate were picked, DNA was extracted using Nanjing engine plant genome DNA extraction kit, and The gene spacer sequences of housekeeping genes 5.8S rDNA and 28S rDNA (ITS) were amplified using this as a template.

The ITS PCR amplification primer sequences are shown below:

ITS1：5′-TCCGTAGGTGAACCTGCGC-3′(SEQ ID NO.1)

ITS4：5′-TCCTCCGCTTATTGATATGC-3′(SEQ ID NO.2)

PCR conditions were as follows: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, and extension at 72 ℃ for 10s for 30 cycles; extension at 72 ℃ for 10 min.

The amplification products of the primers of the strains B18 ITS1 and ITS4 are sequenced by Nanjing Optingprime Biotechnology Limited, the length of the amplification products is 535bp, and the sequences are shown as follows:

TCGGGTGCTGGGTCTTCGGGGCCAACCTCCCACCCGTGCTTACCGTACCCTGTTGC TTCGGCGGGCCCGCCTTCGGGCGGCCCGGGGCCTGCCCCCGGGACCGCGCCCGCCGGA GACCCCAATGGAACACTGTCTGAAAGCGTGCAGTCTGAGTCGATTGATACCAATCAGTC AAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCG ATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCC CCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTCCCCTCCAGCCCCGCTGG TTGTTGGGCCGCGCCCCCCCGGGGGCGGGCCTCGAGAGAAACGGCGGCACCGTCCGGT CCTCGAGCGTATGGGGCTCTGTCACCCGCTCTATGGGCCCGGCCGGGGCTTGCCTCGAC CCCCAATCTTCTCAGATTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATAT CAAAAA(SEQ ID NO.3)

and (4) passing the sequencing result through BLAST of an NCBI website, wherein the species with the highest similarity in the sequence comparison result is the similar species of the strain. The strain is subjected to sequence comparison, and the most similar species is Aspergillus aculeatus.

Example 2

1. Fermentation of bacterial strains

(1) Preparing a seed solution: the preparation method is the same as example 1.

(2) Small-batch fermentation: inoculating the seed liquid into a rice solid culture medium, a corn solid culture medium, a rice +1 solid culture medium and a corn +1 solid culture medium according to the proportion of 1mL/10 g; the culture time is 15 days and 30 days respectively; the culture conditions are light and dark respectively; the culture temperature was 28 ℃. Each set being two parallel.

Rice solid medium: 1000.0g rice, 33g sea crystal, 0.15g MgSO₄·7H₂O，1000.0mL H₂O；

Corn solid medium: 1000.0g corn, 33g sea rock crystal, 0.15g MgSO₄·7H₂O，1000.0mL H₂O；

Rice +1 solid medium: 1000.0g rice, 33g sea crystal, 20.0g maltose, 20.0g sorbitol, 3.0g yeast, 0.5g tryptophan, 10.0g sodium glutamate, 0.5g K₂HPO₄，0.3g MgSO₄·7H₂O，1000.0mL H₂O, adjusting the pH value to 7.0-7.5;

corn +1 solid medium: 1000.0g corn, 33g sea crystal, 20.0g maltose, 20.0g sorbitol, 3.0g yeast, 0.5g tryptophan, 10.0g sodium glutamate, 0.5g K₂HPO₄，0.3g MgSO₄·7H₂O，1000.0mL H₂And O, adjusting the pH value to 7.0-7.5.

Soaking the small-batch fermentation product in 3-time volume of ethanol overnight, ultrasonically leaching for 30min the next day, and vacuum filtering to obtain filtrate. This procedure was repeated three times. Mixing the obtained filtrates, performing rotary evaporation under reduced pressure to obtain fermented extract, and adding 3mL of ethanol to dissolve the extract to obtain fermented crude extract for antibacterial experiment.

The indicator bacteria selected for the bacteriostatic experiments were Escherichia coli (Escherichia coli), Klebsiella pneumoniae (Klebsiella aerogenes), Staphylococcus aureus (Staphylococcus aureus), Pseudomonas aeruginosa (Pseudomonas aeruginosa), Methicillin-resistant Staphylococcus aureus (MRSA), Methicillin-resistant Staphylococcus epidermidis (MRSE), Micrococcus luteus, Acinetobacter baumannii (Acinetobacter baumannii). Activating indicator bacteria: the glycerol tube of the indicator bacterium stored at-80 ℃ was inoculated into 20mL of MHB broth (2.0g beef powder; 1.5g soluble starch; 17.5g acid-hydrolyzed casein, pH adjusted to 7.5), cultured at 37 ℃ and 200rpm overnight. Inoculating the activated indicator bacterium into 20mL of MHB liquid culture medium, culturing at 37 ℃ and 200rpm until OD600nm is approximately equal to 0.08-0.1, inoculating the indicator bacterium into a dish of 100 muL, and uniformly coating the indicator bacterium on an MHB culture plate; perforating the indicator bacteria-coated MHB plate with a sterile perforator having a diameter of about 6mm, and adding 30. mu.L of crude fermentation extract to each well; chloramphenicol at 100. mu.g/mL was used as a positive control, and methanol was used as a negative control. The culture was carried out in a 37 ℃ incubator for 18 h. The inhibition zone of the crude fermentation extract was measured by the cross method, and the results are shown in table 1.

TABLE 1 results of Secondary metabolite Activity of Aspergillus aculeatus B18 in different media and culture conditions

(3) Large-batch fermentation: seed liquid was prepared as in example 1. And selecting a corn +1 solid culture medium for large-scale fermentation according to the bacteriostatic activity of the small-scale fermentation product. Preparing 2kg of corn +1 solid fermentation medium, 50g per tank, respectively filling in 40 fermentation tanks, and autoclaving at 121 ℃ for standby. The seed solution was inoculated at 5 mL/pot, incubated at 28 ℃ in the dark for 15 days. Soaking the mass fermentation product in 3 times volume of ethanol overnight, ultrasonically leaching for 30min the next day, and vacuum filtering to obtain filtrate. This procedure was repeated three times. Mixing the filtrates, and rotary steaming under reduced pressure to obtain fermented extract for subsequent separation and purification.

2. Separation and purification of target compound

(1) The obtained fermented extract is firstly extracted by ethyl acetate, the ethyl acetate is firstly saturated by 3 percent of water, and the weight ratio of ethyl acetate: the extraction was performed with water 1:1 and repeated 3 times. The organic phase was taken and recorded as component 1 and subjected to the subsequent tests.

(2) For the fraction 1 obtained in the step (1), the fraction was concentrated under reduced pressure until the weight was not reduced any more, and subjected to silica gel column chromatography (the volume of the silica gel column was about 300mL, and the silica gel G size was 100-200 mesh). The mobile phase of the silica gel column chromatography is petroleum ether, ethyl acetate, methanol and chloroform, gradient elution is adopted, and the ratio of petroleum ether: after V ethyl acetate ═ 100: 1 to 5:1, V chloroform: methanol (100: 1) to (1: 1) gave chloroform: methanol 40:1 component 2.

(3) For the component 2, ODS reversed-phase column chromatography is carried out to obtain the target compound Xylarinol A. The liquid phase diagram of the compound is shown in FIG. 3, and the nuclear magnetic diagram is shown in FIGS. 4 and 5.

Example 3

Synergistic effect of compound Xylarinol A and aminoglycoside antibiotic isepamicin

(1) Preparing Xylarinol A and an antibiotic mother liquor: weighing 10mg of Xylarinol A, adding 1m L of DMSO, and preparing a mother solution with the final concentration of 10 mg/mL; 100mg of isepamicin is weighed and 10mL of purified water is added to prepare mother liquor with the final concentration of 10 mg/mL.

(2) Culturing Acinetobacter baumannii 19606 strain: acinetobacter baumannii 19606 strain was streaked on MHB plates and placed in a 37 ℃ incubator overnight for culture. Single colonies were picked into 20mL MHB liquid medium, cultured at 37 ℃ and 200rpm to logarithmic phase.

(3) Combined bacteriostatic test of different concentrations of Xylarinol a and different concentrations of isepamicin antibiotic: xylarinol A was diluted 2500-fold to 4. mu.g/mL, and then diluted sequentially in two-fold ratios at 4. mu.g/mL, 2. mu.g/mL, 1. mu.g/mL, 0.5. mu.g/mL, 0.25. mu.g/mL, and 0.125. mu.g/mL, in a total volume of 5mL for each concentration, and 45. mu.L was added to each well. The antibiotic Isepamicin (ISEPA) was diluted in duplicate starting with the mother liquor concentration of 12.5. mu.g/mL, 6.25. mu.g/mL, 3.125. mu.g/mL, 1.5625. mu.g/mL, 0.78125. mu.g/mL, 0.3906. mu.g/mL, 0.195. mu.g/mL, 0.097. mu.g/mL, 0.048. mu.g/mL in this order, and 45. mu.L was added per well. Acinetobacter baumannii in logarithmic growth phase was diluted to OD600nm of 0.3 with a blank MHB medium, and then diluted 100 times to 96-well plates, each well volume was 10. mu.L. Culturing at 37 deg.C for 18h, and measuring OD600nm as bacterial density index.

The combined inhibition index (FICI) can be used for evaluating whether two medicines have synergistic action or additive action, the FICI is MICA medicine combination/MICA medicine combination + MICB medicine combination/MICB medicine combination, if the FICI is less than or equal to 0.5, the two medicines have synergistic action, the FICI is less than 0.5, the FICI is less than 1, the two medicines have partial synergistic action, the FICI is less than 1, the FICI is less than 4, the two medicines have unrelated effect, and the FICI is more than or equal to 4, the two medicines have antagonistic action.

TABLE 2 MIC of Xylarinol A against Acinetobacter baumannii ATCC19606

TABLE 3 combination of Xylarinol A at various concentrations with isepamicin at various concentrations against Acinetobacter baumannii ATCC19606

The result shows that when the concentration of Xylarinol A is trace 0.25 mu g/mL, the Xylarinol A and the isepamicin have obvious synergistic effect, and the MIC of the isepamicin to Acinetobacter baumannii 19606 is reduced.

Sequence listing

<110> university of Chinese pharmacy

<120> Aspergillus aculeatus strain, metabolite and application thereof

<130> 20210129

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tccgtaggtg aacctgcgc 19

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcctccgctt attgatatgc 20

<210> 3

<211> 535

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tcgggtgctg ggtcttcggg gccaacctcc cacccgtgct taccgtaccc tgttgcttcg 60

gcgggcccgc cttcgggcgg cccggggcct gcccccggga ccgcgcccgc cggagacccc 120

aatggaacac tgtctgaaag cgtgcagtct gagtcgattg ataccaatca gtcaaaactt 180

tcaacaatgg atctcttggt tccggcatcg atgaagaacg cagcgaaatg cgataactaa 240

tgtgaattgc agaattcagt gaatcatcga gtctttgaac gcacattgcg ccccctggta 300

ttccgggggg catgcctgtc cgagcgtcat ttctcccctc cagccccgct ggttgttggg 360

ccgcgccccc ccgggggcgg gcctcgagag aaacggcggc accgtccggt cctcgagcgt 420

atggggctct gtcacccgct ctatgggccc ggccggggct tgcctcgacc cccaatcttc 480

tcagattgac ctcggatcag gtagggatac ccgctgaact taagcatatc aaaaa 535

Claims

1. Aspergillus aculeatus (A.)), (Aspergillus aculeatus) B18, preserved in China Center for Type Culture Collection (CCTCC) at 20.01.2021, with the preservation number of CCTCC NO: m2021075.

2. Aspergillus aculeatus (A.aculeatus), (A.aculeatus ) according to claim 1Aspergillus aculeatus) B18 application of the secondary metabolite obtained after fermentation culture as synergist of antiparacter paucidum of acinetobacter baumannii;

。

3. use according to claim 2, characterized in that:

the secondary metabolite is prepared by the following steps:

step 1, preparing spores, namely preparing aspergillus aculeatus (A. aculeatus) (A. aculeatus)Aspergillus aculeatus) B18 inoculating on PDA plate, culturing at 28 deg.C in dark for 3 days;

step 2, preparing seed liquid: after a single colony grows on a PDA plate, scraping spores and hyphae into a PDB liquid culture medium, and culturing for 3-4 days at the temperature of 28 ℃ to obtain a seed solution;

4. Use according to claim 3, characterized in that: the formula of the solid fermentation medium is as follows: 1000.0g corn, 33g sea rock, 20.0g maltose, 20.0g sorbitol, 3.0g yeast, 0.5g tryptophan, 10.0g sodium glutamate, 0.5g K₂H_PO₄，0.3g MgSO₄·7H₂O，1000.0mL H₂O，pH7.0-7.5。

5. Use according to claim 3, characterized in that: the fermentation conditions in step 3 are as follows: fermenting at 28 deg.C in dark for 15 days.