CN110526961B

CN110526961B - Application of transcription factor participating in regulation and control of synthesis of tomato steroid alkaloid

Info

Publication number: CN110526961B
Application number: CN201910847193.7A
Authority: CN
Inventors: 张阳; 李彦; 周璐; 付饶
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2019-09-09
Filing date: 2019-09-09
Publication date: 2021-02-19
Anticipated expiration: 2039-09-09
Also published as: CN110526961A

Abstract

The invention discloses an application of a transcription factor participating in regulation and control of synthesis of tomato steroid alkaloid, wherein an amino acid sequence of a transcription factor SlbHLH114 is shown as SEQ ID No.4, a nucleotide sequence is shown as SEQ ID No.3, and overexpression of the transcription factor has a positive regulation and control effect on synthesis of the tomato steroid alkaloid, so that the steroid alkaloid content of a transgenic line can be improved by overexpression of the transcription factor SlbHLH114 in a plant, and a theoretical basis is provided for improvement and excellent breeding of tomato quality.

Description

Application of transcription factor participating in regulation and control of synthesis of tomato steroid alkaloid

Technical Field

The invention relates to the technical field of biology, in particular to application of a transcription factor participating in regulation and control of synthesis of tomato steroid alkaloid.

Background

Steroidal Alkaloids (SAs) and their glycosylated forms (steroidal alkaloid glycosides, SGAs) are nitrogen-containing toxic compounds in the plant family, also known as Solanum alkaloids, a common component belonging to the Solanaceae family, in particular the Solanum family. In plants, steroidal alkaloids often act as antibiotics, providing plants with a pre-existing chemical barrier against various pathogens, such as α -tomatidine, by disrupting the membrane, resulting in electrolyte leakage and depolarization of the membrane potential. Research shows that the toxicity of alpha-tomatine to plant cells is reduced due to the existence of steroidal glycoside alkaloids and acetylated steroidal glycoside alkaloids in tomato cell membranes, so that tomato plants are not poisoned by the alpha-tomatine. However, in humans, some steroidal alkaloids cause gastrointestinal and nervous system diseases and can be fatal at high concentrations, and the toxic mechanisms include destruction of cell membranes and inhibition of acetylcholinesterase activity. Although steroidal alkaloids help plants to fight a variety of pathogens and carnivores (including bacteria, fungi, oomycetes, viruses, insects, and animals), most are considered as anti-nutritional compounds for humans due to their toxic effects.

The research shows that the existence of the solanine causes the tomatoes to have astringent taste, while in the breeding process from the wild tomatoes to the cultivated tomatoes, the content of the solanine is gradually reduced, the natural variation of the solanine is mainly controlled by 5 genetic loci and is strongly selected, wherein the most effective gene cluster of the glycosyltransferase is positioned on the No.10 chromosome and mainly exists in the red fruit, and the content of the main solanine can be reduced by 80 percent through two main effective loci. Recently, the molecular mechanism of synthesis of steroid alkaloids in tomato has been basically determined by utilizing multiomic analysis and molecular biology technology, cholesterol is generated from glycolysis pathway through mevalonic acid pathway to cycloartenol pathway, and steroid alkaloids are generated through a series of reactions such as hydroxylation, oxidation, transamination, cyclization and the like, but the metabolic regulation mechanism is not clear. Therefore, the research on the transcription factor participating in the regulation of the synthesis of the tomato steroid alkaloid has important significance for improving the content of the tomato steroid alkaloid.

Disclosure of Invention

In view of the above, an object of the present invention is to provide an application of SlbHLH114 participating in regulation and control of tomato steroid alkaloid synthesis transcription factor in increasing plant steroid alkaloid content; the invention also aims to provide a method for improving the content of plant steroidal alkaloids.

In order to achieve the purpose, the invention provides the following technical scheme:

1. the application of a transcription factor SlbHLH114 participating in regulation and control of synthesis of tomato steroid alkaloid in improving the content of plant steroid alkaloid is disclosed, wherein the amino acid sequence of the transcription factor SlbHLH114 is shown in SEQ ID No. 4.

Preferably, the nucleotide sequence of the transcription factor SlbHLH114 is shown as SEQ ID NO. 3.

Preferably, the plant is a solanaceous plant.

Preferably, the plant is a tomato.

More preferably, the steroid alkaloid is one or more of hydroxydehydrotomato alkali, hydroxylycopene (hydroxytomato alkali), delta-tomato alkali (delta-tomato alkali glycoside), beta 2-tomato alkali (beta 2-tomato alkali glycoside), tomato alkali-o-rhamnoside (tomatidine-o-rhamnoside) and dihydroxy-tomato alkali-o-hexoside-rhamnoside (dihydroxy tomato alkali-o-hexoside), tomato alkali (tomatidine), tomato alkali derivative (tomatidine), tomato alkali, gamma-tomato alkali (gamma-tomato alkali), tomato alkali (tomatidine), tomato alkali-o-xosysl-o-pentoside (tomato alkali-o-acyl-pentoside), acetoxy-dehydrogenase (acetate), and tomato alkali A.

2. A method for improving the content of plant steroid alkaloid is to overexpress a transcription factor SlbHLH114 involved in regulation and control of tomato steroid alkaloid synthesis in a plant, wherein the amino acid sequence of the transcription factor SlbHLH114 is shown as SEQ ID NO. 4.

Preferably, the method of overexpression in plants is as follows: cloning a transcription factor SlbHLH114 gene, constructing a plant expression vector to obtain a recombinant plant expression vector containing the transcription factor SlbHLH114, transforming agrobacterium tumefaciens into the obtained recombinant plant expression vector to obtain engineering bacteria, finally transforming a plant explant by the engineering bacteria, and obtaining a transgenic plant, namely a plant with high steroid alkaloid content, through co-culture, regeneration culture and rooting culture and positive identification.

Preferably, the method for cloning the transcription factor SlbHLH114 gene comprises the following steps: and carrying out PCR amplification by taking tomato cDNA as a template and the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 as primers to obtain the cloned transcription factor SlbHLH114 gene.

Preferably, the method for constructing the plant expression vector comprises the following steps: the nucleotide sequence shown as SEQ ID NO.3 is connected into pBin19-E8-GW and pBin19-35S-GW vectors.

More preferably, the plant is tomato.

The invention has the beneficial effects that: the invention provides a positive regulation function of a SlbHLH114 transcription factor on the synthesis of tomato steroid alkaloid, further regulates the accumulation of the steroid alkaloid by regulating the expression of a tomato steroid alkaloid synthesis gene, and discloses a regulation mechanism of a tomato steroid alkaloid metabolic pathway, so that a plant with improved steroid alkaloid content can be obtained by over-expressing the SlbHLH114 transcription factor gene in plants, particularly solanaceae plants, and a theoretical basis is provided for the synthesis of the tomato steroid alkaloid and molecular assisted breeding.

Drawings

In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:

FIG. 1 shows the real-time fluorescent quantitative PCR detection of expression level of SlbHLH114 in stable transgenic tomato fruit and leaf (A: fruit; B: leaf; E8-SlbHLH 114-C/I: different transgenic tomato lines containing E8 promoter; 35S-SlbHLH 114-NPTII-11/24: different transgenic tomato lines containing 35S promoter; WT: wild type).

FIG. 2 shows LC-MS detection of steroid alkaloid content in stable transgenic tomato fruits (E8-SlbHLH 114-C/I: different transgenic tomato lines containing E8 promoter; WT: wild type).

FIG. 3 shows LC-MS detection of steroid alkaloid content in tomato stable transgenic leaves (35S-SlbHLH 114-NPTII-11/24: different transgenic tomato lines containing 35S promoter, WT: wild type).

Detailed Description

The present invention is further described with reference to the following drawings and specific examples so that those skilled in the art can better understand the present invention and can practice the present invention, but the examples are not intended to limit the present invention.

The anabolic pathway of the tomato steroid alkaloid is elucidated through the research on the synthesis and regulation of the tomato steroid alkaloid and the combined analysis of a transcriptome, a metabolome and a proteome. Then, by a method of space-time high-resolution metabolome and transcriptome joint analysis, a bHLH family transcription factor (Solyc01g096370) and tomato steroid alkaloid and metabolic pathway genes thereof are positioned to show a co-expression mode, so that the transcription factor is supposed to possibly regulate and control the synthesis of the tomato steroid alkaloid. In order to verify the conjecture, the SlbHLH114 is introduced into tomato cotyledons by an agrobacterium-mediated method, stable transgenic tomato plants are grown after germination and rooting, positive plants are identified and screened in the T0 generation, and a great amount of expression of transcription factors and synthetic genes is found in the T1 generation, so that the content of steroid alkaloid is obviously improved.

Example 1 cloning of the tomato SlbHLH114 Gene

(1) Extraction of total RNA from tomato leaves

Taking a proper amount of tomato leaves, quickly freezing in liquid nitrogen, sufficiently crushing for three times by using a rapid grinding instrument according to 45Hz and 30s, adding a lysate, and extracting total RNA according to the specification of a plant RNA extraction kit V1.5 (BIOFIT). The RNA quality was checked by agarose gel electrophoresis and the RNA concentration was determined by NanoDrop 2000 spectrophotometer.

(2) Cloning of tomato SlbHLH114 Gene

Synthesizing cDNA by using the extracted total RNA as a template according to the instruction of a Takara reverse transcription kit; designing a gene specific primer according to the sequence of the SlbHLH114 gene, wherein the specific sequence is as follows:

SlbHLH114 upstream primer: 5'-atggaacaactcgcggtttc-3' (SEQ ID NO. 1);

SlbHLH114 downstream primer: 5'-atttacaaatcatagctagtaagaa-3' (SEQ ID NO. 2).

The SlbHLH114 gene is amplified by PCR with Takara high fidelity enzyme Primerstar Max, then is connected with a T4 vector, and escherichia coli DH5 alpha is transformed, and positive clones are picked for sequencing.

The result shows that the full-length coding sequence of the tomato SlbHLH114 is obtained by amplification, and the nucleotide sequence is shown in SEQ ID NO. 3; the protein coding amino acid sequence is shown in SEQ ID NO.4, the initiation codon is ATG, and the termination codon is TAA.

Example 2 construction of plant expression vector containing SlbHLH114

In order to research the influence of the SlbHLH114 gene on the content of steroid alkaloids in tomatoes, overexpression vectors pBin19-E8-SlbHLH114 and 35S-SlbHLH114-NPTII vectors are respectively constructed. The nonspecific arm of each vector was added to both forward and reverse primers, as shown in Table 1.

Table 1, pBin19-E8-SlbHLH114 and 35S-SlbHLH114-NPTII vector construction primer sequences

The correctly sequenced T4 vector containing SlbHLH114 gene is used as a template, SEQ ID NO.5 and SEQ ID NO.6, and SEQ ID NO.7 and SEQ ID NO.8 are used as primers, and Primerstar Max high fidelity enzyme of Takara is adopted for PCR amplification. The expression vectors pBin19-E8-SlbHLH114 and 35S-SlbHLH114-NPTII are obtained by connecting gateway and goldenbridge into pBin19-E8-GW and P35S-SlbHLH 114-T35S-PnoS-NPTII-Tnos-omega 1 vectors (Ying, Su et al 2019, Sarrion-Perdigones, Vazzez-Vilar et al 2013) respectively and verifying sequencing.

In the embodiment, the tomato SlbHLH114 gene is operably connected with an expression control sequence, and the vector can be used for controlling the content of the tomato steroid alkaloid through a transcription control strategy.

Example 3 Agrobacterium tumefaciens-mediated SlbHLH114 overexpression vector genetic transformation of tomato to obtain transgenic tomato plants

(1) Obtaining of Agrobacterium tumefaciens engineering bacteria containing pBin19-E8-SlbHLH114 and 35S-SlbHLH114-NPTII expression vectors

The pBin19-E8-SlbHLH114 and 35S-SlbHLH114-NPTII expression vectors obtained in example 2 were transferred to Agrobacterium tumefaciens (e.g., EHA105) by electrotransformation, and verified by PCR. The results show that the expression vectors pBin19-E8-SlbHLH114 and 35S-SlbHLH114-NPTII have been successfully constructed into Agrobacterium tumefaciens strains.

(2) Agrobacterium tumefaciens-mediated SlbHLH114 gene transformed tomato

a. Preparation and preculture of sterile cotyledons of tomato

Disinfecting the seeds with 10ml of 5% PPM (fungal inhibitor) 3 XMS solution for 4 hours; about 30 seeds per bottle were spread on 1/2MS (Murashige and Skoog, 1962) solid medium, and cultured at 25 deg.C for 16h/8h (light/dark) for 7-10 days to obtain sterile tomato cotyledons. In seedling cutting liquid (MS + KH)₂PO₄200mg/L +2, 4-D0.2 mg/L + KT 0.1mg/L), cutting off two ends of cotyledons, and culturing in a pre-culture medium (1/2MS + IAA 1mg/L + ZR 2mg/L) for subsequent transformation.

b. Co-culture of Agrobacterium with explants

Adding the explant obtained in step a into activated Agrobacterium tumefaciens resuspension (MS + KH) containing pBin19-E8-SlbHLH114 and 35S-SlbHLH114-N [ TII expression vector [ ] -₂PO₄200mg/L + AS 200 mu mol/L), fully contacting the bacterial liquid with the explant for 18 minutes, transferring to a co-culture medium (MS + AS 200 mu mol/L), wrapping with toilet paper, and placing in an incubator at 25 ℃ for 2 days under low light.

c. Regeneration culture and rooting culture of explants

Placing the explants obtained in the step b in a regeneration culture medium (MS + IAA 1mg/L + ZR 2mg/L + Kan 100mg/L + Tim 320mg/L), and replacing the culture medium every two weeks until buds grow; then the callus is stripped and transferred into a rooting culture medium (MS + Kan 50mg/L + Tim 320mg/L), and the culture medium is replaced every 4 weeks until roots grow to form a complete plant.

d. Transgenic plant for seedling transplantation

And d, hardening the sterile stable transgenic plant obtained in the step c in an incubator at 25 ℃ overnight, and then transferring the plant into a soil pot until vigorous tissues such as roots, stems and leaves grow out.

(3) Identification of Positive transgenic plants

Forward and reverse detection primers are respectively designed according to pBin19-E8-SlbHLH114 and 35S-SlbHLH114-PTII expression vectors for detecting transgenic plants, and specific primer sequences are shown in a table 2:

TABLE 2 SlbHLH114 Positive transgenic tomato plant identification primer sequences

Primer name	Primer sequence (5 '-3')
		qRT-SlbHLH114-F	aagagaaaacagcagaaaaccg(SEQ ID NO.9)
T35S CAMV-R	tcaacacatgagcgaaaccct(SEQ ID NO.10)
		P35S-F	gagcatcgtggaaaaagaagacgttc(SEQ ID NO.11)
T35S-R	gctcaacacatgagcgaaaccctata(SEQ ID NO.12)
		qRT-SlbHLH114-R	gttgattgatgtaggacacagc(SEQ ID NO.13)

The transgenic plants containing pBin19-E8-SlbHLH114 expression vectors are detected by SEQ ID NO.9 and SEQ ID NO.10, and the transgenic plants containing 35S-SlbHLH114-NPTII expression vectors are detected by SEQ ID NO.11 and SEQ ID NO.13 and SEQ ID NO.9 and SEQ ID NO. 12.

The detection result shows that the designed primer sequence is adopted, the positive transgenic plant can amplify specific DNA fragments, and the negative and wild tomatoes can not amplify any fragments.

(4) Quantitative detection of transgenic tomato plant SlbHLH114 gene expression level

Three days after the color of each strain of the transgenic tomato containing the pBin19-E8-SlbHLH114 expression vector is broken, transgenic tomato leaves containing the 35S-SlbHLH114-NPTII expression vector are collected, quick-frozen in liquid nitrogen, and RNA is extracted by using a quick grinder according to the method of example 1 to obtain cDNA. Diluting cDNA with RNA-free water by 20 times, performing fluorescence quantitative PCR (polymerase chain reaction) by using SYBR Supermix of Bio-Rad company, and detecting the expression level of the transgenic tomato fruit by using SlUBI as a control gene, wherein the primer sequences of the target gene are shown as SEQ ID NO.9 and SEQ ID NO.13, and the primer sequence of the control UBI is shown as Table 3.

TABLE 3 SlbHLH114 transgenic tomato hairy root gene expression level detection primer sequence

Primer name	Primer sequence (5 '-3')
		qRT-SlUBI-F	gccaaagaagatcaagcaca(SEQ ID NO.14)
qRT-SlUBI-R	tcagcattagggcactcctt(SEQ ID NO.15)

The results are shown in FIG. 1. The results show that the fruit expression level of the transgenic tomato SlbHLH114 connected with the E8 promoter is higher than that of the wild type, and the leaf expression level of the transgenic tomato SlbHLH114 connected with the 35S promoter is higher than that of the wild type, so that the SlbHLH114 gene is successfully transferred into a tomato, and a tomato plant over-expressing the SlbHLH114 gene is successfully obtained.

In this embodiment, the plant expression vector is used to transform agrobacterium tumefaciens to obtain agrobacterium tumefaciens engineering strains of expression vectors pBin19-E8-SlbHLH114 and 35S-SlbHLH114-NPTII for transforming tomato, and the constructed agrobacterium tumefaciens is used to transform tomato to obtain transgenic tomato plants positive by PCR detection. The acquisition of transgenic tomato plants provides direct materials and theoretical basis for screening high-content steroid alkaloid.

Example 4 determination of steroid alkaloid content in transgenic tomato by LC-MS method

(1) LC-MS conditions

And (3) UPLC: shim-pack UFLC SHIMADZU CBM30A system (https:// www.shimadzu.com.cn /).

A chromatographic column: waters ACQUITY UPLC HSS T3C 18 column (particle size: 1.8 μm; length: width: 100X 2.1 mm).

Mobile phase: the organic phase is alcohol acetonitrile solution, and the water phase is ultrapure water containing 0.01 percent of acetic acid; gradient elution conditions: 0 min-water phase/organic phase (95: 5V/V), 11.0min-5:95V/V, 12.0min-5:95V/V, 12.1min-95:5V/V, 15.0 min-95: 5V/V. The column temperature was 40 ℃, the sample input was 2 μ l, and the sample injection flow rate was 0.4 ml/min.

MS: SCIEX Triple Quad of Ebrisi^TM5500LC-MS/MS system (http:// www.appliedbiosystems.com.cn /).

Electrospray ion source (ESI, electrospraying): the mass spectrum voltage is 5500V, the temperature is 500 ℃, the air curtain gas (CUR) is 40psi, and the parameters of the collision-induced ionization (CAD) are set to be middle; in a triple quadrupole (QQQ), each ion pair is scan detected according to the optimized declustering voltages (DP) and (CE). The compounds were quantified according to the ion pair in the published literature.

(2) Preparation of sample and determination of content of steroid alkaloid

Collecting a peel sample of pBin19-E8-SlbHLH114 transgenic fruit 10 days after color breaking and 35S-SlbHLH114-NPTII transgenic leaf, quickly freezing in liquid nitrogen, freeze-drying in a freeze dryer at low temperature to constant weight, grinding into powder, weighing 0.1g of dry powder, dissolving in 1ml of extracting solution 80% methanol (containing 0.1% formic acid), performing vortex 30S and 40W ultrasonic for 30min, performing vortex 30S, performing centrifugation at 3000g and 4 ℃ for 10 min, transferring supernatant to a new tube, performing centrifugation at 20000g and 4 ℃ for 10 min, passing the supernatant through a 0.22 mu m filter membrane, and storing in a brown sample bottle.

The content of steroid alkaloid is determined by LC-MS method, sample injection volume is 2 μ L, and the content of wild type and transgenic tomato fruit and leaf is represented according to mass spectrum peak area, and the result is shown in figure 2 and figure 3.

The results show that the tomato fruits and leaves of the SlbHLH114 overexpression vector obviously improve the content of steroid alkaloid, and the highest content is that tomatine (tomatidine glycoside) is improved by 2.7 times in a pBin19-E8-SlbHLH114-I strain, and acetooxydehydrotomatine (acetic acid dehydrotomatidine) is improved by 1.7 times in a 35S-SlbHLH114-NPTII-24 strain. In addition, in pBin19-E8-SlbHLH114-I, the content of hydroxyanhydrotinol (hydroxydehydrotomatine), hydroxyanhydrotomatine (hydroxytomatine), delta-tomatine (delta-tomatine glycoside), beta 2-tomatine (beta 2-tomatine glycoside), tomatine-o-rhamnoside (tomatine-o-rhamnoside) and dihydroxy-tomatine-o-hexoside-o-rhamnoside (dydrobase-o-hexose-rhamnoside) is obviously increased, and the increase of cholestrol (cholesterol) is not obvious. In the 35S-SlbHLH114-NPTII strain, the content of tomato alkali, hydroxytomato alkali derivative, filomomatic, delta-tomato alkali (delta-tomatidine glycoside), gamma-tomatidine (gamma-tomatidine), tomatidine-o-rhamnoside (tomatidine-o-rhamnoside), tomatidine (tomatidine glycoside), tomatidine-o-hexoside-pentoside (tomatidine-o-hexoside), lycopersiside A and lycopersiside H is also significantly increased.

In the embodiment, the content of steroid alkaloid in the fruit and leaf of the transgenic tomato of the SlbHLH114 overexpression vector is measured by adopting an LC-MS method, and the metabolic engineering strategy for successfully transforming the SlbHLH114 overexpression vector is adopted to find that the expression level of the SlbHLH114 gene has an obvious positive correlation with the content of the steroid alkaloid, so that a powerful experimental basis is provided for overexpression research by using the gene and further improvement of the content of the steroid alkaloid in the tomato.

The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.

Sequence listing

<110> Sichuan university

<120> application of transcription factor participating in regulation and control of tomato steroid alkaloid synthesis

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggaacaac tcgcggtttc 20

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atttacaaat catagctagt aagaa 25

<210> 3

<211> 1353

<212> DNA

<213> tomato (Solanum lycopersicum)

<400> 3

atggaacaac tcgcggtttc ctcatctccc atggcagtag ctcctcctcc ggtagacgtt 60

aaccaggtgc ctttaggcct acaacagatg cttcaatatg ttgtcaaaag ccaaccagaa 120

tggtgggctt atgctatttt ctggcagacc tctaatgacg acgagggaaa aaacttttta 180

gcttggggag acggatattt ccaaggagat ggtgtagtta ttaacaacaa aggcggcggc 240

ggtagcagca gcagcttaaa gtcacaggct cagtccgaga gaaaaaaagt tattaaagga 300

attcaagctt taatggatgg taatggagat actgatctag tggatgatgg tgatgtaact 360

gacactgagt ggttctacgt gatgtcgctg gcccgttctt tctctgccgg agatggatct 420

gttaccggta aagcttttgg aagtgatgat tttttgtgga taacaggtcc ggaccaattt 480

cagcttcatt acagctgtga aagggctaaa gaagctcaga tccatgggat tcagactctg 540

gttagtattc caacttcaaa tggcgtgttt gaattaggct ccactcaatt aatcaaacag 600

aatttgagct tagttcaaca ggtgaagtct ctgttcctct gttgtccccc tattcaattt 660

ttagaaaaaa caattagttt tgccgatatt ggccttgtca ccggcttgca acaagatgac 720

aatgactata aattaagaga aaacagcaga aaaccgcacc ctgttgtagc caaaaaaaga 780

gggagaaagc ctaaaggcgg cgaggaggat gctcatatgg cggcattgaa ccacgtggaa 840

gcggagagac agaggaggga gaagctgaac caccggttct acgcgttgcg ctccgtcgtt 900

cccaacgtat cgagaatgga caaagcgtca ttgctctcag acgctgtgtc ctacatcaat 960

caactcaaag ccaaggtaga tgaactggag ttgcagctaa ttgatcacac taaaaaaccg 1020

aaaatcgtaa cagaatcatc atcagctgac aaccagagcg ccaccacctc atccgacgac 1080

caagtaatta aagcagctaa tcccacagca gccccggagg ttgaagtgaa aatagttggc 1140

acagatgcaa tgatcagagt tcaatcggaa aacgtggatt atccatcagc aaaactcatg 1200

attgcgcttc aaaatctaca aatgcaagtc caccatgcca gcatttcatc cgtcaatcat 1260

ctcgtccttc atgatgttgt ggttagagtt cctcaaggat tgagcaccga agatgaacta 1320

aggactgctc ttcttactag ctatgatttg taa 1353

<210> 4

<211> 450

<212> PRT

<213> tomato (Solanum lycopersicum)

<400> 4

Met Glu Gln Leu Ala Val Ser Ser Ser Pro Met Ala Val Ala Pro Pro

1 5 10 15

Pro Val Asp Val Asn Gln Val Pro Leu Gly Leu Gln Gln Met Leu Gln

20 25 30

Tyr Val Val Lys Ser Gln Pro Glu Trp Trp Ala Tyr Ala Ile Phe Trp

35 40 45

Gln Thr Ser Asn Asp Asp Glu Gly Lys Asn Phe Leu Ala Trp Gly Asp

50 55 60

Gly Tyr Phe Gln Gly Asp Gly Val Val Ile Asn Asn Lys Gly Gly Gly

65 70 75 80

Gly Ser Ser Ser Ser Leu Lys Ser Gln Ala Gln Ser Glu Arg Lys Lys

85 90 95

Val Ile Lys Gly Ile Gln Ala Leu Met Asp Gly Asn Gly Asp Thr Asp

100 105 110

Leu Val Asp Asp Gly Asp Val Thr Asp Thr Glu Trp Phe Tyr Val Met

115 120 125

Ser Leu Ala Arg Ser Phe Ser Ala Gly Asp Gly Ser Val Thr Gly Lys

130 135 140

Ala Phe Gly Ser Asp Asp Phe Leu Trp Ile Thr Gly Pro Asp Gln Phe

145 150 155 160

Gln Leu His Tyr Ser Cys Glu Arg Ala Lys Glu Ala Gln Ile His Gly

165 170 175

Ile Gln Thr Leu Val Ser Ile Pro Thr Ser Asn Gly Val Phe Glu Leu

180 185 190

Gly Ser Thr Gln Leu Ile Lys Gln Asn Leu Ser Leu Val Gln Gln Val

195 200 205

Lys Ser Leu Phe Leu Cys Cys Pro Pro Ile Gln Phe Leu Glu Lys Thr

210 215 220

Ile Ser Phe Ala Asp Ile Gly Leu Val Thr Gly Leu Gln Gln Asp Asp

225 230 235 240

Asn Asp Tyr Lys Leu Arg Glu Asn Ser Arg Lys Pro His Pro Val Val

245 250 255

Ala Lys Lys Arg Gly Arg Lys Pro Lys Gly Gly Glu Glu Asp Ala His

260 265 270

Met Ala Ala Leu Asn His Val Glu Ala Glu Arg Gln Arg Arg Glu Lys

275 280 285

Leu Asn His Arg Phe Tyr Ala Leu Arg Ser Val Val Pro Asn Val Ser

290 295 300

Arg Met Asp Lys Ala Ser Leu Leu Ser Asp Ala Val Ser Tyr Ile Asn

305 310 315 320

Gln Leu Lys Ala Lys Val Asp Glu Leu Glu Leu Gln Leu Ile Asp His

325 330 335

Thr Lys Lys Pro Lys Ile Val Thr Glu Ser Ser Ser Ala Asp Asn Gln

340 345 350

Ser Ala Thr Thr Ser Ser Asp Asp Gln Val Ile Lys Ala Ala Asn Pro

355 360 365

Thr Ala Ala Pro Glu Val Glu Val Lys Ile Val Gly Thr Asp Ala Met

370 375 380

Ile Arg Val Gln Ser Glu Asn Val Asp Tyr Pro Ser Ala Lys Leu Met

385 390 395 400

Ile Ala Leu Gln Asn Leu Gln Met Gln Val His His Ala Ser Ile Ser

405 410 415

Ser Val Asn His Leu Val Leu His Asp Val Val Val Arg Val Pro Gln

420 425 430

Gly Leu Ser Thr Glu Asp Glu Leu Arg Thr Ala Leu Leu Thr Ser Tyr

435 440 445

Asp Leu

450

<210> 5

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggggacaagt ttgtacaaaa aagcaggctt aatggaacaa ctcgcggttt c 51

<210> 6

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggggaccact ttgtacaaga aagctgggta tcttactagc tatgatttgt aa 52

<210> 7

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcgccgtctc gctcgaatgg aacaactcgc ggtttc 36

<210> 8

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcgccgtctc gctcaaagcc ttactagcta tgatttgtaa 40

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aagagaaaac agcagaaaac cg 22

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcaacacatg agcgaaaccc t 21

<210> 11

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gagcatcgtg gaaaaagaag acgttc 26

<210> 12

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gctcaacaca tgagcgaaac cctata 26

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gttgattgat gtaggacaca gc 22

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gccaaagaag atcaagcaca 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tcagcattag ggcactcctt 20

Claims

1. The application of the transcription factor SlbHLH114 for over-expressing and regulating the synthesis of the tomato steroid alkaloid in improving the content of the plant steroid alkaloid is characterized in that: the amino acid sequence of the transcription factor SlbHLH114 is shown in SEQ ID NO. 4; the steroid alkaloid is one or more of hydroxyl dehydro-tomatidine, hydroxyl tomatidine, delta-tomatidine glycoside, beta 2-tomatidine glycoside, tomatidine-o-rhamnoside, tomatidine, filomodine, gamma-tomatidine, tomatidine-o-hexose-pentoside, acetic acid dehydrotomatidine, lycopersiside A and lycopersiside H; the plant is tomato.

2. The use of the transcription factor SlbHLH114 involved in the regulation and control of tomato steroid alkaloid synthesis for increasing the content of plant steroid alkaloids according to claim 1, wherein: the nucleotide sequence of the transcription factor SlbHLH114 is shown in SEQ ID NO. 3.

3. A method for increasing the content of plant steroid alkaloid is characterized in that: overexpression of a transcription factor SlbHLH114 involved in regulation and control of tomato steroid alkaloid synthesis in a plant, wherein the amino acid sequence of the transcription factor SlbHLH114 is shown as SEQ ID NO.4, and the plant is a tomato; the steroid alkaloid is one or more of hydroxyl dehydro-tomatidine, hydroxyl tomatidine, delta-tomatidine glycoside, beta 2-tomatidine glycoside, tomatidine-o-rhamnoside, tomatidine, filomodine, gamma-tomatidine, tomatidine-o-hexose-pentoside, acetic acid dehydrotomatidine, lycopersiside A and lycopersiside H.

4. A method of increasing the level of plant steroidal alkaloids according to claim 3, wherein: the method of overexpression in plants is as follows: cloning a transcription factor SlbHLH114 gene, constructing a plant expression vector to obtain a recombinant plant expression vector containing the transcription factor SlbHLH114, transforming agrobacterium tumefaciens into the obtained recombinant plant expression vector to obtain engineering bacteria, finally transforming a plant explant by the engineering bacteria, and obtaining a transgenic plant, namely a plant with high steroid alkaloid content, through co-culture, regeneration culture and rooting culture and positive identification.

5. The method of claim 4, wherein the plant steroidal alkaloid content is increased by: the method for cloning the transcription factor SlbHLH114 gene comprises the following steps: and carrying out PCR amplification by taking tomato cDNA as a template and the sequences shown in SEQ ID NO.1 and SEQ ID NO.2 as primers to obtain the cloned transcription factor SlbHLH114 gene.

6. The method of claim 4, wherein the plant steroidal alkaloid content is increased by: the method for constructing the plant expression vector comprises the following steps: the nucleotide sequence shown as SEQ ID NO.3 is connected into pBin19-E8-GW and pBin19-35S-GW vectors.