JP2013141421A - Plant having increased content of aromatic amino acid and method for producing the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a transformed plant which produces an aromatic amino acid in a larger amount than the same kind of wild type plant cultivated in identical conditions, and to provide a transformed plant which produces a secondary metabolite originated from the aromatic amino acid in a larger amount than the same kind of wild type plant cultivated in identical conditions.SOLUTION: In a plant having a shikimic acid synthesis route, the activity of 3-deoxy-D-arabino-heptulonate-7-phosphate synthetase (DAHPS) is increased, or the feed back inhibition of DAHPS is reversed. More specifically, the present invention includes transfer of a feed back inhibition reversal aroG modified in a gene aroG encoding DAHPS to a plant.

Description

The present invention relates to genetic manipulation of aromatic amino acid synthesis systems in plants. In particular, the present invention relates to a transformed plant having an enhanced aromatic amino acid content and a method for producing the same.
The present invention also relates to a transformed plant having an increased content of secondary metabolites derived from aromatic amino acids and a method for producing the same.

The aromatic amino acids phenylalanine, tyrosine and tryptophan are substrates for protein synthesis, while in plants they are growth regulator hormones and secondary metabolite production substrates.
In animals, these amino acids are essential amino acids and must be taken from food. In particular, tryptophan is one nutrient that represents the quality of plant-derived feed together with lysine, methionine, and threonine. Therefore, it is desirable that these amino acids are contained in a high amount in food and feed crops.
Various functional secondary metabolites are synthesized using aromatic amino acids as substrates. For example, in secondary metabolites such as phenylpurpanoids, flavonoids and alkanoids synthesized from phenylalanine, many components exhibit antibacterial and antistress effects in plants, and these are also used as health foods and medicines. . Vitamin E, a type of antioxidant, is synthesized from the tyrosine pathway. In addition, indoleacetic acid, which is a kind of plant growth regulator auxin, is synthesized from the tryptophan synthesis pathway. As described above, modification of the amount of accumulated amino acids contained in plants is expected to lead to mass synthesis of useful secondary metabolites and detection of unknown functional components. Therefore, the production of plants with high content of aromatic amino acids is expected for the search for functional components.
Aromatic amino acids start from the shikimic acid synthesis pathway. Shikimic acid synthesis pathway combines phosphoenolpyruvate (PEP) and erythrose-4-phosphate (E-4P) into 3-deoxy-D-arabino-heptuloson-7-phosphate (DAHP) Starting from the reaction, 6 enzymes are involved, and through 7 reactions, the final chorismate is synthesized. From this synthetic pathway, shikimic acid, a raw material of Tamiflu, known as an anti-influenza drug, is synthesized. The aromatic amino acids phenylalanine, tyrosine, and tryptophan are synthesized using chorismic acid as a substrate. Control of the shikimate synthesis pathway is thought to control all aromatic amino acids and secondary metabolites involved in this pathway.
Industrially, it is known that aromatic amino acids are synthesized in large quantities by controlling the shikimate synthesis pathway and amino acid synthesis pathway using microorganisms, and introduction of feedback inhibition release genes is an effective means. (European patent EP745671; US patent US7638312).
In plants, there have been several reports of increasing aromatic amino acids by introducing a feedback inhibition release gene of a gene involved in the latter half of the aromatic amino acid synthesis pathway. For example, E. coli feedback inhibition release gene pheA is introduced into Arabidopsis to increase the content of phenylalanine (Plant J. 2009; 60 (1): 156-67). In addition, Tozawa et al. Increased Tryptophan by introducing Rice-derived feedback inhibition release gene OASA1D into Rice (Plant Phys. 2001; 126: 1493-1506). In addition, a yeast-derived PDH gene was introduced into tobacco to synthesize vitamin E in large quantities (Plant Phys., 2004; 134: 92-100). In such an example, since a gene related to the final stage of each amino acid synthesis pathway is expressed, only one amino acid can be effectively increased for each gene.
On the other hand, attempts to increase aromatic amino acids using a gene for feedback inhibition of the shikimate synthesis pathway have not yet been reported in plants. The first step of the shikimic acid synthesis pathway is the combination of phosphoenolpyruvate (PEP) produced by glycolysis and D-erythrose-4-phosphate (E-4P) to form 3-deoxy-D- This is the process in which arabino-heptuloson-7-phosphate is produced. The enzyme involved in this process is DAHPS. In microorganisms, DAHPS has three isozymes, called aroG, aroF, and aroH, which are known to have DAHPS activity of 80%, 20%, and 1%, respectively. AroG is known to be feedback-inhibited by phenylalanine, aroF by tyrosine, and aroH by tryptophan (J. BACTERIOL., 1988; 170 (2): 5500-5506). An exemplary Escherichia coli DAHPS in which feedback inhibition by phenylalanine is released is a mutation in which the 150th proline (Pro) from the N-terminal of the amino acid sequence of DAHPS encoded by aroG is replaced with another amino acid, preferably leucine (Leu). Have. In addition, exemplary E. coli DAHPS in which feedback by tyrosine was released has a mutation in which 148th Pro in the amino acid sequence of DAHPS encoded by aroF is replaced with Leu (J. BACTERIOL., Nov. 1990, p. 6581). -6584). Examples of mutants of E. coli DAHPS encoded by aroH, desensitized to tryptophan feedback, are described in J. BACTERIOL., Dec. 1988, p. 5500-5506.
In Arabidopsis thaliana, two DAHPS genes exist and are said to have physiological activities, respectively (Proc. Natl. Acad. Sci. USA, 1991; 88: 8821-8825, Mol. Plant, 2010; 3 (6): 956-972), whether it is subject to feedback inhibition from amino acids has not been clarified.

European Patent No. 745671 U.S. Patent No. 7638312

Plant J. 2009; 60 (1): 156-67. Plant Phys., 2001; 126: 1493-1506 Plant Phys., 2004; 134: 92-100 J. BACTERIOL., 1988; 170 (2): 5500-5506 J. BACTERIOL., Nov. 1990, p. 6581-6584 J. BACTERIOL., Dec. 1988, p. 5500-5506 Proc. Natl. Acad. Sci. USA, 1991; 88: 8821-8825 Mol. Plant, 2010; 3 (6): 956-972

  The present invention provides a transformed plant having an increased content of aromatic amino acids as compared to the same type of wild-type plant cultivated under the same conditions. The present invention also provides a transformed plant having an increased content of secondary metabolites derived from aromatic amino acids as compared to the same type of wild-type plant cultivated under the same conditions. Furthermore, the present invention provides a transformed plant that produces a novel secondary metabolite derived from an aromatic amino acid as compared to the same type of wild-type plant cultivated under the same conditions.

The present invention relates to transformation in which the activity of 3-deoxy-D-arabino-heptulon-7-phosphate synthase (DAHPS) involved in the shikimate synthesis pathway is increased and / or feedback inhibition of DAHPS is released. A plant and a method for producing the plant are provided.
In particular, the present invention introduces a feedback inhibition release aroG in which a gene aroG encoding DAHPS has been modified into a plant, thereby transforming the aromatic amino acid content to be increased as compared to a wild-type plant of the same species cultivated under the same conditions. A plant and a method for producing the plant are provided.
In addition, the present invention introduces a feedback inhibition release aroG obtained by modifying aroG of Escherichia coli into a plant, so that the content of secondary metabolites derived from aromatic amino acids compared to the same type of wild-type plant cultivated under the same conditions Provides transformed plants and methods for their production.

FIG. 1 shows an outline of ligation of gene sequences by Ligation PCR. FIG. 2 shows the structure of a gene construct containing aroG encoding DAHPS with released feedback inhibition (feedback inhibition released aroG). NPT II: neomycin phosphotransferase II gene; CaMV 35S promoter: cauliflower mosaic virus 35S promoter; rbcS: ribulose-1,5-bisphosphate carboxylase / oxygenase (RubisCo) small subunit transit peptide coding sequence; aroG: mutant aroG ( Bacterial feedback insensitive DAHPS gene); HA: hemagglutinin epitope tag; NOS-ter: nopaline octopine synthase terminator; ATG: translation start codon; TAG: stop codon; LB: left border sequence of T-DNA region; RB: Right border sequence of T-DNA region. FIG. 3 shows the results of genome analysis of wild-type plants and transformed plants into which feedback inhibition-removed aroG was introduced. M is a DNA marker of 100 bp, and 3, 4, 5, 6, 7, 8, 9, 12, 14, 16, and 20 on the lane are transformant line numbers. W indicates a wild type. FIG. 4 shows the amino acid analysis results of a wild type plant and a transformant into which feedback inhibition release aroG was introduced. The vertical axis represents the amino acid content per fresh mass (mmol / g FW). The numbers on the horizontal axis are the numbers of transformed lines. FIG. 5 shows the results of Western blot analysis of wild type plants and transformed lines into which feedback inhibition-removed aroG was introduced. The numbers above each lane indicate the number of the transformed line. FIG. 6 shows the analysis results of the total amount of polyphenols of the wild type plant and the transformed line into which feedback inhibition release aroG was introduced. The vertical axis represents the polyphenol content (mg) corresponding to gallic acid per 100 g of fresh plant mass. The numbers on the horizontal axis indicate the numbers of transformed lines. W represents a wild type. FIG. 7 shows the measurement results of the antioxidant activity of the extract of a wild type plant and a transformed line into which feedback inhibition release aroG was introduced. The vertical axis represents the amount (mg) corresponding to ascorbic acid having an equivalent free radical scavenging capacity in 100 g of fresh plant mass. The numbers on the horizontal axis indicate the numbers of transformed lines. W represents a wild type. Amino acid sequence of mutant E. coli DAHPS desensitized to feedback inhibition by phenylalanine and nucleotide sequence encoding it. Fig. 8-1 continued.

The present invention relates to genetic manipulation of aromatic amino acid synthesis systems in plants. Specifically, the present invention relates to a transgenic plant having an enhanced aromatic amino acid content and a method for producing the same.
In the present invention, the activities of enzymes involved in aromatic amino acid synthesis, particularly the enzymes involved in the shikimate synthesis pathway and / or the genes encoding these enzymes are modified.
Such modification of expression is, for example,
a) a transgene in which the coding sequence of the enzyme is operably linked to a strong constitutive promoter,
b) increased copy number of a gene encoding an enzyme involved in aromatic amino acid synthesis;
c) a regulatory gene that activates the expression of a gene encoding an enzyme involved in aromatic amino acid synthesis;
d) cancellation of feedback inhibition of enzymes involved in aromatic amino acid synthesis;
Etc.
In one embodiment of the invention, the activity of an enzyme that performs aromatic amino acid synthesis is increased. In another embodiment of the present invention, the expression of a gene encoding an enzyme that performs aromatic amino acid synthesis is enhanced. In a particularly preferred embodiment of the invention, aromatic amino acid synthesis in plants is enhanced by eliminating feedback inhibition of genes involved in aromatic amino acid synthesis. “Release” of feedback inhibition in the transformed plant of the present invention does not only mean that feedback inhibition does not occur at all, but feedback inhibition is 30% compared to wild-type plants cultivated under the same conditions. It means a reduction of more than 50%, preferably 50% or more, more preferably 70% or more, further preferably 90% or more, and most preferably 99% or more. In addition, the degree of “cancellation” of feedback inhibition can be confirmed, for example, by the technique disclosed by Kikuchi et al. (Appl. Environ. Microbiol., 1997, 63, 761-762). More specifically, in the presence of Phe (phenylalanine), DAHPS activity was measured according to the method of Schoner and Herrman (J. Biol. Chem., 1976, 251, 5440-5447), and the coexisting Phe concentration and DAHPS activity decreased The degree of cancellation of feedback inhibition can be evaluated by measuring the relationship. For example, measuring the degree of feedback inhibition by comparing the specific activity (U / mg) of DAHPS in the presence of a specific concentration of Phe in the range of 2 to 10 mM with a sample derived from the wild type and the transformed plant of the present invention. Can do. 1 U can be defined, for example, as a unit of enzyme activity that produces 1 μmol of DAHP per minute at 37 ° C. from phosphoenolpyruvate and erythrose-4-phosphate. Specifically, when wild-type DAHPS activity is inhibited by 90% by 2 mMPhe as shown in the above-mentioned Kikuchi et al., The DAHPS activity of the transformed plant of the present invention is less than 90% by 2 mM Phe. If not inhibited, it can be determined that the feedback inhibition of DAHPS of the transformed plant of the present invention is “removed” compared to the wild-type plant, and the transformed plant of the present invention has a DHPS activity of 2 mM Phe. When only 45% is inhibited by the above, it can be judged that the DAHPS feedback inhibition of the transformed plant of the present invention is 50% lower than that of the wild type plant. Even if Phe does not inhibit (in a measurable range) the DAHPS activity of the transformed plant of the present invention at all, or even if the activity is increased by Phe, the aromatic amino acid in the transformed plant of the present invention The feedback inhibition of the genes involved in the synthesis is “30% lower than the wild type plant cultivated under the same condition compared to the wild type plant cultivated under the same condition, preferably 50% or more, more preferably Needless to say, the decrease is 70% or more, more preferably 90% or more, and most preferably 99% or more.

The method of the invention comprises, for example, the following procedure:
a) cloning a gene involved in the shikimic acid synthesis pathway;
b) modifying the obtained gene so that feedback inhibition is released;
c) if necessary, inserting the modified gene into an appropriate vector in an appropriate direction, if necessary, and recloning;
d) A step of introducing a modified gene obtained in b) or a vector obtained in c) into a plant or plant cell to obtain a transformant.

The present invention also provides:
a) cloning a gene involved in the shikimic acid synthesis pathway;
b) modifying the obtained gene so that feedback inhibition is released;
c) obtaining a transformant by incorporating a gene whose feedback inhibition has been released into the plant genome using the modified gene or a fragment thereof,
May be included.
In either case, when the transformant is a plant cell, the obtained transformed cell can be regenerated into the plant body.

  In the present invention, enzymes involved in the shikimate synthesis pathway whose activity is enhanced include 3-deoxy-D-arabino-heptuloson-7-phosphate synthase (DAHPS). In the present invention, the gene involved in the shikimate synthesis pathway in which feedback inhibition is released includes 3-deoxy-D-arabino-heptuloson-7-phosphate involved in the first step of the shikimate synthesis pathway. It contains at least one gene constituting the subunit of synthase (DAHPS). As described above, there are three isozymes in DAHPS of E. coli, which are encoded by genes called aroG, aroF, and aroH, respectively. Among them, DAHPS isozyme encoded by aroG is responsible for 80% of the total activity of DAHPS, and DAHPS encoded by aroG is feedback-inhibited by phenylalanine, which is a substrate for the synthesis of many secondary metabolites. Therefore, DAHPS encoded by aroG is particularly preferable as an enzyme involved in the shikimate synthesis pathway whose activity is increased in the present invention. In the present invention, DAHPS whose expression is enhanced or feedback inhibition is released is selected. AroG is particularly preferred as the gene to be encoded. An exemplary Escherichia coli DAHPS that is desensitized to feedback inhibition by phenylalanine that can be used in the present invention has a proline (Pro) at the 150th amino acid sequence of DAHPS (SEQ ID NO: 2) encoded by aroG as another amino acid, preferably leucine ( Leu) has a mutation substituted (SEQ ID NO: 4).

  In the present invention, the origin of a gene encoding an enzyme involved in the shikimate synthesis pathway in which feedback inhibition is released, particularly the aroG gene, is not particularly limited, and is a corresponding gene derived from bacteria, yeast, algae, and plants. It's okay. In general, the shikimic acid synthesis pathway is not found in animals, but if it exists, the gene involved in that pathway is also used as a gene that enhances expression in the present invention or a gene that should cancel feedback inhibition. It is natural that we can do it. Sequences obtained from such sources can be operably linked to appropriate promoters that function in plant cells, to increase their translation efficiency in the host plant, or to catalyze the encoded enzyme. May be modified by in vitro mutagenesis or de novo synthesis to alter. These modifications include, but are not limited to, modification of residues involved in substrate and / or catalysis. Furthermore, a gene encoding an enzyme involved in the shikimic acid synthesis pathway can be modified to have an optimal codon according to the codon usage of the host to be expressed or the organelle. In addition, a nucleic acid sequence encoding an appropriate transit peptide such as a transit peptide that promotes transfer to chloroplasts may be linked to these gene sequences.

  In addition, 3-deoxy-D-arabino-heptuloson-7-phosphate 3-deoxy-D-arabino-heptuloson from phosphoenolpyruvate (PEP) and D-erythrose-4-phosphate (E-4P) As long as it encodes a polypeptide that has an activity to synthesize 7-phosphate (3-deoxy-D-arabino-heptulon-7-phosphate synthase activity, ie, DAHPS activity) and is desensitized to feedback inhibition, Nucleic acids that hybridize to the various nucleic acid sequences described above under stringent conditions can also be used in the present invention. Therefore, a nucleic acid fragment encoding a protein in which one or more amino acids of the protein consisting of the amino acid sequence of SEQ ID NO: 2 has been deleted, added, or substituted has DAHPS activity, and the 150th Pro in the amino acid sequence is Leu. Any polypeptide can be used in the present invention as long as it encodes a polypeptide containing a mutation substituted for. Here, “stringent conditions” refers to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. “Stringent conditions” refers to conditions under which so-called specific hybrids are formed and non-specific hybrids are not formed. Such conditions are well known to those skilled in the art as described in Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, Third Edition (2001) Cold Spring Harbor Laboratory Press. Under stringent conditions, DNAs with high homology, for example, DNAs having a homology of 80, 90, 95, 97 or 99% or higher hybridize, and DNAs with lower homology do not hybridize with each other. Equivalent to the washing conditions for normal Southern hybridization, 60 ° C., 1 × SSC, 0.1% SDS, preferably 0.1 × SSC, 0.1% SDS, more preferably 68 ° C., 0.1 × SSC, 0.1% SDS The conditions include washing at a salt concentration and temperature to wash once, more preferably 2 to 3 times. The homology of the amino acid sequence and the nucleic acid sequence is an analysis program well known to those skilled in the art, such as BLAST, FASTA, etc. provided by EBI (European Bioinformatics Institute, http://www.ebi.ac.uk/) Can be calculated using standard parameters.

  In a particularly preferred embodiment of the invention, the DAHPS gene from E. coli, in particular aroG, has been modified so that feedback inhibition is released and the modified E. coli DAHPS gene is linked to a suitable promoter. Introduced into plants as a genetic construct. Methods for producing such gene constructs are well known to those skilled in the art. Site-directed mutagenesis methods for modifying specific genes are also well known to those skilled in the art. The nucleotide sequence of the arogG gene of E. coli is shown in SEQ ID NO: 1, and the amino acid sequence of DAHPS encoded by aroG is shown in SEQ ID NO: 2. An example of Escherichia coli DAHPS in which feedback inhibition by phenylalanine is canceled is a mutant DAHPS in which the 150th proline (Pro) in the amino acid sequence of DAHPS is replaced with another amino acid, preferably leucine (Leu). A mutation aroG encoding DAHPS having such an amino acid sequence can be easily prepared by site-directed mutagenesis based on the information of SEQ ID NOs: 1 and 2. An example of a nucleotide sequence encoding Escherichia coli DAHPS in which feedback inhibition by phenylalanine is released is shown in SEQ ID NO: 3, an example of an amino acid sequence of DAHPS in which feedback inhibition is released is shown in SEQ ID NO: 4, and these are collectively shown in FIG. 1 and FIG. 8-2. In addition to the amino acid sequence of SEQ ID NO: 4, a sequence in which alanine (Ala) at position 202 is replaced with threonine (Thr) in the amino acid sequence described in SEQ ID NO: 2, and aspartic acid (Asp) at position 146 is replaced with asparagine (Asn) Or a mutant DAHPS comprising a sequence in which methionine (Met) at position 147 is replaced with isoleucine (Ile) is also an example of DAHPS in which feedback inhibition is released.

  As used herein, a polypeptide having at least 80, 90, 95, 97, or 99% sequence identity to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2, comprising 3-deoxy-D-arabino -A polypeptide having a heptulon-7-phosphate synthase activity and having Pro substituted at the 150th position of the amino acid sequence of SEQ ID NO: 2 with another amino acid, preferably Leu, is "released from feedback inhibition. 3-deoxy-D-arabino-heptulon-7-phosphate synthase (DAHPS) ", and the gene encoding such an enzyme is" feedback inhibition released aroG "encoding DAHPS with released feedback inhibition or It is “mutant aroG”. A nucleic acid fragment encoding a polypeptide having at least 80, 90, 95, 97 or 99% sequence identity to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 is, for example, that of SEQ ID NO: 1 or SEQ ID NO: 3. Designing one or two or more nucleic acid probes based on sequence information, and using these probes to screen cDNA libraries of various species having a shikimate synthesis pathway under the hybridizing conditions described above. Can also be easily obtained. It can be confirmed that the obtained clone has DAHPS activity using an appropriate host-expression system. Pro in the 150th position of the amino acid sequence of SEQ ID NO: 2 in a polypeptide having at least 80, 90, 95, 97 or 99% sequence identity to the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 The position of the corresponding proline can be identified by alignment of the polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 with other polypeptides. Sequence alignment can be performed using tools well known to those skilled in the art such as CLUSTALW provided by EBI and the like.

Eliminate feedback inhibition of enzymes involved in the shikimate synthesis pathway without introducing heterologous DNA by introducing a mutation similar to the above into the endogenous gene of the plant corresponding to E. coli DAHPS. You can also. For example, the Arabidopsis DAHPS gene sequence can be obtained from Keith et al., 1991, Proc. Natl. Acad. Sci. USA, 88: 8821-8825; Accession No. M74819, and based on this sequence information, Arabidopsis or other For the endogenous gene corresponding to Escherichia coli DAHPS in these plant species, mutations similar to those described above can be introduced by homologous recombination or the like.
In addition to aroG or mutant aroG, gene constructs used in the present invention generally include appropriate promoters that function in plant cells, appropriate terminators such as nopaline synthase gene terminators, and other elements useful for expression control ( And drug resistance genes including, for example, kanamycin resistance gene, G418 resistance gene, hygromycin resistance gene and the like, and appropriate marker genes for selecting transformants. The promoter contained in this construct may be a constitutive promoter, organ-specific or growth-specific, depending on the host used, gene, required expression level, organ to be expressed, growth stage, etc. Can be selected. In the present invention, when expressing a gene containing or not containing a mutation involved in the shikimate synthesis pathway, particularly a DAHPS gene containing or not containing a mutation, a plurality of the aforementioned promoters and other elements useful for expression control should be used. May be desirable.

Plants with increased aromatic amino acid content are transformed into plant cells with a genetic construct comprising a plant promoter linked to a nucleic acid molecule encoding DAHPS, an enzyme involved in the shikimate synthesis pathway modified as described above. Can be produced. Related promoters used in preferred embodiments of the invention are strong and non-organ-specific or non-growth stage-specific promoters (eg, promoters that are strongly expressed in many or all tissues). Such strong constitutive promoters include the CaMV35S promoter.
In yet another embodiment of the invention, it may be advantageous to transform a plant with a genetic construct in which an inducible promoter is linked to a sequence encoding the desired enzyme. Such promoters include but are not limited to defense response genes such as heat shock genes, phenylalanine ammonia lyase genes, and injury response genes.

  The gene construct described above may include a selectable marker for selecting the construct. For example, constructs transmitted in bacteria preferably include genes that confer resistance to antibiotic resistance genes such as kanamycin, tetracycline, streptomycin, or chloramphenicol. Suitable vectors for transferring the construct include plasmids, cosmids, bacteriophages or viruses. In addition, the recombinant constructs may include plant-expressing selectable marker genes or screenable marker genes for the isolation, identification or tracking of plant cells transformed with these constructs. Selection markers include, but are not limited to, genes that confer resistance to antibiotics such as kanamycin, G418, and hygromycin, and resistance to herbicides such as sulfonylurea, phosphinothricin, and glyphosate. . Marker genes that can be screened include, but are not limited to, β-glucuronidase gene and luciferase gene.

  The gene introduction method that can be used in the present invention is not particularly limited, and any method known to those skilled in the art as a gene introduction method into a plant cell or a plant body may be used. For example, in one embodiment of the present invention, Agrobacterium is used to introduce a genetic construct into a plant. Such transformation can be performed using a two-component Agrobacterium T-DNA vector (Bevan, 1984, Nuc. Acid Res. 12: 8711-8721) and a co-culture procedure (Horsch et al., 1985, Science, 227: 1229-1231). It is desirable to use The Agrobacterium transformation system can also be used to transform monocotyledonous plants and plant cells. Plant transformation methods utilizing the Agrobacterium system to transform plants are well known to those skilled in the art.

In other embodiments, various alternative methods for introducing recombinant nucleic acid constructs into plants and plant cells can be used. Alternative gene transfer and transformation methods include naked DNA, protoplast transformation using calcium, polyethylene glycol (PEG) or electroporation, in planta transformation using reduced pressure infiltration (CR Acad Sci. Paris, Life Science, 1993; 316, 1194-1199).
Plants targeted in the present invention are not particularly limited, and for example, tomato, potato, beet, soybean, Arabidopsis, corn, wheat, rice, sugarcane, pepper, lettuce, sweet potato, broccoli, berries (strawberry, raspberry, poison berry) , Gooseberry, blueberry, marionberry, etc.), but is not limited thereto.

A transformed plant body, plant cell, callus, tissue or the like can be identified and isolated by selecting or screening for a trait encoded by a marker gene present in the gene construct used for transformation. Furthermore, transformed plant cells and plants can also be identified by screening for the activity of visible marker genes (eg, β-glucuronidase gene, luciferase gene) that may be present in the recombinant nucleic acid construct of the present invention. Such selection methods and screening methods are known to those skilled in the art.
In addition, various methods known to those skilled in the art can be used to identify plants or plant cell transformants containing the gene construct of the present invention. Such methods include: 1) Southern analysis or PCR amplification to detect and identify introduced recombinant DNA fragments; 2) Northern blot, S1 RNase protection to detect and identify RNA transcripts of gene constructs Including, but not limited to, primer extension PCR amplification or reverse transcriptase PCR (RT-PCR) amplification; and 3) protein gel electrophoresis, western blot, immunoprecipitation, or enzyme immunoassay. These assay methods are also well known to those skilled in the art. Methods for distinguishing DNA fragments having specific mutations from DNA fragments not having such mutations are well known to those skilled in the art.
Transformed plants can be screened for the desired biological change. For example, the DAHPS level or DAHPS gene expression level can be measured in a desired tissue and / or growth stage for a transformed plant. Furthermore, it is possible to screen for the content of aromatic amino acids and secondary metabolites derived from aromatic amino acids, particularly polyphenols. Furthermore, antioxidant activity can also be measured about the extract of a transformed plant.

  The aromatic amino acid content of the transformed plant of the present invention is increased by 1.2 times or more compared to the wild type plant cultivated under the same conditions. In the present specification, “aromatic amino acid” includes phenylalanine, tyrosine and tryptophan. In particular, in the transformed plant of the present invention, the content of tryptophan per unit mass of the plant body or a part thereof is preferably increased by 2 times or more compared to a wild type plant cultivated under the same conditions, or The content is preferably increased 10 times or more, particularly preferably 15 times or more, or the phenylalanine content is preferably increased 10 times or more, particularly preferably 50 times or more. In particular, in the transformed plant of the present invention, the tryptophan content per unit mass of the plant body or a part of the plant body or a part thereof is preferably increased by 2 times or more compared to the wild type plant cultivated under the same conditions. Is preferably 10 times or more, more preferably 15 times or more, particularly preferably 30 times or more, and the phenylalanine content is preferably 10 times or more, more preferably 50 times or more, particularly preferably 160 times. More than that. The aromatic amino acid content of a plant can be easily measured by, for example, a commercially available high-speed amino acid analyzer.

  Since the transformed plant of the present invention has an increased aromatic amino acid content as compared to a wild type plant cultivated under the same conditions, the content of secondary metabolites derived from aromatic amino acids in the transformed plant of the present invention is also increased. It is increasing. Such secondary metabolites include polyphenols, alkaloids, phenylpropanoids, vitamin E and the like. Preferably, the content of the secondary metabolite of the transformed plant of the present invention is increased to 1.2 times or more of the wild type plant cultivated under the same conditions. In particular, the content of polyphenols in the transformed plant of the present invention increases 1.2 times or more, more preferably 1.8 times or more of a wild type plant cultivated under the same conditions per unit mass of the plant body or a part of the plant body. Polyphenol or polyphenols is a general term for chemical substances having a plurality of phenolic hydroxy groups in the molecule, and includes flavonoids, phenolic acid, ellagic acid, lignan, curcumin, coumarin and the like. Flavonoids include, but are not limited to, anthocyanins, isoflavones, flavonols, catechins, tannins, rutin. Methods for recovering polyphenols from plants or plant cells are well known to those skilled in the art (Molecules 2008, 13, 581-594; Journal of Engineering Science and Technology 2007, 2 (1), 70-80; J Agric. Food Chem. 2006, 54, 112-119; J. Agric. Food Chem. 2003, 51, 1237-1241). For example, the recovery and the total amount thereof can be measured as follows.

For example, a whole plant or a part of a plant such as a fruit, or a sample derived from another plant is washed with distilled water and crushed by a suitable method such as a homogenizer or ultrasonic waves. The sample may be dried. In some cases, it may be frozen (or lyophilized) before crushing. Freezing may increase the yield of polyphenols. After crushing, the sample may be dried. Extract the polyphenols by treating the crushed (or further dried) sample with 3 to 10 times the volume of 70% methanol aqueous solution or 70% acetone aqueous solution (pH about 2) for about 5 minutes to 1 hour. can do. Alternatively, an appropriate amount of ethanol can be added to a crushed (or further dried) sample, and polyphenols can be extracted at high pressure by applying a pressure of about 10 MPa while continuously stirring at about 60 rpm under a nitrogen atmosphere. . The mixture of the sample and the extraction buffer is centrifuged or filtered to remove the residue, and the extract is recovered. In some cases, the solvent of the extract may be evaporated by further vacuuming. The dried product obtained by evaporating the solvent can be used as it is or dissolved in a suitable solvent, for example, about 70% (v / v) methanol and used for a sample for measurement or other applications. It can also be stored at a low temperature of -80 ° C. The total amount of phenols can be measured by the Folin-Ciocalteau method (Am. J. Enol. Vitic. 1965, 16, 144-158). For example, add 1 mL to 5 mL of pure water to 50 μL to 1 mL of sample extract, add 75 μL to 1 mL of Folin-Ciocalteau reagent (2N) (SIGMA), mix well, and incubate at room temperature for 5 minutes to 1 hour. To do. Next, the total amount of phenols in the sample can be determined by adding 300 μL to 10 mL of 7-15% sodium carbonate, incubating for 2 hours, and measuring the absorbance at 750 nm to 765 nm. A standard curve can be prepared using gallic acid or tannic acid, and the total amount of phenols can be quantified based on this standard curve.
Individual phenol compounds can be measured by high performance chromatography (HPLC) or the like. When analyzing by HPLC, the sample can be loaded on the HPLC and, for example, each phenol compound can be eluted using a concentration gradient of 1% formic acid and acetonitrile. For example, acetonitrile concentration (% v / v) in formic acid is 0-15% (0-50 minutes), 15-25% (50-60 minutes), 25-100% (60-70 minutes), 100% (70 -72 minutes) and 100 to 0% (72-80 minutes), and the phenol compound can be eluted sequentially.

Polyphenols are known to have antioxidant activity. Since the polyphenol content of the transformed plant of the present invention is increased, the antioxidant activity of the transformed plant of the present invention is increased compared to the wild type plant cultivated under the same conditions. Preferably, the transformed plant of the present invention has an antioxidant activity that is 1.2 times or more, particularly preferably 2 times or more that of a wild-type plant cultivated under the same conditions. The antioxidant activity is measured using, for example, a plant extract extracted from the plant body or a part thereof, and converted to the antioxidant activity per unit mass of the plant body or a part thereof. Preferably, the plant extract is extracted from the plant using a 70% aqueous methanol solution or a 70% aqueous acetone solution (about pH 2). Antioxidant activity can be measured, for example, as follows.
Antioxidant activity of samples containing phenols extracted as described above was measured by free radical scavenging ability measurement method (DPPH (2,2-diphenyl-1-picrylhydrazyl) method) (J. Sci. Food Agric. 1998, 76, 270-276), ferric reduction antioxidant power measurement method (FRAP method) (Anal. Biochem. 1996, 239. 70-76) and ABTS radical cation capture capacity measurement method (ABTS method) (Free Radical Biol. Med. 1999, 26, 1231-1237) and the like. The DPPH method is based on the reactivity of a stable free radical of 2,2-diphenyl-1-picrylhydrazyl (DPPH) with a hydrogen donor such as phenols. Decolorization of the DPPH solution is an indicator of the antioxidant activity of the sample. In the DPPH method, the scavenging ability for the DPPH (2,2-diphenyl-1-picrylhydrazyl) radical is measured. Add an appropriate amount of sample, for example, 700 μL of methanol to 50 μL of sample, add 750 uL of 0.02 mg / mL DPPH (ALFA AESAR) and mix well. If necessary, a dilution series of samples may be created. Incubate for 10-30 minutes at room temperature after mixing and measure absorbance at 517 nm or 530 nm. A standard curve can be prepared using ascorbic acid, and the antioxidant activity can be measured as the amount (mg) of ascorbic acid equivalent to 100 g of fresh plant mass with respect to the ability to scavenge free radicals.

The FRAP method is based on the ability of phenols to reduce Fe ³⁺ to Fe ²⁺ . In the FRAP method, for example, 30 μL of a sample and 250 μL of FRAP reagent are mixed, and after 1 hour, the change in absorbance at 595 nm is measured, and the mole number of Fe ²⁺ reduced per unit time per 1 g of fresh plant mass (μmol) ) Antioxidant activity can be measured. A standard curve can be made using FeSO ₄ .
The ABTS method is based on the trapping ability of ABTS ⁺ , a radical cation generated by oxidation of 2,2'-azinobis (3-ethyl-2,3-dihydrobenzothiazole-6-sulfonic acid (ABTS). Mix the aqueous solution with potassium persulfate solution to make a 7 mM ABTS solution in a final concentration of 2.5 mM potassium persulfate solution, mix 10 μL of the sample methanol dilution with 990 μL of the ABTS solution described above, and after 6 minutes 734 nm The standard curve can be prepared by using ascorbic acid, etc. Antioxidant activity can be measured as the number of moles (μmol) of ascorbic acid equivalent to 100 g of fresh plant mass.

  The transformed plant of the present invention can be cultivated under the same conditions as wild type plants of the same species. Extracting and recovering aromatic amino acids and polyphenols from the plant body or a part thereof, or plant cells using 70% methanol or 70% acetone (pH 2.0) as described above from the cultivated transformed plant You can also.

Incorporation of E. coli aroG gene into plant transformation vector i) Preparation of feedback inhibition release aroG gene DAHPS of E. coli is leucine by the 150th proline (Pro) of DAHPS amino acid sequence (SEQ ID NO: 2). Substitution with (Leu) eliminates feedback inhibition by phenylalanine (Kikuchi et al., Appl. Environ. Microbiol., 1997, 63, 761-762). The mutation from Pro to Leu in the amino acid sequence of DAHPS was performed by changing C at position 449 in the DNA sequence (SEQ ID NO: 1) encoding DAHPS of E. coli to T. Thereby, feedback inhibition by phenylalanine is released. Specifically, feedback inhibition release aroG was prepared as follows (Kikuchi et al., Appl. Environ. Microbiol., 1997, 63, 761-762, Japanese Patent Application No. 3-196226).

Cloning of aroG gene Full length sequence of aroG gene by PCR using 5'-GTATTTACCCCGTTATTGTC-3 (SEQ ID NO: 5) and 5'-ACTCCGCCGGAAGTGACTAA-3 '(SEQ ID NO: 6) primers from the DNA of wild type E. coli W3110 A 2.0 kb fragment containing was amplified. This fragment was digested with restriction enzymes SalI and Eco47III and inserted into SalI-SmaI of vector pMW119 (Wako Pure Chemical Industries, Osaka, Japan). This vector was introduced into E. coli, and the pMW119 plasmid containing the aroG gene was recovered using the Wizard Minipreps DNA Purification System (Promega) kit.

Generation of aroG gene mutant by hydroxylamine treatment 5 mg of pMW119 plasmid DNA is incubated at 75 ° C for 2 h in 100 ml treatment buffer (50 mM sodium phosphate, 400 mM hydroxylamine, 1 mM EDTA, pH 6.0). Processed. E. coli strain (aroF363 aroG365 aroH367 str-712 thi-1 his-4 proA2 argE3 ilv-7) lacking the DAHPS gene was purified using the EASYTRAP system (Takara Shuzo, Kyoto, Japan). Bacteriol. 99: 707 (1969)). The obtained transformant was screened on an agar medium (kanamycin 50 ug / ml) containing 10 mM Phe, and its resistance to Phe was evaluated. As a result, four transformants having phe resistance, pAROG4, pAROG8, pAROG15 and pAROG29 were obtained. The wild type and mutant DNA sequences of the aroG gene were analyzed to confirm the mutant sequence (Table 1). As a result of analyzing the DAHPS activity of the four transformants, the activity of pAROG4 was the highest. In pAROG4, C at position 449 in the aroG DNA sequence was changed to T, and the 150th Pro in the encoded amino acid sequence was replaced with Leu. This mutation aroG (feedback inhibition release aroG) was used in subsequent experiments.
The nucleotide sequence encoding E. coli DAHPS in which feedback inhibition by phenylalanine is released is shown in SEQ ID NO: 3, and the amino acid sequence of E. coli DAHPS in which feedback inhibition is released is shown in SEQ ID NO: 4.

Table 1. Mutation site and mutation sequence of mutant aroG
^aThe mutated part is underlined. For amino acid sequence variations, numbers indicate residue numbers.

ii) Linkage of gene sequences
Using Ligation PCR method (Fig. 1), 240bp RubisCo small subunit transit peptide sequence (rbcS TP) (SEQ ID NO: 7) before the feedback inhibition release aroG gene sequence, and HA for protein detection after the aroG gene sequence. The hemagglutinin epitope tag) sequence TACCCATACGACGTCCCAGACTACGCT (SEQ ID NO: 8) was ligated.
Using the primers rbcS_F and rbcS_R, the 240 bp rbcS TP sequence was PCR amplified from Arabidopsis thaliana DNA to obtain rbcS TP fragment DNA. The sequence of rbcS TP has a 15 bp vector pUC19 containing the restriction enzyme Sma I site CCCGGG, and the restriction enzyme Sal I site GTCGAC added after the sequence.
Using the primers aroG_F and aroG_R, aroG gene fragment was obtained by amplifying the aroG sequence (1050 bp without stop codon) from the plasmid DNA containing feedback inhibition released aroG, in which C at position 449 of the aroG DNA sequence was changed to T. . In this fragment, an 8 bp rbcS TP sequence and a restriction enzyme Sal I site GTCGA are added 5 'to the aroG gene sequence, and a 27 bp HA sequence and a Kpn I site GGTACC are added before the 3' stop codon. ing.
The two amplified PCR products described above were purified and used as the following template DNA for PCR. Ligation PCR was performed using rbcS_F and HA-aroG_R primers and the above-mentioned rbcS TP fragment DNA and aroG gene fragment DNA as a template to obtain a sequence in which rbcS TP + aroG + HA was linked. Downstream of this sequence is a 15 bp vector pUC19 sequence, restriction enzyme Sst I site GAGCTC and stop codon TGA. The primer sequences used are summarized in Table 2.

Table 2. Primers used to link the HA sequence and the RubisCo small subunit signal peptide sequence to the aroG sequence

All the PCR amplifications described above were performed under the following conditions. 1) 95 ° C 1min, 2) 94 ° C 30s, 56 ° C 30s, 72 ° C 30s, 30 cycles, 3) 72 ° C 7min. Reaction solution composition (total 25 μl): dH ₂ O (sterile water) 18.3 μl; 10 × PCR buffer 2.5 μl; dNTP mix 2.0 μl; forward primer (10 μM) 0.5 μl; reverse primer (10 μM) 0.5 ul; EXTaq polymerase ( 5 unit / μl) (TaKaRa) 0.2 μl; DNA template (50 ng / μl) 1.0 μl.
The ligated sequence was inserted into a cloning vector pUC19 (Clontech). A plasmid containing rbcS TP-aroG-HA was recovered from the colony and the sequence was confirmed. The rbcS TP-aroG-HA fragment was excised from the pUC19 plasmid by double digestion with restriction enzymes Sma I and Sst I.

iii) Construction of plant transformation vector containing mutant aroG Plant transformation vector pBI121 (Clontech) was treated with restriction enzymes Sma I and Sst I, and the resulting product was separated on an agarose gel to obtain the larger vector fragment. Was recovered. The rbcS TP-aroG-HA DNA fragment excised with Sma I and Sst I was ligated with the recovered vector fragment, and the rbcS TP-aroG-HA sequence was inserted into the Sma I and Sst I restriction enzyme sites of vector pBI121 ( Figure 2). The sequence of the obtained plasmid DNA was confirmed. Next, a plasmid containing this rbcS TP-aroG-HA sequence was introduced into Agrobacterium tumefaciens strain EHA105.

Incorporation of E. coli aroG gene into plant transformation vector pBI121aroG prepared in Example 1 was introduced into Agrobacterium tumefaciens strain EHA105, and the resulting Agrobacterium EHA105 culture solution containing pBI121aroG was obtained by Arabidopsis thaliana using the reduced pressure infiltration method. Infected with Columbia. The in planta transformation method using the vacuum infiltration method followed the method of Bechtold et al. (CR Acad Sci. Paris, Life Science, 1993; 316, 1194-1199).
Arabidopsis was cultivated in a pot for about 3 weeks. The Arabidopsis began to extract moss, and chopped when the stem height reached 5-6 cm. After pinching, the plant body was further cultivated for several days to a week, so that the plant could be infected with Agrobacterium.
Agrobacterium EHA105 holding the pBI121 vector inserted with aroG was pre-cultured for 2 days, and the pre-cultured Agrobacterium was further cultured with shaking in LB medium (containing antibiotic kanamycin) for 24 hours. Thereafter, Agrobacterium was collected from the culture solution by centrifugation, and suspended in a medium (1/2 MS, 5% Sucrose, Silwet L77 0.05%, pH 5.7) for 1 hour to prepare an infectious solution.
Flowers already flowering or fruiting were removed from Arabidopsis plants. The pot in which the Arabidopsis plant was planted was inverted and the plant was immersed in the infectious solution. The beaker containing the pot was placed in a desiccator and sucked for 5 minutes at a pressure of -50 kPa. Then, the pressure was slowly restored, and the bacterial solution remaining on the plant was removed with a towel. The bowl was placed on its side in a plastic bucket, covered with wrap and placed overnight. The next day, the wrap was removed, the pot was raised, and cultivation was continued in a place with good light conditions. The seeds were harvested about 4 weeks after infection. Using the harvested seeds, transformants were selected as described in Example 3.

Selection of transformants and genomic DNA analysis of transformants
Harvested seeds from Arabidopsis plants infected with Agrobacterium EHA105 with pBI121aroG, sterilized the seeds (T1) with 1% sodium hypochlorite solution, washed 3 times with sterile water, containing kanamycin (50μg / mL) 1/2 MS medium (2.2g / L MS (MURASHIGE & SKOOG MEDIUM, Duchefa Biochemie), 10g / L sucrose, 0.5g / lL MES-KOH (pH 5.7), 0.8% agar) And made a selection. As a result of selection, 11 lines of kanamycin resistant plants were obtained. Eleven strains of genomic DNA that showed kanamycin resistance were analyzed to confirm the introduction of the mutant aroG gene. Genomic DNA was extracted from leaves of 11 transformant T1 plants. Genomic DNA was extracted using DNeasy Plant Kit from QIAGEN. Two primers, NPT II-F (forward primer) 5'-TCTGATGCCGCCGTGTTCCG-3 '(SEQ ID NO: 14) and NPT II-R (reverse primer) 5'-TCTTCGTCCAGATCATCCTG -3 ′ (SEQ ID NO: 15) was designed and PCR was performed.
PCR amplification conditions: 95 ° C 5 min, 2) 94 ° C 30 s, 60 ° C 30 s, 72 ° C 30 s, 30 cycles, 3) 72 ° C 7 min. The composition of the reaction solution was the same as that described in Example 2.

  The results of PCR amplification are shown in FIG. W represents a wild type (Columbia), and 1 to 11 represent transformed plants obtained. An amplified fragment was not observed from the wild type plant, but an approximately 400 bp fragment was amplified in the transformant. From this result, it was confirmed that the NPT II gene was incorporated into the transformant, and it was confirmed that the desired transformant (transgenic plant) was obtained.

Amino acid analysis of transformants Amino acid analysis was performed using T2 generation plants selected and cultivated in 1/2 MS medium (same as above) containing kanamycin (50 ug / ml) for 2 weeks. The amino acid extraction method was performed as follows.
100 mg of Arabidopsis plants (excluding roots) were sampled and powdered (homogenizer MM300 (Retsch)). 1 mL and 0.5 mL of 80% ethanol were added to each of the powder samples and extracted twice. The extract was subjected to a centrifugal evaporator to evaporate ethanol. Then 500 μL of pure water was added to dissolve the sample. Thereafter, 500 μL of chloroform was added and mixed well to separate the solution, and 400 μL of the upper aqueous solution was taken and transferred to a new tube. The aqueous solution was subjected to a centrifugal evaporator to evaporate the water to obtain an extract. The extract was dissolved in 800 uL of 0.02 N HCL on the same day as the amino acid analyzer, and filtered. Amino acids were measured using 200 μL of the resulting extract as a sample. Amino acids were measured using an L-8800 high-speed amino acid analyzer (HITACHI) according to the analysis method of this instrument. Each sample was subjected to a duplicate experiment, the amount of amino acid (nmol) per fresh mass (FW) of the sample was calculated, and the average value was taken as the result. Compared with wild type, the content of aromatic amino acids was increased in several lines of transformants of feedback inhibition released aroG. For each aromatic amino acid, an increase was particularly observed in the 4th, 5th and 7th lines.
The results are shown in Table 3 and Figs. 4a, b and c.

Table 3. Amino acid content of transformant Unit: mmol / g (FW)

  Line 4 has the highest aromatic amino acid content, about 168 times the wild type average phenylalanine content 0.096 mmol / g FW, tyrosine content 0.045 mmol / g FW, tryptophan content 0.067 mmol / g FW, respectively. (16.204 mmol / g FW), about 36 times (1.611 mmol / g FW) and about 4 times (0.299 mmol / g FW) (FIGS. 4 a, b and c).

Analysis of protein expression of aroG by Western blot T2 generation Arabidopsis plants selected and cultivated in 1/2 MS medium (same as above) containing kanamycin (50 μg / mL) were used as materials for Western blot analysis. Protein extraction method: About 40 mg of Arabidopsis plants (excluding roots) is crushed, extracted buffer (25 mM Tris, 75 mM Nacl, 0.1% NP-40) is added, vortexed, then centrifuged at 15000 rpm for 15 minutes (4 ° C.) and the supernatant was recovered. A part of the collected supernatant was used as a protein sample for Western blot analysis, and the rest was used as a protein concentration measurement sample. For Western blot analysis, rat monoclonal antibody Anti-HA High Affinity (Roche) against HA was used. The predicted molecular weight of aroG is 38 kDa, rbcS TP is 8 kDa, and HA tag is 1 kDa, so aroG + rbcS TP + HA is 47 kDa. DAHPS functions locally in chloroplasts in plants. The protein of aroG + rbcS TP + HA has a molecular weight of 41.5 kDa when it is transferred to the chloroplast after partial sequence of rbcS TP is cleaved. As a result of Western blot analysis, no band was detected in the wild type, but in the transformants other than No. 12 and No. 14, protein expression was observed near the estimated molecular weight (41.5 kDa) (FIG. 5).
From this result, the introduced E. coli feedback inhibition release (mutation) aroG was expressed in Arabidopsis transformants. In addition, it was confirmed that almost all proteins encoded by the mutant aroG migrated to chloroplasts. Differences in expression levels were observed between strains, with strong expression in transformant lines 3, 4, 7 and 16 and comparison in transformant lines 5, 6, 8, 9 and 20 Expression was weak. Moreover, the expression level of aroG in each line was consistent with the amino acid content (FIG. 4).

Analysis of total polyphenol content Plants synthesize various functional products from aromatic amino acids. Among them, since it is well known that polyphenols have an antioxidant activity, the total content of polyphenols in aroG transformants with increased phenylalanine content was examined.
Polyphenols were extracted using T2 generation plants selected and cultivated in 1/2 MS medium (same as above) containing kanamycin (50 μg / mL) for 2 weeks. The extraction method was in accordance with the method described in the paper by Lamien-Meda et al. (Lamien-Meda et al. Molecules, 2008, 13, 581-594). 100 mg of the above-ground part of Arabidopsis plants was frozen with liquid nitrogen, ground and powdered, and extracted twice by adding 1.0 mL of 70% methanol. The obtained extract was subjected to a centrifugal evaporator to completely evaporate the liquid, and then dissolved in 500 μL of 70% methanol. The total polyphenol content was measured using the solution. The measurement was performed by the Folin-Ciocalteau method. To 50 μL of the extract, 1075 μL of pure water and 75 μL of Folin-Ciocalteau reagent (2N) (SIGMA) were added, mixed well, and then incubated at room temperature for 8 minutes. Next, 300 μL of 15% sodium carbonate was added and incubated for 2 hours, after which the absorbance at 765 nm was measured. Calibration curves were prepared using 0, 10, 20, 40, 80, 160 mg / L gallic acid. The measurement result was expressed as a polyphenol content corresponding to gallic acid (mg) per 100 g of fresh plant mass (FW) (Table 4, FIG. 6).

Table 4 Total polyphenol (PF) content of transformants (mg / 100g corresponding to gallic acid)

  Compared to the wild type (W), the amount of polyphenols in the transformant introduced with feedback inhibition release aroG was found to be increased. Increased. From this result, it was confirmed that the amount of polyphenol was increased in the transformant introduced with feedback inhibition (mutation) aroG, suggesting that the biosynthesis of secondary metabolites was controlled.

Measurement of antioxidant activity Antioxidant activity was examined using the above polyphenol extract. Using the DPPH (2,2-diphenyl-1-picrylhydrazyl) radical method according to the method described in Lamien-Meda et al. (Molecules, 2008, 13, 581-594) The erasing ability was measured. To 50 μL of the sample extract, 700 μL of methanol was added, and 750 uL of 0.02 mg / mL DPPH (ALFA AESAR) was added and mixed well. Then, it incubated at room temperature for 15 minutes and measured by the light absorbency of 517nm. Calibration curves were prepared with 0, 0.2, 1, 2 and 4 ug / mL ascorbic acid. The measurement result was expressed as an amount (mg) corresponding to ascorbic acid having an equivalent free radical scavenging ability in 100 g of fresh mass (FW) of the plant (Table 5, FIG. 7).

Table 5 Antioxidant activity of transformants (amount corresponding to ascorbic acid with equivalent free radical scavenging capacity in 100 g of fresh mass (mg))

  As a result, the increase in antioxidant activity in the aroG transformant compared to the wild species (W) is almost the same as the increase in the amount of polyphenol described above, and the antioxidant activity of the No. 4 transformant line is wild. There was a 2.2-fold increase compared to the species. From this result, it was confirmed that the antioxidant activity of plants was increased by introducing the feedback inhibition release gene aroG.

Claims (13)

  Transformation in which feedback inhibition of 3-deoxy-D-arabino-heptulon-7-phosphate synthase was released and the content of secondary metabolites of aromatic amino acids increased compared to wild-type plants cultivated under the same conditions plant.   The transformed plant according to claim 1, wherein a 3-deoxy-D-arabino-heptulon-7-phosphate synthase gene in which feedback inhibition is released is introduced.   The 3-deoxy-D-arabino-heptulon-7-phosphate synthase released from feedback inhibition has at least 80% sequence identity to the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, The 3-deoxy-D-arabino-heptulon-7-phosphate synthase activity and Pro corresponding to position 150 of the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid. Transformed plants.   The transformed plant according to claim 3, wherein the amino acid sequence of 3-deoxy-D-arabino-heptulon-7-phosphate synthase from which feedback inhibition has been released is the amino acid sequence of SEQ ID NO: 4.   The transformed plant according to any one of claims 1 to 4, wherein the secondary metabolite of the aromatic amino acid is a polyphenol.   The transformed plant according to claim 5, wherein the content of polyphenols is increased by 1.2 times or more compared to a wild-type plant cultivated under the same conditions.   The antioxidant activity converted per unit mass of the transformed plant or a part thereof is 1.2 times the antioxidant activity converted per unit mass of the plant or part of the wild-type plant grown under the same conditions The antioxidative activity is measured using a plant extract extracted from the plant body or a part thereof and the plant body of the wild type plant or a part thereof. 6. The transformed plant according to any one of 5 above.   Increased production of secondary metabolites of aromatic amino acids, including release of feedback inhibition of 3-deoxy-D-arabino-heptulon-7-phosphate synthase in plants with shikimate synthesis system A method for producing transformed plants.   The transgenic plant according to claim 8, which comprises introducing a gene encoding 3-deoxy-D-arabino-heptulon-7-phosphate synthase whose feedback inhibition is released into a plant having a shikimic acid synthesis system. Production method.   The 3-deoxy-D-arabino-heptulon-7-phosphate synthase released from feedback inhibition has at least 80% sequence identity to the polypeptide comprising the amino acid sequence of SEQ ID NO: 2, The 3-deoxy-D-arabino-heptulon-7-phosphate synthase activity, and Pro corresponding to position 150 of the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid. Of producing transgenic plants.   The method for producing a transformed plant according to claim 10, wherein the amino acid sequence of 3-deoxy-D-arabino-heptulon-7-phosphate synthase from which feedback inhibition has been released is the amino acid sequence of SEQ ID NO: 4.   The method according to any one of claims 8 to 11, further comprising selecting a plant having an increased production amount of a secondary metabolite of an aromatic amino acid.   The manufacturing method of polyphenols including collect | recovering polyphenols from the plant of any one of Claims 1-7.