JP2009065886A - Method for plant configuration control - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for plant configuration control, which moderately dwarfs a plant body without causing germination incompetence or flower-bud formation incompetence. <P>SOLUTION: The method for plant configuration control comprises raising a transgenic plant incorporated with a gene encoding a protein (steviol synthase) having a function of hydroxylating carbon at the 13 position of ent-kaurenoic acid or ent-gibberellane skeleton so as to overexpress the gene. For example, a gene containing a polynucleotide encoding a protein containing a specific amino acid sequence is cited as the gene. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for regulating the morphology of a plant that regulates to a significantly different morphology as compared to a wild type plant.

  Among cytochrome P450 enzymes, CYP714A2 derived from Arabidopsis thaliana is known to belong to the same family as rice CYP714D1. Rice CYP714D1 has a function of catalyzing the epoxidation of the C-16 (17) position of gibberellin (Non-patent Document 1). Therefore, CYP714A2 derived from Arabidopsis thaliana is also expected to have the same function, but the actual function in vivo was unknown.

  Steviol, on the other hand, is an aglycone of stevioside, a natural sweetener produced by Stevia rebaudiana. Stevioside biosynthetic enzymes have been vigorously studied including approaches such as mass collection of ESTs (Non-Patent Document 2), and a plurality of enzymes involved in glycosylation of steviol (glucosyltransferase) have been identified. However, the steviol synthase gene has not yet been identified, and metabolic engineering for increasing stevioside production ability has been very difficult in this respect.

  Furthermore, most enzymes involved in the biosynthesis and metabolism of gibberellin, a plant growth hormone, have already been identified, but no gene encoding the hydroxylase at the C-13 position of gibberellin has been identified.

  Furthermore, in the above situation, it was completely unknown what kind of phenotype the transformed plant overexpressing the gene encoding the hydroxylase at the C-13 position of gibberellin shows. According to Non-Patent Document 1, it is known that rice CYP714D1 catalyzes the epoxidation of gibberellin at the C-16 (17) position, and thus greatly reduces the hormone activity of gibberellin. Therefore, when this CYP714D1 gene is overexpressed, the plant body becomes extremely fertile. It is an important technique in the field of agriculture and horticulture to moderately reduce the endogenous amount and physiological activity of gibberellin and reduce the height of the plant, but if gibberellin is completely lost, germination failure and flower bud formation failure It becomes fatal to plant growth.

Zhu et al., ELONGATED UPPERMOST INTERNODE encodes a cytochrome P450 monooxygenase that epoxidizes gibberellins in a novel deactivation reaction in rice.Plant Cell, 18: 442-456 (2006) Richman A, Swanson A, Humphrey T, Chapman R, McGarvey B, Pocs R, Brandle J. Functional genomics uncovers three glucosyltransferases involved in the synthesis of the major sweet glucosides of Stevia rebaudiana.Plant J. 41: 56-67 (2005)

  As described above, in the past, it was possible to extremely dwarf the plant body, but there is no technology for appropriately dwarfing the plant body without causing problems such as failure to germinate or bud formation failure. There was a problem.

  Thus, as a result of intensive studies to solve the above-mentioned problems, the present inventors have succeeded in finding out that CYP714A2 derived from Arabidopsis belonging to the same family as rice CYP714D1 is surprisingly a steviol synthase. did. Furthermore, the present inventors developed a system capable of biosynthesis of steviol in large quantities by overexpressing the steviol synthase gene, and found an interesting phenotype, thereby completing the present invention. Furthermore, the present inventors found an interesting phenotype by overexpressing the CYP714B1 gene, which is one of CYP714A2 homologous gene candidates in rice, and completed the present invention.

  The plant morphology control method according to the present invention is incorporated so as to overexpress a gene encoding a protein having a function of hydroxylating the carbon at position 13 of ent-kaurenoic acid or the carbon at position 13 of the ent-gibberellane skeleton. It grows transformed plants.

Examples of the gene include any of the polynucleotides (a) to (c).
(A) a polynucleotide encoding a protein comprising the amino acid sequence shown in SEQ ID NO: 2 (b) comprising an amino acid sequence in which one or more amino acids have been deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 2, A polynucleotide encoding a protein having a function of hydroxylating carbon at position 13 of kaurenoic acid (c) comprising an amino acid sequence having 70% or more homology to the amino acid sequence shown in SEQ ID NO: 2, and containing ent-kaurenoic acid A polynucleotide encoding a protein having a function of hydroxylating the 13th carbon of the above-mentioned gene. Examples of the gene include any of the polynucleotides (a) to (c).
(A) a polynucleotide encoding a protein comprising the amino acid sequence shown in SEQ ID NO: 13 (b) comprising an amino acid sequence in which one or more amino acids have been deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 13, A polynucleotide encoding a protein having a function of hydroxylating carbon at position 13 of the gibberellane skeleton (c) comprising an amino acid sequence having 70% or more homology with the amino acid sequence shown in SEQ ID NO: 13, A polynucleotide encoding a protein having a function of hydroxylating carbon at position 13 is not particularly limited, and for example, derived from a plant selected from the group consisting of Arabidopsis thaliana, rice, poplar, persimmon tea and stevia Preferably there is.

According to the present invention, a gene encoding a protein having a function of hydroxylating the 13th carbon of ent-kaurenoic acid or the 13th carbon of the ent-gibberellane skeleton is overexpressed to show semi-fertility, it is possible to provide the form method of modulating a plant such recover semidwarfism by administering exogenous gibberellin a _4.

Hereinafter, the present invention will be described in detail with reference to the drawings.
1. Novel steviol synthase gene The steviol synthase gene according to the present invention is a gene encoding an enzyme (steviol synthase) having hydroxylation activity for the 13th carbon of ent-kaurenoic acid. The steviol synthetase can be isolated from plants and fungi known to produce various glycosides using steviol as an aglycone. As an example, a steviol synthase gene derived from Arabidopsis thaliana can be mentioned. The base sequence of the steviol synthetase gene derived from Arabidopsis thaliana is shown in SEQ ID NO: 1, and the amino acid sequence of the steviol synthase derived from Arabidopsis thaliana is shown in SEQ ID NO: 2.

  The nucleotide sequence shown in SEQ ID NO: 1 is known to encode the Arabidopsis cytochrome P450 enzyme CYP714A2, but the knowledge that this CYP714A2 has hydroxylation activity for the 13th carbon of ent-kaurenoic acid is unknown. there were. Heretofore, an enzyme having hydroxylation activity for the 13th carbon of ent-kaurenoic acid has not been identified, and the knowledge that the protein consisting of the amino acid sequence shown in SEQ ID NO: 2 is steviol synthase is completely new. is there. The reaction for hydroxylating the 13th carbon of ent-kaurenoic acid is shown in the following formula.

  The steviol synthase gene according to the present invention is not limited to a gene derived from Arabidopsis thaliana, but may be a gene derived from a plant or fungus that accumulates steviol or a glycoside thereof.

  Further, the steviol synthase gene according to the present invention includes an amino acid sequence in which one or more amino acids are deleted, substituted, added or deleted in the amino acid sequence shown in SEQ ID NO: 2, and contains the carbon at position 13 of ent-kaurenoic acid. It may contain a polynucleotide encoding a protein having a function of hydroxylating. Here, one or more amino acids means, for example, 1 to 20 amino acids, preferably 1 to 10 amino acids, more preferably 1 to 5 amino acids.

  Further, the steviol synthase gene according to the present invention comprises an amino acid sequence having a homology of 70% or more, preferably 80% or more, more preferably 90% or more with respect to the amino acid sequence shown in SEQ ID NO: 2, It may include a polynucleotide encoding a protein having a function of hydroxylating 13th carbon of kaurenoic acid. Here, the homology of amino acid sequences can be determined using the algorithm BLAST (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990, Proc Natl Acad Sci USA 90: 5873, 1993). Homology between amino acid sequences can be calculated using a program called BLASTX (Altschul SF, et al: J Mol Biol 215: 403, 1990) based on the BLAST algorithm. Good.

  Furthermore, the steviol synthase gene according to the present invention hybridizes under stringent conditions with a probe comprising the whole or a part of the base sequence shown in SEQ ID NO: 1 or a complementary strand thereof, and ent-kaurene. It may contain a polynucleotide encoding a protein having a function of hydroxylating the 13th carbon of the acid. As a probe that can hybridize under stringent conditions, one or a plurality of continuous sequences of at least 20, preferably at least 30, for example, 40, 60, or 100 of the base sequence shown in SEQ ID NO: 1 was selected. Polynucleotides can be used. Stringent conditions are those in which a specific hybrid signal is clearly distinguished from a non-specific hybrid signal. Stringent conditions include, for example, 5 × SSC, 1.0% (W / V) nucleic acid hybridization blocking reagent (Boehringer Mannheim), 0.1% (W / V) N-lauroyl sarcosine, 0.02% (W / V) After hybridization (about 8 to 16 hours) using SDS, washing with 0.1 × SSC, 0.1% (W / V) SDS is performed twice for 15 minutes. Moreover, the temperature of hybridization and washing can illustrate 67 degreeC or more. Hybridization is performed in Molecular Cloning: A laboratory Mannual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY., 1989, Current Protocols in Molecular Biology, Supplement 1-38, John Wiley & Sons (1987- 1997).

  By the way, a polynucleotide encoding an amino acid sequence having one or more amino acid deletions, substitutions, additions or insertions in the amino acid sequence shown in SEQ ID NO: 2, 70% or more with respect to the amino acid sequence shown in SEQ ID NO: 2, preferably A polynucleotide encoding an amino acid sequence having a homology of 80% or more, more preferably 90% or more, a probe comprising the whole or a part of the base sequence shown in SEQ ID NO: 1, or a complementary strand thereof, and stringent conditions The polynucleotide to be hybridized below can be obtained by any method known to those skilled in the art, such as chemical synthesis, genetic engineering, or mutagenesis, based on the nucleotide sequence and amino acid sequence information shown in SEQ ID NOs: 1 and 2. Can be produced.

  For example, the polynucleotide having the base sequence shown in SEQ ID NO: 1 is shown in SEQ ID NO: 2 by using a method of contacting a mutagen with a drug, a method of irradiating ultraviolet rays, a genetic engineering technique, etc. A polynucleotide encoding an amino acid sequence having one or more amino acid deletions, substitutions, additions or insertions in the amino acid sequence can be produced. Site-directed mutagenesis, which is one of genetic engineering techniques, is useful because it can introduce specific mutations at specific positions. Molecular Cloning: A laboratory Mannual, 2nd Ed., Cold Spring Harbor Laboratory , Cold Spring Harbor, NY., 1989, Current Protocols in Molecular Biology, Supplements 1-38, John Wiley & Sons (1987-1997).

  Whether a polynucleotide having a predetermined base sequence is a steviol synthase gene can be verified as follows. That is, the transformant introduced so that the gene containing the polynucleotide to be examined can be expressed is cultured in a medium containing ent-kaurenoic acid as a substrate. Thereafter, the components contained in the extract from the medium are subjected to a gas chromatography-mass spectrometer to confirm whether steviol is synthesized as a metabolite of ent-kaurenoic acid. If steviol is detected, the gene containing the polynucleotide to be examined is found to be a steviol synthase gene.

By the way, as described above, the steviol synthase gene according to the present invention encodes steviol synthase having an activity of hydroxylating carbon at position 13 of ent-kaurenoic acid. It is not limited to the activity of hydroxylating 13th carbon of kaurenoic acid. That is, the steviol synthase also has an activity of hydroxylating the 13th carbon in ent-7β-hydroxykaurenoic acid. The steviol synthase also has an activity of hydroxylating the carbon at position _{12 of} gibberellin A ₁₂ -7-aldehyde, but slightly hydroxylates the carbon at position 13 of gibberellin A ₁₂ -7-aldehyde. Only. Furthermore, the steviol synthetase gene is also has activity of hydroxylating the 12th carbon of gibberellin A _12, 13th carbon of gibberellin A ₁₂ is only slightly hydroxide. The hydroxylation activity by these steviol synthetases is schematically shown in FIG.

2. Expression vector The steviol synthase gene described in 1. can be used and stored by inserting it into an appropriate vector. The type of the original vector is not particularly limited. For example, the vector may be a self-replicating vector, or when it is introduced into the host cell, it is integrated into the host cell genome and replicated together with the integrated chromosome. It may be. In particular, as the vector, it is preferable to use a vector that can be incorporated so that the above-mentioned steviol synthase gene can be expressed. That is, it is preferably prepared as an expression vector having the above-mentioned steviol synthase gene. In the expression vector, the steviol synthase gene is functionally linked to elements necessary for transcription (for example, a promoter and the like). A promoter is a DNA sequence that exhibits transcriptional activity in a host cell, and can be appropriately selected according to the type of host.

  Examples of promoters that can operate in bacterial cells include the Bacillus stearothermophilus maltogenic amylase gene, the Bacillus licheniformis alpha-amylase gene, and the Bacillus amyloliquefaction. Bacillus amyloliquefaciens BAN amylase gene, Bacillus subtilis alkaline protease gene, Bacillus pumilus xylosldase gene promoter, or phage lambda PR or Examples include the PL promoter, E. coli lac, trp or tac promoter.

  Examples of promoters operable in mammalian cells include SV40 promoter, MT-1 (metallothionein gene) promoter, adenovirus 2 major late promoter, and the like. Examples of promoters operable in insect cells include polyhedrin promoter, P10 promoter, autographa calicornica polyhedrosis basic protein promoter, baculovirus immediate early gene 1 promoter, or baculovirus 39K delayed early gene promoter. Is mentioned. Examples of promoters that can operate in yeast host cells include promoters derived from yeast glycolytic genes, alcohol dehydrogenase gene promoters, TPI1 promoters, ADH2-4c promoters, and the like. Examples of promoters that can operate in filamentous fungal cells include the ADH3 promoter or the tpiA promoter.

  The expression vector may further contain a selection marker. Examples of selectable markers include dihydrofolate reductase (DHFR) or a gene lacking its complement, such as Schizosaccharomyces pombe TPI gene, or ampicillin, kanamycin, tetracycline, chloramphenicol, Mention may be made of drug resistance genes such as neomycin or hygromycin.

  In addition, when constructing an expression vector for the purpose of overexpressing the above-mentioned steviol synthase gene in plants, any vector can be used as long as it can express the steviol synthase gene in plants. It is. Specifically, a vector that can be integrated into the genome of a host plant when a part of a vector DNA such as a vector derived from Agrobacterium tumefaciens Ti plasmid is introduced into a plant cell, such as pKYLX6, pKYLX7, pBI101, pBH2113, pBI121 (Clontech Laboratories, Inc.).

  As a promoter that functions in a plant, either a promoter derived from the target plant or a heterogeneous promoter can be used as long as it functions in the target plant. Further, if necessary, an externally inducible promoter or a tissue-specific promoter can be used. CaMV35S promoter, NOS promoter, and octopine synthase promoter (Fromm et al. (1989) Plant Cell 1: 977), which are promoters showing non-tissue specific but strong expression inducibility, can also be used. Moreover, the rbcS promoter and cab promoter which induce strong expression in green leaves can be used (Chory et al. (1991), Plant Cell, 3, 445-459). Estradiol i-inducible promoter (Plant Cell 2000; 12: 65-80), pUAS-Gal4 glucocorticoid-inducible promoter (Plant J. 11, 605-612)) and the like can also be used. Specific examples of promoters include Agrobacterium tumefaciens T-DNA-derived promoter, Smas promoter, cinnamon alcohol dehydrogenase promoter, ribulose diphosphate carboxylase oxygenase (Rubisco) promoter, GRP1-8 promoter, plant-derived actin and histone Promoters / enhancers and other transcription initiation regions from various known plant genes.

  Furthermore, in order to efficiently express the steviol synthase gene, a poly (A) + sequence may be added to the 3 ′ end of the coding region of the gene. The poly (A) + sequence can be derived from various plant genes or T-DNA, but is not limited thereto. In addition, other sequences useful for expressing the gene at a high level, for example, an intron sequence of a specific gene, a 5'-untranslated region sequence, and the like can also be included in the expression vector.

  Furthermore, the expression vector can contain various antibiotic resistance genes and other marker genes as selection marker genes. Marker genes include anti-spectinomycin gene, streptomycin resistance gene (streptomycin phosphotransferase (SPT) gene), kanamycin or geneticin resistant neomycin phosphotransferase (NPTII) gene, hygromycin resistant hygromycin phosphotransferase (HPT) gene, Examples include resistance genes for herbicides that inhibit acetolactate synthase (ALS), resistance genes for herbicides that inhibit glutamine synthase (eg, the bar gene), β-glucuronidase genes, luciferase genes, and the like.

3. Transformant 2. A transformant can be produced by introducing the expression vector described in 1 above into a host cell. The host cell may be any cell as long as it can express the steviol synthase gene incorporated in the expression vector, and may be any of bacteria, yeast, fungi, animal cells, insect cells and / or plant cells.

  Examples of bacteria include gram-positive bacteria such as Bacillus or Streptomyces, or gram-negative bacteria such as Escherichia coli. Transformation of these bacteria may be performed by using competent cells by a protoplast method or a known method. Examples of mammalian cells include HEK293 cells, HeLa cells, COS cells, BHK cells, CHL cells, or CHO cells. Methods for transforming mammalian cells and expressing DNA sequences introduced into the cells are also known, and for example, electroporation method, calcium phosphate method, lipofection method and the like can be used. Examples of the yeast include cells belonging to Saccharomyces or Schizosaccharomyces, and examples thereof include Saccharomyces cerevis 1ae and Saccharomyces kluyveri. Examples of the method for introducing a recombinant vector into a yeast host include an electroporation method, a spheroblast method, and a lithium acetate method.

  Moreover, it is although it does not specifically limit as a fungus, It is preferable to use the fungus known as a gibberellin producing microbe. Examples of gibberellin-producing bacteria include Giberella fujikuroi, Phaeosphaeria sp. L487, and the like. These gibberellin-producing bacteria may accumulate a large amount of ent-kaurenoic acid, which is a substrate for steviol synthase, through metabolism. Therefore, by overexpressing the steviol synthase gene, the accumulated ent-kaurenoic acid is It can be expected that a large amount of steviol can be synthesized.

  Furthermore, when a plant is transformed, the above 2. For example, particle gun method, electroporation method, polyethylene glycol (PEG) method, calcium phosphate method, DEAE dextran method, microinjection method, lipofection method and Agrobacterium-mediated transfection method using the expression vector described in 1. Can be applied. In plant cells, the particle gun method, electroporation method, polyethylene glycol (PEG) method and Agrobacterium method are preferred, and the Agrobacterium method is particularly preferred (Bechtold N. & Pelletier G., Methods Mol. Biol. 82 , pp.259-266, 1998).

  Plants to be transformed include whole plants, plant organs (eg leaves, petals, stems, roots, seeds, etc.), plant tissues (eg epidermis, phloem, parenchyma, xylem, vascular bundles, fences) Tissue, spongy tissue, etc.) or plant cultured cells (for example, callus). Although it does not limit as a plant used for transformation, For example, the following can be considered.

Eggplant family: Eggplant (Solanum melongena L.), tomato (Lycopersicon esculentum Mill), pepper (Capsicum annuum L. var. Angulosum Mill.), Pepper (Capsicum annuum L.), tobacco (Nicotiana tabacum L.)
Brassicaceae: Arabidopsis thaliana, Brassica (Brassica campestris L.), Chinese cabbage (Brassica pekinensis Rupr.), Cabbage (Brassica oleracea L. var. Capitata L.), Japanese radish (Raphanus sativus L.), Rapeseed (Brassica) L., B. napus L.)
Gramineae: corn (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum L.), barley (Hordeum vulgare L.)
Legumes: soybean (Glycine max), azuki bean (Vigna angularis Willd.), Green beans (Phaseolus vulgaris L.), broad bean (Vicia faba L.)
Cucurbitaceae: Cucumber (Cucumis sativus L.), Melon (Cucumis melo L.), Watermelon (Citrullus vulgaris Schrad.), Pumpkin (C. moschata Duch., C. maxima Duch.)
Convolvulaceae: Sweet potato (Ipomoea batatas)
Lilies: Allium fistulosum L., Onion (Allium cepa L.), leek (Allium tuberosum Rottl.), Garlic (Allium sativum L.), asparagus (Asparagus officinalis L.)
Labiatae: Perilla (Perilla frutescens Britt. Var. Crispa)
Asteraceae: Chrysanthemum morifolium, Chrysanthemum coronarium L., Lettuce (Lactuca sativa L. var. Capitata L.)
Rosaceae: Rose (Rose hybrida Hort.), Strawberry (Fragaria x ananassa Duch.)
Citrus family: Citrus unshiu, Salamander (Zanthoxylum piperitum DC.)
Myrtaceae: Eucalyptus (Eucalyptus globulus Labill)
Willowaceae: Poplar (Populas nigra L. var. Italica Koehne)
Rabbitaceae: Spinach (Spinacia oleracea L.), sugar beet (Beta vulgaris L.)
Gentianaceae: Gentian (Gentiana scabra Bunge var. Buergeri Maxim.)
Nadesico: Carnation (Dianthus caryophyllus L.)

  In particular, as a plant to be transformed, it is preferable to use a plant known to biosynthesize various glycosides using steviol as an aggragon. Examples of such plants include stevia (Stevia rebaudiana) and strawberry tea (Rubus suauissimus). In addition, examples of plants to be transformed include poplar (Populas nigra L. var. Italica Koehne) whose use as biomass has been studied.

  The tumor tissue, shoots, hairy roots, etc. obtained as a result of transformation can be used as they are for cell culture, tissue culture, or organ culture, and use a conventionally known plant tissue culture method. The plant body (transgenic plant) can be regenerated by administration of an appropriate concentration of a plant hormone (auxin, cytokinin, gibberellin, abscisic acid, ethylene, brassinolide, etc.).

  Whether or not the steviol synthase gene has been incorporated into a plant can be confirmed by PCR, Southern hybridization, Northern hybridization, or the like. For example, DNA is prepared from a transgenic plant, PCR is performed by designing DNA-specific primers. PCR can be performed under the same conditions as those used to amplify the cDNA fragment of the steviol synthase gene inserted into the expression vector. Thereafter, the amplified product is subjected to agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, etc., stained with ethidium bromide, SYBR Green solution, etc., and the amplified product is detected as a single band, It can be confirmed that it has been transformed. Moreover, PCR can be performed using a primer previously labeled with a fluorescent dye or the like to detect an amplification product. Furthermore, it is possible to employ a method in which the amplification product is bound to a solid phase such as a microplate and the amplification product is confirmed by fluorescence or enzyme reaction.

4). Method for producing steviol 2. Steviol can be biosynthesized by culturing or growing the transformant described in 1 above in the presence of ent-kaurenoic acid. That is, steviol synthase expressed in the transformant can produce steviol by hydroxylating the 13th carbon of ent-kaurenoic acid. Here, ent-kaurenoic acid may be endogenous or exogenously administered.

  Further, steviol biosynthesized in the transformant can be extracted according to a conventional method. For example, a transformant after culture or growth can be extracted using an acetone solvent or ethyl acetate-normal hexane (1: 1) solvent, and steviol can be separated and purified from the extract.

  As described above, the above 1. A steviol biosynthesis system can be developed by using the steviol synthetase gene described in 1., and steviol can be produced by biosynthesis. Conventionally, in a system in which various glycosides having steviol as an aglycone are produced by metabolic engineering, steviol synthesis has been the rate-limiting step. However, the above 1. By utilizing the steviol synthetase gene described in 1., a system for producing various glycosides can be developed without making steviol synthesis a rate-limiting step (see FIG. 2).

  Here, as a glycoside having steviol as an aglycon, for example, stevioside, rebaudioside A, rebaudioside B, rebaudioside C, rebaudioside D, rebaudioside E, rebaudioside F, dulcoside A, steviolmonoside, steviolbioside, rubusoside, etc. Can be mentioned. That is, the above 1. By utilizing the steviol synthase gene described in 1., a system capable of producing these various glycosides with excellent yields can be developed.

5). Phenotype by overexpression of steviol synthase gene As described above, 1. If the steviol synthase gene described in (1) is overexpressed in the plant, the synthesis of steviol is promoted. In addition to the above, 1. When the steviol synthase gene described in the above is overexpressed in the plant, the synthesis of gibberellin A ₁ is promoted among the gibberellins which are plant growth hormones. In wild-type plants, a relatively large amount of gibberellin A ₄ having a higher physiological activity than gibberellin A ₁ is accumulated using ent-kaurenoic acid as a precursor. Conventionally, gibberellin A ₁ was thought to be synthesized by hydroxylating gibberellin A ₄ .

However, the above 1. In steviol synthetase gene explained since the accumulation amount of gibberellin A ₁ overexpression in a plant increases, gibberellin A ₁ in a plant has a high probability biosynthesized steviol as a precursor. This is a finding contrary to the conventional prediction described above (see FIG. 2).

In other words, the above 1. By overexpressing the steviol synthase gene described in the above in a plant, the abundance ratio between gibberellin A ₄ and gibberellin A ₁ in the plant can be changed as compared with a wild type plant. Specifically, the above 1. By overexpressing the steviol synthase gene described in the above in the plant, the value of (gibberellin A ₁ amount) / (gibberellin A ₄ ) can be adjusted to be larger than that in the wild type plant.

The above 1. When the steviol synthase gene described in the above is overexpressed in a plant, the plant exhibits a characteristic phenotype such as semi-dwarfism. Specifically, the above 1. Plants that overexpress the steviol synthase gene described in 1 are significantly dwarfed compared to wild type plants. Moreover, it plants showing a semi-dwarf, grown to the size of the equivalent wild-type plants by exogenous administration of gibberellin A ₄ is restored. Here, semi-dwarf means hatching in a range that is significantly smaller than a wild-type plant body and significantly larger than a mutant whose gibberellin in the body is below the detection limit. Here, it is known that a mutant whose gibberellin in the body is below the detection limit has a very high degree of hatching.

That is, the above 1. In a plant half dwarfed by overexpressing steviol synthetase gene explained, then it is possible to provide the form method of modulating a plant such as to restore the growth by exogenous administration of gibberellin A _4.

  In addition, a gene encoding a protein that does not have a function of hydroxylating the 13th carbon of ent-kaurenoic acid but has a function of hydroxylating the 13th carbon of the ent-gibberellane skeleton is overexpressed in the plant. However, the plant exhibits a characteristic phenotype such as semi-dwarfism. An example of a gene encoding a protein having a function of hydroxylating the carbon at position 13 of the ent-gibberellan skeleton is CYP714B1 gene, which is one of CYP714A2 homologous gene candidates derived from rice. The base sequence of the CYP714B1 gene is shown in SEQ ID NO: 12, and the amino acid sequence of the protein encoded by the CYP714B1 gene is shown in SEQ ID NO: 13.

  As a gene encoding a protein having a function of hydroxylating carbon at position 13 of the ent-gibberellan skeleton, an amino acid sequence in which one or more amino acids are deleted, substituted, added or deleted in the amino acid sequence shown in SEQ ID NO: 13 And a polynucleotide encoding a protein having a function of hydroxylating carbon at position 13 of the ent-gibberellane skeleton. Here, one or more amino acids means, for example, 1 to 20 amino acids, preferably 1 to 10 amino acids, more preferably 1 to 5 amino acids.

  Furthermore, the gene encoding a protein having a function of hydroxylating carbon at position 13 of the ent-gibberellane skeleton is 70% or more, preferably 80% or more, more preferably 90%, relative to the amino acid sequence shown in SEQ ID NO: 3. It may contain a polynucleotide encoding a protein containing an amino acid sequence having a homology of at least% and having a function of hydroxylating the 13th carbon of the ent-gibberellan skeleton. Here, the homology of amino acid sequences can be determined using the algorithm BLAST (Proc. Natl. Acad. Sci. USA 87: 2264-2268, 1990, Proc Natl Acad Sci USA 90: 5873, 1993). Homology between amino acid sequences can be calculated using a program called BLASTX (Altschul SF, et al: J Mol Biol 215: 403, 1990) based on the BLAST algorithm. Good.

  EXAMPLES Hereinafter, although this invention is demonstrated in detail using an Example, the technical scope of this invention is not limited to a following example.

[Example 1] Functional test of novel steviol synthase The full-length cDNA of cytochrome P450 enzyme gene CYP714A2 was isolated from immature sheath of Arabidopsis thaliana using RT-PCR. The following primer sets were used for RT-PCR, and Expand High Fidelity ^PLUS PCR System (Roche) and Pyrobest (TaKaRa) were used. Next, using the cDNA obtained by RT-PCR as a template, PCR primers 714A2-F1 (CGGGATCC ATG GAGAGTTTGGTTGTTCATAC (SEQ ID NO: 3): BamH I restriction enzyme site is placed immediately before the translation initiation codon (underlined)) and 714A2 A restriction enzyme site was introduced by performing PCR using -R1 (GGGGTACC TCA AACAACCCTAATGACAACAC (SEQ ID NO: 4): a Kpn I restriction enzyme site immediately after the stop codon (underlined)). The product was digested with BamH I and Kpn I restriction enzymes and then ligated into the pYeDP60 vector BamH I / Kpn I sites. The pYeDP60 vector is a known vector that induces cytochrome P450 gene expression in the presence of galactose.

  The resulting plasmid is a known WAT11 yeast (Pompon D, Louerat B, Bronine A, Urban P (1996) Yeast expression of animal and plant P450s in optimized redox) that co-expresses Arabidopsis cytochrome P450 reductase 1 in the presence of galactose. environments. Methods Enzymol 272: 51-64).

The obtained transformant was planted in 10 ml of SGI liquid medium (Glucose 20 g, Yeast Nitrogen Base without Amino Acids 6.7 g, Bacto Casamino Acid 1 g, DL-Tryptophan 40 mg, H ₂ O 1 L) and shaken at 30 ° C. for 24 hours. Cultured (200 rpm). 1 ml of the culture solution is inoculated into 10 ml of SLI liquid medium (Galactose 20 g, Yeast Nitrogen Base without Amino Acids 6.7 g, Bacto Casamino acid 1 g, DL-Tryptophan 40 mg, H ₂ O 1 L) at a concentration of 4 × 10 ⁷ cells / ml at 28 ° C. Cultured with shaking until grown. The grown transformed yeast was diluted with fresh SLI liquid medium to a concentration of 8 × 10 ⁶ cells / ml. 1 μg (dissolved in 1 μl of ethanol) of ent-kaurenoic acid, ent-7β-hydroxykaurenoic acid, gibberellin A ₁₂ -7-aldehyde (hereinafter referred to as GA ₁₂ -7-aldehyde), gibberellin A in 5 ml of the transformant medium ₁₂ (hereinafter referred to as GA ₁₂ ) was added and cultured with shaking at 28 ° C. until the cells grew to a concentration of 6 × 10 ⁷ cells / ml. After culturing, the transformant to which ent-kaurenoic acid, ent-7β-hydroxykaurenoic acid, GA12-7-aldehyde was added and its medium were extracted with ethyl acetate-normal hexane (1: 1). After drying, 90% methanol was dissolved and passed through a Bond Elut C18 column (100 mg, manufactured by VARIAN). The transformant to which GA12 was added and its medium were extracted with ethyl acetate. The extract was dried, dissolved in 80% methanol, and passed through a Bond Elut C18 column. The eluate was dried and then derivatized to a methyl-TMSi form and analyzed by GC-MS. For GC-MS, a DB-1 column (0.25 mm × 15 m; 0.25 μm film thickness, manufactured by J & W Scientific) was used in Automass (JEOL) -6890N (Agilent technologies). The carrier gas is He (1 ml / min). The injection temperature was 250 ° C. The column oven is held at 80 ° C for 1 minute after injection, then heated to 200 ° C at 30 ° C / minute, then raised to 250 ° C at 5 ° C / minute, and then raised to 300 ° C at 30 ° C / minute. And kept at 300 ° C. for 1 minute. The results analyzed by GC-MS are shown in Table 1.

As a result of Table 1, steviol was identified as a metabolite of ent-kaurenoic acid. Similarly, ent-7β, 13-dihydroxykaurenoic acid having a hydroxyl group introduced at the C-13 position was also identified. As metabolites of GA ₁₂ -7-aldehyde and GA ₁₂ , only a small amount of metabolites with a hydroxyl group introduced at the C-13 position were detected, and those with a hydroxyl group introduced at the C-12α position were the main products. Identified. Therefore, the Arabidopsis cytochrome P450 enzyme CYP714A2 is an enzyme that introduces a hydroxyl group at the C-13 position in ent-kaurenoic acid and ent-7β-hydroxykaurenic acid, which have an ent-kaurane skeleton with a 6-membered B ring. On the other hand, it was clarified that the B ring is a GA ₁₂ -7-aldehyde having a 5-membered ent-gibberellan skeleton and an enzyme that introduces a hydroxyl group into the C-12α position in GA ₁₂ (FIG. 1).

[Example 2] Preparation of overexpressed steviol synthase gene PCR primer At5g24900F (BamHI) (CCGGATCC ATG GAGAGTTTGGTTGT (SEQ ID NO: 5): Start of translation using the cDNA clone of steviol synthase gene prepared in Example 1 as a template PCR using BamH I restriction enzyme site immediately before the codon (underlined) and At5g24900R (PstI) (CCCTGCAG TCA AACAACCCTAATGA (SEQ ID NO: 6): Pst I restriction enzyme site immediately after the stop codon (underlined)) To introduce a restriction enzyme site. The product obtained by PCR was linked to a plasmid vector and cloned, and the nucleotide sequence was confirmed. A cDNA fragment of the steviol synthase gene obtained by digesting this plasmid with BamH I and Pst I was used as a BamH I / between the cauliflower mosaic virus 35S promoter (strong constitutive expression promoter) and the NOS terminator in the pCGN binary vector. Binding to the Pst I site. This binary vector was introduced into Agrobacterium EHA105 by electroporation. Arabidopsis thaliana (Ecotype Col-0) was transformed by the Floral-dip method. The obtained T1 seed was aseptically sown on a 1 / 2MS (Murashige-Skoog) agar medium containing 50 mg / l of kanamycin, and a transformant exhibiting kanamycin resistance was selected. T3 individuals with homozygous transgenes in these progenies were used in the experiment. The obtained overexpressed steviol synthase gene showed a semi-dwarf phenotype as shown in FIG. In FIG. 3, the photograph A shows a wild-type Arabidopsis thaliana, and the photograph B shows an Arabidopsis thaliana overexpressing steviol synthase gene.

  Growth measurement test using two independent lines (named b2 and d1), wild type (Col-0) and gibberellin (GA) synthesis deficient mutants of the steviol synthetase gene overexpressing body prepared in this example Went. Note that a mutant called gal-3 was used as the GA synthesis deficient mutant. In this test, the rosette radius was measured on the 10th day after transplanting the shoots on the 6th day after sowing to the same agar medium. The photographs on day 10 after transplantation for each of b2, d1, Col-0 and gal-3 are shown in FIG. In this test, the rosette radius was calculated as an average value of 6 individuals. The measurement results are shown in Table 2 and FIG.

  As can be seen from Table 2 and FIG. 5, the steviol synthase gene overexpression product produced in this example was significantly more fertile than the wild type and significantly compared to the GA synthesis deficient mutant. growing. Thus, it became clear that the steviol synthetase gene overexpression body produced in the present Example showed a very characteristic semi-dwarfism.

  In addition, in this example, growth was performed using 4 independent lines (b2, d1, f1, and r1) of the steviol synthetase gene overexpressing body, wild type (Col-0), and gibberellin (GA) non-synthesis whole. A measurement test was conducted. In addition, as a whole GA synthesis failure, unlike the above-described gal-3, a transformed plant having an in vivo GA below the detection limit was used. In this test, after seeding in culture soil, it grew under normal light, and the rosette radius was measured on the 23rd day. In this test, the rosette radius was calculated as an average value of 10 individuals. The measurement results are shown in Table 3 and FIG. Further, FIG. 7 shows a photograph of the 23rd day after sowing for each of b2, Col-1 and GA synthesis incomplete.

  As can be seen from Table 3 and FIG. 6, the steviol synthase gene overexpression product produced in this example was significantly fertile compared to the wild type and significantly larger than the GA synthesis non-total. Become. Thus, it became clear that the steviol synthetase gene overexpression body produced in the present Example showed a very characteristic semi-dwarfism. Note that among the steviol synthetase gene overexpressing bodies produced in this example, f1 and r1 show a moderate semi-dwarfity compared to b2 and d1. This phenotype is considered to be because the expression level of the steviol synthase gene in f1 and r1 is lower than that in b2 and d1. Thus, it became clear that the degree of fertility can be controlled by adjusting the expression level of the steviol synthase gene in transformed plants.

Furthermore, in this example, phenotypic changes caused by administering gibberellin A ₄ (GA ₄ ) to a steviol synthase gene overexpressing body that was found to be semi-fertile were examined. In this test, after seeding in culture soil, grown under ordinary light, it was administered by spraying the GA ₄ of 50μM to 10 days and 17 days after sowing for + GA ₄ district. The results of this test are shown in FIG. In FIG. 8, the wild type (Col-0), the b2 line, and the b2 line (+ GA4 ward) are shown in the upper and lower two individuals from the left. As shown in FIG. 8, it was clarified that by administering GA4 to a transformed plant that overexpresses the steviol synthase gene, the semi-fertility was restored and it grew like the wild type.

[Example 3] Quantification of ent-kaurenoic acid and steviol in steviol synthetase gene overexpressing substance Two independent lines (named b2 and d1) of the steviol synthetase gene overexpressing substance prepared in Example 2 and wild type (named b2 and d1) Col-0) was grown under white light for 24 hours. The gibberellin was ^17,17-2 H ₂ label 40ng as an internal standard in addition to the aerial part 5g fresh weight of bolting immediately before, and extracted with 80% acetone. The extract was evaporated to dryness, and the solvent was partitioned with 50% acetonitrile and n-hexane to dryness. The following two elution fractions were prepared.

  Elution fraction 1: Silica gel chromatography was performed on hexane (including kaurenoic acid). The sample was suspended in hexane and charged in a silica gel column. After elution with hexane, the kaurenoic acid fraction was eluted with hexane: ethyl acetate (85:15).

  Elution fraction 2: 50% acetonitrile (including steviol) was suspended in 1% formic acid and charged to an Oasis HLB column (Waters). After elution with 1% formic acid and 40% acetonitrile, the steviol fraction was eluted with 1% formic acid and 80% acetonitrile.

  Each elution fraction 1 and 2 was dissolved in methanol and charged to a Bond Elut DEA column (manufactured by VARIAN). After elution with 100% methanol, the kaurenoic acid and steviol fractions were eluted with 0.1% acetic acid methanol.

  The obtained 0.1% acetic acid methanol section was fractionated by ODS-HPLC. The column used in ODS-HPLC was SHISEIDO MGII5 (4.6 mm I.D.x 250 mm). The column thermostat was kept at 40 ° C. The mobile phase was 50% MeOH (1% AcOH) from 0 min to 5 min, then gradient to 100% MeOH over 25 min and eluted with 100% MeOH up to 35 min. The flow rate was 1 ml / min. HPLC fractions were collected at 1 min / tube to obtain Fr 25 and 26 (including steviol) Fr29, 30 and 31 (including kaurenoic acid).

  Each fraction was collected, concentrated to dryness, derivatized with MSTFA, and analyzed using GC-MS. For GC-MS, a DB-1 column (0.25 mm × 15 m, 0.25 μm film thickness, manufactured by J & W Scientific) was used in Automass (JEOL) -6890N (manufactured by Agilent Technologies). At this time, He (1 ml / min) was used as the carrier gas. The injection temperature was 250 ° C. The column oven was held at 80 ° C. for 1 minute after injection, heated to 30 ° C./min up to 200 ° C., then heated to 280 ° C. at 5 ° C. per minute, and then held at 280 ° C. for 1 minute.

  The results of quantification of ent-kaurenoic acid and steviol in wild-type Arabidopsis thaliana and steviol synthase gene overexpression Arabidopsis thaliana are shown in Table 4 (in Table 4, the unit is “pg / g fresh weight”).

  As can be seen from Table 4, in steviol synthase gene overexpressing Arabidopsis thaliana, ent-kaurenoic acid, which is a substrate for steviol synthase, was reduced to 5% to 16% compared to the wild type. On the other hand, steviol, which is a metabolite of steviol synthase, increased 15 to 17 times compared to the wild type.

[Example 4] Quantification of active gibberellins (GA ₄ , GA ₁ ) in steviol synthase gene overexpressing bodies Overexpressing bodies (b2 and d1) and wild type (Col-0) plants used in Example 3 ^17,17-2 H ₂ labeled gibberellin was added and extracted with 80% acetone. After the extract was dried, the solvent was partitioned with 50% acetonitrile and n-hexane. The 50% acetonitrile section was dried, suspended in 500 mM phosphate buffer (pH 8.0), and charged to a polyvinylpyrrolidone column (manufactured by Tokyo Kasei). The column was eluted with 100 mM phosphate buffer (pH 8.0), adjusted to pH 3.0 with hydrochloric acid, and then charged on an Oasis HLB column (manufactured by Waters). After elution with 2% formic acid, the gibberellin fraction was eluted with 1% formic acid 80% acetonitrile. After drying, it was dissolved in methanol and charged to a Bond Elut DEA column (manufactured by VARIAN). After elution with 100% methanol, the gibberellin fraction was eluted with 0.5% acetic acid methanol. After drying, the mixture was suspended in chloroform-ethyl acetate (1: 1) containing 1% acetic acid and passed through a SepPak silica cartridge (manufactured by VARIAN). After passing through the liquid to dryness, it was dissolved in water and subjected to LC-MS / MS analysis. LC-MS / MS is quadrupole / time-of-flight tandem mass spectrometer (Q-Tof Premier, Waters) and Acquity Ultra Performance LC (Waters), Acquity UPLC BEH-C18 column (2.1 x 50 mm, 1.7 mm μm particle size, manufactured by Waters) was used. After eluting with 98% acetonitrile (including 0.05% acetic acid) for 5 minutes, elution was performed from 3% acetonitrile to 65% acetonitrile with a gradient of 20 minutes. The flow rate was 200 μL / min.

The results of quantification of gibberellin A ₄ (GA ₄ ) and gibberellin A ₁ (GA ₁ ) in wild-type Arabidopsis thaliana and steviol synthase gene overexpressing Arabidopsis are shown in Table 5 (in Table 5, the unit is “pg / g fresh weight”) Is).

As shown in Table 5, in steviol synthase gene overexpressing Arabidopsis thaliana, GA _{4 of} active gibberellin having no hydroxyl group at the C-13 position was decreased to below the detection limit. On the other hand, GA _{1 of the} active type gibberellin having a hydroxyl group at the C-13 position was increased 129 to 142 times compared to the wild type.

[Example 5] Functional test of rice GA 13-position hydroxylase gene The full-length cDNA of CYP714B1 gene, which is one of the CYP714A2 homologous gene candidates in rice, is the extension site (node section) of rice (variety Nipponbare). Isolated) using RT-PCR. Oligo (dT) 12-18 primer (Invitrogen) was used for the reverse transcription reaction, and SuperScript II RT (Invitrogen) was used for the reverse transcriptase. Using the synthesized cDNA as a template, PCR using PCR primer 714B1-F1 (CATCTTGCATACATCAACGTCAG (SEQ ID NO: 7)) and PCR primer 714B1-R2 (CTAATCAAATCCAGCCCAATCAC (SEQ ID NO: 8)) using PrimeSTAR HS DNA Polymerase with GC buffer (TaKaRa) The amplified DNA was cloned into pMD20-T vector using Mighty TA-cloning Kit for PrimeSTAR (TaKaRa), and PCR primer 714B1-CACC (CACC ATG GTGGTGGTGGTG (sequence) No. 9): PCR was performed using an additional sequence CACC for Gateway cloning immediately before the translation start codon (underlined) and PCR primer 714B1-R2.The product was obtained as a gateway entry vector pENTR / D-TOPO (Invitrogen). company) to the subjected to subcloning. the introduction into the yeast expression vector is the full-length cDNA introduced entry vector described above as a template, PCR primers 714B1-BamHI (CGGGATCC ATG GTGGTGGTGGTG SEQ ID NO: 10): the translation initiation codon (underlined) immediately preceding the placement of BamH I restriction enzyme sites) and 714B1-KpnI (GGGGTACC CTA ATCAAATCCAGCCCAATC (SEQ ID NO: 11): the Kpn I restriction enzyme site immediately after the stop codon (underlined) The restriction enzyme site was introduced by PCR using the following arrangement: The product was digested with BamH I and Kpn I restriction enzymes and then ligated to the pYeDP60 vector BamH I / Kpn I site. Is shown in SEQ ID NO: 12, and the amino acid sequence of the protein encoded by the rice-derived CYP714B1 gene is shown in SEQ ID NO: 13. The subsequent introduction into WAT11 yeast and functional tests using this are CYP714A2 enzyme function experiments. Compliant with.

As a result, as a metabolite of GA _12, the metabolite GA ₅₃ into which a hydroxyl group was introduced at the C-13 position was identified as a product. That is, it was revealed that this enzyme is a rice GA13 hydroxylase that has not been discovered so far. However, unlike the Arabidopsis CYP714A2, this enzyme did not detect hydroxylation at position 13 when ent-kaurenoic acid was used as a substrate.

[Example 6] Production of overexpressed rice GA 13-hydroxylase gene The Gateway entry vector into which the full-length cDNA clone of the rice GA 13-hydroxylase gene (CYP714B1) produced in Example 5 was introduced was used as a template. By homologous recombination reaction using a system kit, the cDNA of this gene was introduced into a gateway-compatible constitutive expression binary vector pGW8 (having a cauliflower mosaic virus 35S promoter) (provided by Dr. Tsuyoshi Nakagawa, Gene Experiment Facility, Shimane University). This binary vector was introduced into Agrobacterium pGV3101 (pMP90RK) by electroporation. Arabidopsis thaliana (Ecotype Col-0) was transformed by the Floral-dip method. The obtained T1 seed was aseptically sown on a 1 / 2MS (Murashige-Skoog) agar medium containing 50 mg / l of kanamycin, and a CYP714B1 overexpressing transformant (T1 generation) showing kanamycin resistance was selected. In the experiment, T2 individuals selected for kanamycin were used for two independent CYP714B1 overexpressing body lines (j15 and m17). When these were compared with two lines (a1 and d3) of control transformants showing growth equivalent to that of the wild type, semi-fertile expression similar to the overexpressed steviol synthase gene shown in Example 2 was obtained. The mold was shown (FIG. 9).
From the results of this example, it was revealed that a characteristic semi-fertility is exhibited by overexpressing a gene encoding a hydroxylase for the 13th carbon of the ent-gibberellan skeleton.

[Example 7] Quantification of active gibberellins (GA ₄ , GA ₁ ) in rice GA 13-hydroxylase gene overexpressing body 19-day-old CYP714B1 excess obtained by selection with kanamycin, transplanted and grown on 1 / 2MS medium The two parts of the expression body (j15 and m17) and the above-ground part of the 16-day-old control transformant line (a1 and d3), which were similarly selected and grown, were used for the quantitative test of active gibberellin. The quantification method was based on Example 4.

The results of quantification of gibberellin A ₄ (GA ₄ ) and gibberellin A ₁ (GA ₁ ) in control transformants and rice GA 13-position hydroxylase gene overexpressing Arabidopsis thaliana are shown in Table 6 (in Table 6, the unit is “pg / g fresh weight ").

As shown in Table 6, GA _{4 of} active gibberellin having no hydroxyl group at the C-13 position was reduced to 39 to 48% in the control plant body in Arabidopsis thaliana overexpressing the 13th position hydroxylase gene of rice GA. On the other hand, GA _{1 of the} active gibberellin having a hydroxyl group at the C-13 position was increased 104 to 206 times compared to the control plant.

It is the characteristic view which showed typically the hydroxylation reaction by the steviol synthetase which concerns on this invention. It is a characteristic view which shows typically the type | system | group which produces various glycosides, without making steviol synthesis | combination a rate-limiting step by utilizing the steviol synthetase gene which concerns on this invention. A is a photograph of wild-type Arabidopsis thaliana, and B is a photograph of steviol synthase gene overexpressing body. It is a photograph of a steviol synthetase gene overexpression body, a wild type, and a GA synthesis failure mutant in an experimental system using an agar medium. It is a characteristic figure which shows the result which compared the rosette radius in the steviol synthetase gene overexpression body, the wild type, and the GA synthesis failure mutant in the experiment system using an agar medium. It is a characteristic figure which shows the result of having compared the rosette radius in a steviol synthetase gene overexpression body, a wild type, and a GA synthesis failure mutant in the experiment system using culture soil. It is a photograph of a steviol synthase gene overexpressing body, a wild type, and a GA synthesis deficient mutant in an experimental system using cultured soil. In semi-dwarf recovery experiments by administration of GA _4, wild-type photograph of the steviol synthetase gene overexpressing (GA ₄ untreated group and the GA ₄ treatment group). It is a photograph of rice GA 13-position hydroxylase gene overexpressing body (j15 and m17) and control (control) transformants (a1 and d3).

Claims (7)

  Morphological control of plants that grows transgenic plants in which a gene encoding a protein having a function of hydroxylating 13th carbon of ent-kaurenoic acid or 13th carbon of ent-gibberellan skeleton is overexpressed Method. The plant shape regulation method according to claim 1, wherein the gene comprises any of the following polynucleotides (a) to (c).
(A) a polynucleotide encoding a protein comprising the amino acid sequence shown in SEQ ID NO: 2 (b) comprising an amino acid sequence in which one or more amino acids have been deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 2, A polynucleotide encoding a protein having a function of hydroxylating carbon at position 13 of kaurenoic acid (c) comprising an amino acid sequence having 70% or more homology to the amino acid sequence shown in SEQ ID NO: 2, and containing ent-kaurenoic acid A polynucleotide encoding a protein having a function of hydroxylating carbon at position 13 The plant shape regulation method according to claim 1, wherein the gene comprises any of the following polynucleotides (a) to (c).
(A) a polynucleotide encoding a protein comprising the amino acid sequence shown in SEQ ID NO: 13 (b) comprising an amino acid sequence in which one or more amino acids have been deleted, substituted, added or inserted in the amino acid sequence shown in SEQ ID NO: 13, A polynucleotide encoding a protein having a function of hydroxylating carbon at position 13 of the gibberellane skeleton (c) comprising an amino acid sequence having 70% or more homology with the amino acid sequence shown in SEQ ID NO: 13, A polynucleotide encoding a protein having a function of hydroxylating carbon at position 13   The method according to claim 1, wherein the transformed plant exhibits semi-fertility compared to the wild type. Form adjusting method of the plant according to claim 1, wherein the administering exogenous active gibberellin A ₄ against transformed plants grown. The transformed plant form adjusting method of the plant according to claim 1, wherein the semi-dwarf are recovered by active gibberellin A _4.   The plant gene regulation method according to claim 1, wherein the gene is derived from a plant selected from the group consisting of poplar, strawberry tea and stevia.

Images