CN110526961A - Participate in the application of regulation tomato steroid alkaloid synthesis transcription factor - Google Patents
Participate in the application of regulation tomato steroid alkaloid synthesis transcription factor Download PDFInfo
- Publication number
- CN110526961A CN110526961A CN201910847193.7A CN201910847193A CN110526961A CN 110526961 A CN110526961 A CN 110526961A CN 201910847193 A CN201910847193 A CN 201910847193A CN 110526961 A CN110526961 A CN 110526961A
- Authority
- CN
- China
- Prior art keywords
- plant
- slbhlh114
- steroid alkaloid
- tomato
- transcription factor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
Abstract
The invention discloses the applications for participating in regulation tomato steroid alkaloid synthesis transcription factor, the amino acid sequence of transcription factor SlbHLH114 is as shown in SEQ ID NO.4, nucleotide sequence is as shown in SEQ ID NO.3, being overexpressed the transcription factor has positive regulation effect to the synthesis of tomato steroid alkaloid, it therefore can be by being overexpressed transcription factor SlbHLH114 in plant, the steroid alkaloid content of transgenic line is improved, provides theoretical foundation for Tomato Quality improvement and excellent breeding.
Description
Technical field
The present invention relates to field of biotechnology, and in particular to participates in answering for regulation tomato steroid alkaloid synthesis transcription factor
With.
Background technique
Steroid alkaloid (SAs) and its glycoforms (steroid alkaloid glucosides, SGAs) are nitrogenous in plant families
Toxic compounds, also referred to as Solanum alkaloid are to belong to Solanaceae (Solanaceae), especially Solanum (Solanum) family
Common composition.In plant, steroid alkaloid is provided a kind of pre-existing for various diseases for plant frequently as antibiotic
The chemical barrier of substance leads to the leakage of electrolyte and the depolarising of film potential if α-tomatidine is by the effect of destruction film.It grinds
Study carefully the presence shown due to steroidal glycosides alkaloid in tomato cell film and acetylation steroidal glycosides alkaloid, reduces α-tomato
Alkali is to the toxicity of plant cell, so that tomato plant be made not poisoned by it.But for human, some steroid alkaloids can draw
Gastrointestinal tract and the nervous system disease are played, and at high concentrations may be fatal, toxic mechanism includes destroying cell membrane and inhibiting acetyl
Cholinesterase activity.Although steroid alkaloid facilitate plant resistant multiple pathogens and carnivore (including bacterium, fungi,
Oomycetes, virus, insect and animal), but due to their toxic effect, majority is considered as the anti-nutrient compounds of the mankind.
Studies have shown that the presence of solanine makes tomato have astringent taste, and in the breeding process from wild-type tomato to cultivated tomato,
Solanine content is gradually decreasing, and natural variation is mainly controlled by 5 genetic locus, and is selected strongly, wherein effect
Maximum is a glycosyltransferase gene cluster on No. 10 chromosomes, is primarily present in red fruit, passes through two main effects
Main solanine content just can be reduced by 80% by site.Multiple groups credit analysis and Protocols in Molecular Biology are utilized recently, are determined substantially
The molecular mechanism that steroid alkaloid synthesizes in tomato, it is raw to cycloartenol approach from glycolytic pathway via mevalonate pathway
Generating cholesterol is hydroxylated, aoxidizes, turns the reactions such as ammonia, cyclization and generate steroid alkaloid by a series of, but metabolic regulation mechanism is still not
It is clear.Therefore, the transcription factor for participating in regulation tomato steroid alkaloid synthesis is studied, for improvement tomato steroidal biology
Alkali content is of great significance.
Summary of the invention
In view of this, one of the objects of the present invention is to provide a kind of participation regulation tomato steroid alkaloid synthesis transcription because
Sub- SlbHLH114 is improving the application in plant steroid alkaloid content；The second object of the present invention is to provide a kind of raising
The method of plant steroid alkaloid content.
In order to achieve the above objectives, the invention provides the following technical scheme:
1, it participates in regulation tomato steroid alkaloid synthesis transcription factor SlbHLH114 and is improving plant steroid alkaloid content
In application, the amino acid sequence of the transcription factor SlbHLH114 is as shown in SEQ ID NO.4.
Preferably, the nucleotide sequence of the transcription factor SlbHLH114 is as shown in SEQ ID NO.3.
Preferably, the plant is plant of Solanaceae.
Preferably, the plant is tomato.
It is furthermore preferred that the steroid alkaloid is hydroxytomatidenol (hydroxyl dehydrogenation tomatidine),
Hydroxytomatidine (hydroxyl tomatidine), δ-tomatine (δ-tomatidine glycosides), β 2-tomatine (β 2- tomatidine
Glycosides), tomatidine-o-rhamnoside (tomatidine-o- rhamnoside) and dihydroxy tomatidine-o-
Hexoside-o-rhamnoside (dihydroxy tomatidine-o- hexose-rhamnoside), tomatidine (tomatidine),
Tomatidine derivative (tomato alkali derivant), filotomatine, γ-tomatine (γ-tomatidine),
Tomatine (tomatidine glycosides), tomatidine-o-hexosyl-o-pentoside (tomatidine-o- adipyl base-o- pentose
Glycosides), in Acetoxydehydrotomatine (acetic acid dehydrogenation tomatidine), lycoperoside A and lycoperside H
It is one or more.
2, it is a kind of improve plant steroid alkaloid content method, by participate in regulation tomato steroid alkaloid synthesis transcription because
Sub- SlbHLH114 is overexpressed in plant, and the amino acid sequence of the transcription factor SlbHLH114 is as shown in SEQ ID NO.4.
Preferably, the method being overexpressed in plant is as follows: then clone's transcription factor SlbHLH114 gene constructs plant
Expression vector obtains the recombinant plant expression vector containing transcription factor SlbHLH114, then the recombinant plant of acquisition is expressed and is carried
Body converts Agrobacterium tumefaciems and obtains engineering bacteria, finally converts plant explant with engineering bacteria, passes through the culture that co-cultures, lives again, life
Root culture obtains transgenic plant, the as high plant of steroid alkaloid content through positive identification.
Preferably, the method for cloning transcription factor SlbHLH114 gene is as follows: using tomato cDNA as template, SEQ ID
Sequence described in NO.1 and SEQ ID NO.2 is that primer carries out PCR amplification, and amplification obtains grand transcription factor SlbHLH114 gene.
Preferably, the method for the building plant expression vector is as follows: by nucleotide sequence as shown in SEQ ID NO.3
Sequence is connected into pBin19-E8-GW and pBin19-35S-GW carrier and obtains.
It is furthermore preferred that the plant is tomato.
The beneficial effects of the present invention are: the present invention provides SlbHLH114 transcription factors to close tomato steroid alkaloid
At with positive regulation effect, the expression of gene is synthesized to further regulate and control steroidal biology by regulation tomato steroid alkaloid
The accumulation of alkali, discloses the regulatory mechanism of tomato steroid alkaloid metabolic pathway, therefore can be by plant, especially eggplant
Overexpression SlbHLH114 transcription factor gene obtains the plant that steroid alkaloid content improves in section plant, is tomato steroidal
The synthesis of alkaloid and marker assisted selection provide theoretical foundation.
Detailed description of the invention
In order to keep the purpose of the present invention, technical scheme and beneficial effects clearer, the present invention provides following attached drawing and carries out
Illustrate:
Fig. 1 is detected in the stable transgenosis fruit of tomato for real-time fluorescence quantitative PCR and blade SlbHLH114 expression quantity situation
(A: fruit；B: blade；E8-SlbHLH114-C/I: the different transgene tomato strains containing E8 promoter are indicated；35S-
SlbHLH114-NPTII-11/24: the different transgene tomato strains containing 35S promoter are indicated；WT:wild type).
Fig. 2 is that LC-MS detects steroid alkaloid content situation (E8-SlbHLH114-C/ in the stable transgenosis fruit of tomato
I: the different transgene tomato strains containing E8 promoter are indicated；WT:wild type).
Fig. 3 is that LC-MS detects steroid alkaloid content situation (35S-SlbHLH114- in the stable transgenic leaf of tomato
NPTII-11/24: the different transgene tomato strains containing 35S promoter, WT:wild type are indicated).
Specific embodiment
The present invention will be further explained below with reference to the attached drawings and specific examples, so that those skilled in the art can be with
It better understands the present invention and can be practiced, but illustrated embodiment is not as a limitation of the invention.
By synthesizing the research with regulation to tomato steroid alkaloid, pass through transcript profile, metabolism group and protein groups joint point
Analysis elaborates the anabolism access of tomato steroid alkaloid.Then combined with transcript profile point by space-time high-resolution metabolism group
The method of analysis, navigates to a bHLH family transcription factor (Solyc01g096370) and tomato steroid alkaloid and its metabolism is logical
Roadbed is because being presented coexpression mode, thus it is speculated that the transcription factor may regulate and control the synthesis of tomato steroid alkaloid.For in verifying
Guess is stated, the present invention uses agrobacterium-mediated transformation, and SlbHLH114 is imported in tomato cotyledon, germinateed, taken root, grow stabilization
Transgenic Tomato Plants, in T0 generation, identifies and screening positive plant, T1 generation discovery transcription factor and synthesis gene great expression, thus
Steroid alkaloid content is caused to significantly improve.
The clone of embodiment 1, tomato SlbHLH114 gene
(1) extraction of tomato leaf total serum IgE
Appropriate tomato leaf is taken, it is quick-frozen in liquid nitrogen, it is sufficiently crushed using quick beveller according to 45Hz, 30s
Three times, lysate is added, according to plant RNA extraction kit V1.5 (BIOFIT) specification extracted total RNA.It is solidifying using agarose
Gel electrophoresis detects RNA mass, detects RNA concentration using 2000 spectrophotometer of NanoDrop.
(2) clone of tomato SlbHLH114 gene
Using the total serum IgE of extraction as template, cDNA is synthesized according to Takara reverse transcription reagent box specification；According to
The sequence design gene-specific primer of SlbHLH114 gene, particular sequence are as follows:
SlbHLH114 upstream primer: 5 '-atggaacaactcgcggtttc-3 ' (SEQ ID NO.1)；
SlbHLH114 downstream primer: 5 '-atttacaaatcatagctagtaagaa-3 ' (SEQ ID NO.2).
With Takara high fidelity enzyme Primerstar Max by PCR amplification SlbHLH114 gene, then connects T4 and carry
Body converts bacillus coli DH 5 alpha, picking positive colony sequencing.
The results show that amplification obtains the complete encoding sequence of tomato SlbHLH114, nucleotide sequence such as SEQ ID NO.3
It is shown；Protein coding amino acid sequence is as shown in SEQ ID NO.4, and initiation codon is ATG, terminator codon TAA.
The building of embodiment 2, plant expression vector containing SlbHLH114
For the influence of steroid alkaloid content in research SlbHLH114 gene pairs tomato, over-express vector is constructed respectively
PBin19-E8-SlbHLH114 and 35S-SlbHLH114-NPTII carrier.The non-spy of respective carrier is added in forward and reverse primer
Anisotropic arm, primer are as shown in table 1.
Table 1, pBin19-E8-SlbHLH114 and 35S-SlbHLH114-NPTII vector construction primer sequence
The T4 carrier of the correct gene containing SlbHLH114 is sequenced as template, respectively with SEQ ID NO.5 and SEQ ID
NO.6 and SEQ ID NO.7 and SEQ ID NO.8 is primer, using the Primerstar Max high-fidelity of Takara company
Enzyme carries out PCR amplification.It is connected into pBin19-E8-GW and P35S-SlbHLH114- respectively by gateway and goldenbraid
1 carrier of T35S-PnoS-NPTII-TnoS- Ω (Ying, Su et al.2019, Sarrion-Perdigones, Vazquez-
Vilar et al.2013), sequence verification obtains expression vector pBin19-E8-SlbHLH114 and 35S-SlbHLH114-
NPTII。
Tomato SlbHLH114 gene is operatively connectable to expression regulation sequence by the present embodiment, which can be used for
Regulate and control tomato steroid alkaloid content by transcriptional control strategy.
Embodiment 3, Agrobacterium tumefaciens mediated SlbHLH114 over-express vector genetic transformation tomato obtain transgene tomato
Plant
(1) the Agrobacterium tumefaciems engineering of the expression vector containing pBin19-E8-SlbHLH114 and 35S-SlbHLH114-NPTII
The acquisition of bacterium
PBin19-E8-SlbHLH114 the and 35S-SlbHLH114-NPTII expression vector that embodiment 2 is obtained is using electricity
Robin is transferred to Agrobacterium tumefaciems (such as EHA105), carries out PCR verifying.The result shows that pBin19-E8-SlbHLH114 and 35S-
SlbHLH114-NPTII expression vector is successfully building up in Agrobacterium tumefaciens strain.
(2) Agrobacterium tumefaciens mediated SlbHLH114 genetic transformation tomato
A. the preparation of tomato aseptic cotyledon and preculture
By seed 10ml, 5%PPM (fungistat), 3 × MS solution disinfection 4 hours；Every bottle of about 30 seeds are put down
Be laid on 1/2MS (Murashige and Skoog, 1962) solid medium, 25 DEG C, 16h/8h (illumination/dark) cultivate 7-10
It, can be obtained tomato aseptic cotyledon.In cutting seedling liquid (MS+KH2PO4200mg/L+2,4-D 0.2mg/L+KT 0.1mg/L) in
Cotyledon both ends are cut off, pre-culture medium (1/2MS+IAA 1mg/L+ZR 2mg/L) culture is placed in, is used for subsequent transformation.
B. the co-cultivation of Agrobacterium and explant
Contain pBin19-E8-SlbHLH114 and 35S- for what the addition of explant made from step a had activated
SlbHLH114-N [Agrobacterium tumefaciems re-suspension liquid (the MS+KH of TII expression vector2PO4200 μm of ol/L of 200mg/L+AS), bacterium solution
It comes into full contact with 18 minutes, goes to co-culture medium (200 μm of ol/L of MS+AS) with explant, toilet paper package is placed in 25 DEG C
Low light culture 2 days in incubator.
C. live again culture and the culture of rootage of explant
Explant in step b is placed in culture medium of living again (MS+IAA 1mg/L+ZR 2mg/L+Kan 100mg/L+Tim
320mg/L), a subculture is replaced every two weeks, until long budding；After remove callus, be transferred in root media (MS+
Kan 50mg/L+Tim 320mg/L), every 4 weeks one subcultures of replacement form intact plant until sending out roots.
D. it transplants seedlings transgenic plant
The sterile stable transgenic plant obtained in step c is practiced to seedling overnight in 25 DEG C of incubators, is moved back in the basin that buries,
Until growing the tissue such as healthy and strong root, stem and leaf.
(3) identification of positive transgenic plant
Forward and reverse detection is separately designed according to pBin19-E8-SlbHLH114 and 35S-SlbHLH114-PTII expression vector
Primer pair transgenic plant is detected, specific primer sequence such as table 2:
Table 2, SlbHLH114 positive transgenic tomato plant identify primer sequence
| Primer | Primer sequence (5 ' -3 ') |
| qRT-SlbHLH114-F | aagagaaaacagcagaaaaccg(SEQ ID NO.9) |
| T35S CAMV-R | tcaacacatgagcgaaaccct(SEQ ID NO.10) |
| P35S-F | gagcatcgtggaaaaagaagacgttc(SEQ ID NO.11) |
| T35S-R | gctcaacacatgagcgaaaccctata(SEQ ID NO.12) |
| qRT-SlbHLH114-R | gttgattgatgtaggacacagc(SEQ ID NO.13) |
Turn base containing pBin19-E8-SlbHLH114 expression vector with SEQ ID NO.9 and SEQ ID NO.10 detection
Because of plant, is detected and contained jointly with SEQ ID NO.11 and SEQ ID NO.13 and SEQ ID NO.9 and SEQ ID NO.12
The transgenic plant of 35S-SlbHLH114-NPTII expression vector.
Testing result shows that, using designed primer sequence, positive transgenic plant can amplify specific DNA piece
Section, and negative and wild-type tomatoes do not amplify any segment.
(4) quantitative detection Transgenic Tomato Plants SlbHLH114 gene expression amount
Collect the fruit that each strain of the transgene tomato containing pBin19-E8-SlbHLH114 expression vector breaks three days after color
It is real, collect the transgene tomato blade containing 35S-SlbHLH114-NPTII expression vector, it is quick-frozen in liquid nitrogen, using quickly grinding
Instrument is ground, extracts RNA according to the method for embodiment 1, obtains cDNA.CDNA RNA-free water is diluted 20 times, uses Bio-Rad
The SYBR Supermix of company carries out quantitative fluorescent PCR, using SlUBI as crt gene, detection Transgenic tomato fruit expression
Amount, wherein target gene primer sequence compares UBI primer sequence such as 3 institute of table as shown in SEQ ID NO.9 and SEQ ID NO.13
Show.
The hairy kan gene expression quantity detection primer sequence of table 3, SlbHLH114 transgene tomato
| Primer | Primer sequence (5 ' -3 ') |
| qRT-SlUBI-F | gccaaagaagatcaagcaca(SEQ ID NO.14) |
| qRT-SlUBI-R | tcagcattagggcactcctt(SEQ ID NO.15) |
As a result as shown in Figure 1.The result shows that being connected with the transgene tomato SlbHLH114 fruit expression quantity of E8 promoter
It is above wild type, the transgene tomato SlbHLH114 leaf expression amount for being connected with 35S promoter is above wild type, shows
SlbHLH114 gene is successfully transferred to tomato, successfully obtains the tomato plant for being overexpressed SlbHLH114 gene.
The plant expression vector is converted Agrobacterium tumefaciems by the present embodiment, obtains the pBin19- for converting tomato
The Agrobacterium tumefaciems engineered strain of E8-SlbHLH114 and 35S-SlbHLH114-NPTII expression vector, utilizes constructed root
Cancer Agrobacterium-mediated Transformation tomato obtains the Transgenic Tomato Plants positive through PCR detection.The acquisition of Transgenic Tomato Plants is screening
High-content steroid alkaloid provides direct material and theoretical basis.
Steroid alkaloid content in embodiment 4, LC-MS method measurement transgene tomato
(1) LC-MS condition
UPLC: Shimadzu Corporation Shim-pack UFLC SHIMADZU CBM30A system (https: //
www.shimadzu.com.cn/)。
Chromatographic column: Waters ACQUITY UPLC HSS T3 C18 column (partial size: 1.8 μm；Length and width: 100 × 2.1mm).
Mobile phase: organic phase is alcohol acetonitrile solution, water phase is the ultrapure water containing 0.01% acetic acid；Condition of gradient elution:
0min-water phase/organic phase (95:5V/V), 11.0min-5:95V/V, 12.0min-5:95V/V, 12.1min-95:5V/V,
15.0min—95:5V/V.Column temperature is 40 DEG C, and sample input is 2 μ l, and sample introduction flow velocity is that sample introduction flow velocity is 0.4ml/min.
The SCIEX Triple Quad of MS: Ai Bo imaginative power companyTM5500LC-MS/MS system (http: //
www.appliedbiosystems.com.cn/)。
Electric spray ion source (ESI, Electrospray ionization): mass spectrum voltage is 5500V, temperature 500
DEG C, gas curtain gas (CUR, curtain gas) is 40psi, collision induced dissociation (CAD, collision-activated
Dissociation) parameter is set as medium；In triple quadrupole bar (QQQ), each ion pair is to go cluster electric according to optimization
Pressure (DP, declustring potential) and (CE, collision energy) is scanned detection.Compound is according to
The ion pair delivered in document is quantified.
(2) preparation of sample and the measurement of steroid alkaloid content
Collect peel sample and 35S-SlbHLH114- that pBin19-E8-SlbHLH114 transgenosis fruit breaks 10 days after color
NPTII transgenic leaf, quick-frozen in liquid nitrogen, low temperature is lyophilized to constant weight in freeze drier, pulverizes, and it is dry to weigh 0.1g
Powder is dissolved in 80% methanol of 1ml extracting solution (containing 0.1% formic acid), and vortex 30s, 40W ultrasound 30min, be then vortexed 30s, then
3000g, 4 DEG C be centrifuged 10 minutes, transfer supernatant to new pipe, continue 20000g, 4 DEG C be centrifuged 10 minutes, supernatant crosses 0.22 μm of filter membrane,
It is stored in brown sample injection bottle.
Steroid alkaloid content is measured using LC-MS method, sample feeding volume is 2 μ L, wild according to mass spectra peak cartographic represenation of area
Raw type and Transgenic tomato fruit and blade content, as a result as shown in Figures 2 and 3.
The results show that the tamato fruit and blade of SlbHLH114 over-express vector significantly improve steroid alkaloid content,
Up to tomatine (tomatidine glycosides) improves 2.7 times in pBin19-E8-SlbHLH114-I strain,
Acetoxydehydrotomatine (acetic acid dehydrogenation tomatidine) improves 1.7 in 35S-SlbHLH114-NPTII-24 strain
Times.In addition, in pBin19-E8-SlbHLH114-I strain, hydroxytomatidenol (hydroxyl dehydrogenation tomatidine),
Hydroxytomatidine (hydroxyl tomatidine), δ-tomatine (δ-tomatidine glycosides), β 2-tomatine (β 2- tomatidine
Glycosides), tomatidine-o-rhamnoside (tomatidine-o- rhamnoside) and dihydroxy tomatidine-o-
The content of hexoside-o-rhamnoside (dihydroxy tomatidine-o- hexose-rhamnoside) also significantly improves, cholesterol
(cholesterol) increase rate is unobvious.In 35S-SlbHLH114-NPTII strain, tomatidine (tomatidine),
Hydroxytomatidine (hydroxyl tomatidine), hydroxytomatidenol (hydroxyl dehydrogenation tomatidine), tomatidine
Derivative (tomato alkali derivant), filotomatine, δ-tomatine (δ-tomatidine glycosides), γ-tomatine (γ-
Tomatidine), tomatidine-o-rhamnoside (tomatidine-o- rhamnoside), tomatine (tomatidine glycosides),
Tomatidine-o-hexosyl-o-pentoside (tomatidine-o- hexose-pentoside), lycoperoside A,
The content of lycoperside H also significantly improves.
In the present embodiment, the Transgenic tomato fruit and blade of SlbHLH114 over-express vector are determined using LC-MS method
Middle steroid alkaloid content finds SlbHLH114 gene using successful conversion SlbHLH114 over-express vector metabolic engineering strategies
Expression quantity and steroid alkaloid content have apparent positive correlation, for utilize the gene for be overexpressed research in turn
It improves tomato steroid alkaloid content and strong experimental basis is provided.
Embodiment described above is only to absolutely prove preferred embodiment that is of the invention and being lifted, protection model of the invention
It encloses without being limited thereto.Those skilled in the art's made equivalent substitute or transformation on the basis of the present invention, in the present invention
Protection scope within.Protection scope of the present invention is subject to claims.
Sequence table
<110>Sichuan University
<120>application of regulation tomato steroid alkaloid synthesis transcription factor is participated in
<160> 15
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atggaacaac tcgcggtttc 20
<210> 2
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atttacaaat catagctagt aagaa 25
<210> 3
<211> 1353
<212> DNA
<213>tomato (Solanum lycopersicum)
<400> 3
atggaacaac tcgcggtttc ctcatctccc atggcagtag ctcctcctcc ggtagacgtt 60
aaccaggtgc ctttaggcct acaacagatg cttcaatatg ttgtcaaaag ccaaccagaa 120
tggtgggctt atgctatttt ctggcagacc tctaatgacg acgagggaaa aaacttttta 180
gcttggggag acggatattt ccaaggagat ggtgtagtta ttaacaacaa aggcggcggc 240
ggtagcagca gcagcttaaa gtcacaggct cagtccgaga gaaaaaaagt tattaaagga 300
attcaagctt taatggatgg taatggagat actgatctag tggatgatgg tgatgtaact 360
gacactgagt ggttctacgt gatgtcgctg gcccgttctt tctctgccgg agatggatct 420
gttaccggta aagcttttgg aagtgatgat tttttgtgga taacaggtcc ggaccaattt 480
cagcttcatt acagctgtga aagggctaaa gaagctcaga tccatgggat tcagactctg 540
gttagtattc caacttcaaa tggcgtgttt gaattaggct ccactcaatt aatcaaacag 600
aatttgagct tagttcaaca ggtgaagtct ctgttcctct gttgtccccc tattcaattt 660
ttagaaaaaa caattagttt tgccgatatt ggccttgtca ccggcttgca acaagatgac 720
aatgactata aattaagaga aaacagcaga aaaccgcacc ctgttgtagc caaaaaaaga 780
gggagaaagc ctaaaggcgg cgaggaggat gctcatatgg cggcattgaa ccacgtggaa 840
gcggagagac agaggaggga gaagctgaac caccggttct acgcgttgcg ctccgtcgtt 900
cccaacgtat cgagaatgga caaagcgtca ttgctctcag acgctgtgtc ctacatcaat 960
caactcaaag ccaaggtaga tgaactggag ttgcagctaa ttgatcacac taaaaaaccg 1020
aaaatcgtaa cagaatcatc atcagctgac aaccagagcg ccaccacctc atccgacgac 1080
caagtaatta aagcagctaa tcccacagca gccccggagg ttgaagtgaa aatagttggc 1140
acagatgcaa tgatcagagt tcaatcggaa aacgtggatt atccatcagc aaaactcatg 1200
attgcgcttc aaaatctaca aatgcaagtc caccatgcca gcatttcatc cgtcaatcat 1260
ctcgtccttc atgatgttgt ggttagagtt cctcaaggat tgagcaccga agatgaacta 1320
aggactgctc ttcttactag ctatgatttg taa 1353
<210> 4
<211> 450
<212> PRT
<213>tomato (Solanum lycopersicum)
<400> 4
Met Glu Gln Leu Ala Val Ser Ser Ser Pro Met Ala Val Ala Pro Pro
1 5 10 15
Pro Val Asp Val Asn Gln Val Pro Leu Gly Leu Gln Gln Met Leu Gln
20 25 30
Tyr Val Val Lys Ser Gln Pro Glu Trp Trp Ala Tyr Ala Ile Phe Trp
35 40 45
Gln Thr Ser Asn Asp Asp Glu Gly Lys Asn Phe Leu Ala Trp Gly Asp
50 55 60
Gly Tyr Phe Gln Gly Asp Gly Val Val Ile Asn Asn Lys Gly Gly Gly
65 70 75 80
Gly Ser Ser Ser Ser Leu Lys Ser Gln Ala Gln Ser Glu Arg Lys Lys
85 90 95
Val Ile Lys Gly Ile Gln Ala Leu Met Asp Gly Asn Gly Asp Thr Asp
100 105 110
Leu Val Asp Asp Gly Asp Val Thr Asp Thr Glu Trp Phe Tyr Val Met
115 120 125
Ser Leu Ala Arg Ser Phe Ser Ala Gly Asp Gly Ser Val Thr Gly Lys
130 135 140
Ala Phe Gly Ser Asp Asp Phe Leu Trp Ile Thr Gly Pro Asp Gln Phe
145 150 155 160
Gln Leu His Tyr Ser Cys Glu Arg Ala Lys Glu Ala Gln Ile His Gly
165 170 175
Ile Gln Thr Leu Val Ser Ile Pro Thr Ser Asn Gly Val Phe Glu Leu
180 185 190
Gly Ser Thr Gln Leu Ile Lys Gln Asn Leu Ser Leu Val Gln Gln Val
195 200 205
Lys Ser Leu Phe Leu Cys Cys Pro Pro Ile Gln Phe Leu Glu Lys Thr
210 215 220
Ile Ser Phe Ala Asp Ile Gly Leu Val Thr Gly Leu Gln Gln Asp Asp
225 230 235 240
Asn Asp Tyr Lys Leu Arg Glu Asn Ser Arg Lys Pro His Pro Val Val
245 250 255
Ala Lys Lys Arg Gly Arg Lys Pro Lys Gly Gly Glu Glu Asp Ala His
260 265 270
Met Ala Ala Leu Asn His Val Glu Ala Glu Arg Gln Arg Arg Glu Lys
275 280 285
Leu Asn His Arg Phe Tyr Ala Leu Arg Ser Val Val Pro Asn Val Ser
290 295 300
Arg Met Asp Lys Ala Ser Leu Leu Ser Asp Ala Val Ser Tyr Ile Asn
305 310 315 320
Gln Leu Lys Ala Lys Val Asp Glu Leu Glu Leu Gln Leu Ile Asp His
325 330 335
Thr Lys Lys Pro Lys Ile Val Thr Glu Ser Ser Ser Ala Asp Asn Gln
340 345 350
Ser Ala Thr Thr Ser Ser Asp Asp Gln Val Ile Lys Ala Ala Asn Pro
355 360 365
Thr Ala Ala Pro Glu Val Glu Val Lys Ile Val Gly Thr Asp Ala Met
370 375 380
Ile Arg Val Gln Ser Glu Asn Val Asp Tyr Pro Ser Ala Lys Leu Met
385 390 395 400
Ile Ala Leu Gln Asn Leu Gln Met Gln Val His His Ala Ser Ile Ser
405 410 415
Ser Val Asn His Leu Val Leu His Asp Val Val Val Arg Val Pro Gln
420 425 430
Gly Leu Ser Thr Glu Asp Glu Leu Arg Thr Ala Leu Leu Thr Ser Tyr
435 440 445
Asp Leu
450
<210> 5
<211> 51
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ggggacaagt ttgtacaaaa aagcaggctt aatggaacaa ctcgcggttt c 51
<210> 6
<211> 52
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ggggaccact ttgtacaaga aagctgggta tcttactagc tatgatttgt aa 52
<210> 7
<211> 36
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gcgccgtctc gctcgaatgg aacaactcgc ggtttc 36
<210> 8
<211> 40
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
gcgccgtctc gctcaaagcc ttactagcta tgatttgtaa 40
<210> 9
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
aagagaaaac agcagaaaac cg 22
<210> 10
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
tcaacacatg agcgaaaccc t 21
<210> 11
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
gagcatcgtg gaaaaagaag acgttc 26
<210> 12
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
gctcaacaca tgagcgaaac cctata 26
<210> 13
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
gttgattgat gtaggacaca gc 22
<210> 14
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 14
gccaaagaag atcaagcaca 20
<210> 15
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 15
tcagcattag ggcactcctt 20
Claims (10)
1. participating in regulation tomato steroid alkaloid synthesis transcription factor SlbHLH114 in improving plant steroid alkaloid content
Using, it is characterised in that: the amino acid sequence of the transcription factor SlbHLH114 is as shown in SEQ ID NO.4.
2. participating in regulation tomato steroid alkaloid synthesis transcription factor SlbHLH114 according to claim 1 is improving plant
Application in steroid alkaloid content, it is characterised in that: the nucleotide sequence such as SEQ of the transcription factor SlbHLH114
Shown in IDNO.3.
3. participating in regulation tomato steroid alkaloid synthesis transcription factor SlbHLH114 according to claim 1 is improving plant
Application in steroid alkaloid content, it is characterised in that: the plant is plant of Solanaceae.
4. participating in regulation tomato steroid alkaloid synthesis transcription factor SlbHLH114 according to claim 1 is improving plant
Application in steroid alkaloid content, it is characterised in that: the plant is tomato.
5. any one participation regulation tomato steroid alkaloid synthesis transcription factor SlbHLH114 exists according to claim 1~4
Improving the application in plant steroid alkaloid content, it is characterised in that: the steroid alkaloid is hydroxytomatidenol,
Hydroxytomatidine, δ-tomatine, β 2-tomatine, tomatidine-o-rhamnoside and
Dihydroxytomatidine-o-hexoside-o-rhamnoside, tomatidine, tomatidine derivative,
Filotomatine, γ-tomatine, tomatidine-o-hexosyl-o-pentoside,
One of Acetoxydehydrotomatine, lycoperoside A and lycoperside H or a variety of.
6. a kind of method for improving plant steroid alkaloid content, it is characterised in that: regulation tomato steroid alkaloid will be participated in and closed
It is overexpressed in plant at transcription factor SlbHLH114, the amino acid sequence such as SEQ of the transcription factor SlbHLH114
Shown in IDNO.4.
7. improving the method for plant steroid alkaloid content according to claim 6, it is characterised in that: be overexpressed in plant
Method is as follows: clone's transcription factor SlbHLH114 gene, then constructs plant expression vector, and acquisition contains transcription factor
The recombinant plant expression vector of SlbHLH114, then the recombinant plant expression vector conversion Agrobacterium tumefaciems of acquisition is obtained into engineering
Bacterium finally converts plant explant with engineering bacteria, by the culture that co-cultures, lives again, culture of rootage, turns base through positive identification acquisition
Because of plant, the as high plant of steroid alkaloid content.
8. improving the method for plant steroid alkaloid content according to claim 6, it is characterised in that: clone's transcription factor
The method of SlbHLH114 gene is as follows: using tomato cDNA as template, sequence described in SEQ ID NO.1 and SEQ ID NO.2 is to draw
Object carries out PCR amplification, and amplification obtains grand transcription factor SlbHLH114 gene.
9. improving the method for plant steroid alkaloid content according to claim 6, it is characterised in that: the building plant table
Method up to carrier is as follows: nucleotide sequence sequence as shown in SEQ ID NO.3 is connected into pBin19-E8-GW and pBin19-
35S-GW carrier and obtain.
10. according to any one of claim 6~9 method for improving plant steroid alkaloid content, it is characterised in that: described
Plant is tomato.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910847193.7A CN110526961B (en) | 2019-09-09 | 2019-09-09 | Application of transcription factor participating in regulation and control of synthesis of tomato steroid alkaloid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910847193.7A CN110526961B (en) | 2019-09-09 | 2019-09-09 | Application of transcription factor participating in regulation and control of synthesis of tomato steroid alkaloid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110526961A true CN110526961A (en) | 2019-12-03 |
| CN110526961B CN110526961B (en) | 2021-02-19 |
Family
ID=68667709
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910847193.7A Active CN110526961B (en) | 2019-09-09 | 2019-09-09 | Application of transcription factor participating in regulation and control of synthesis of tomato steroid alkaloid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110526961B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904111A (en) * | 2019-12-19 | 2020-03-24 | 西南大学 | sgRNA sequence for targeted knockout of FcMYC2 gene, CRISPR/Cas9 vector and application thereof |
| CN110938126A (en) * | 2019-12-19 | 2020-03-31 | 西南大学 | Citrus FcMYC2 gene and application of coding protein thereof in regulation and control of citrus essential oil synthesis |
| CN113061614A (en) * | 2021-03-30 | 2021-07-02 | 四川大学 | Application of tomato SlWRKY35 gene in improving content of carotenoid compounds or/and chlorophyll in tomatoes |
| CN113174376A (en) * | 2021-04-25 | 2021-07-27 | 四川大学 | Application of polyphenol oxidase and method for synthesizing flavone |
| CN115807028A (en) * | 2022-11-21 | 2023-03-17 | 海南大学 | Application of transcription factor SlDOG1 in improving content of plant steroid alkaloids |
| CN115820669A (en) * | 2022-12-12 | 2023-03-21 | 海南大学 | Application of SlGA2ox gene in regulation of toxic alkaloid content in tomato |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000046383A2 (en) * | 1999-02-05 | 2000-08-10 | Rijksuniversiteit Leiden | Method of modulating metabolite biosynthesis in recombinant cells |
| CN105592692A (en) * | 2013-06-05 | 2016-05-18 | 耶达研究及发展有限公司 | Plant with altered content of steroidal glycoalkaloids |
| US20170009249A1 (en) * | 2014-02-18 | 2017-01-12 | Vib Vzw | Means and methods for regulating secondary metabolite production in plants |
-
2019
- 2019-09-09 CN CN201910847193.7A patent/CN110526961B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000046383A2 (en) * | 1999-02-05 | 2000-08-10 | Rijksuniversiteit Leiden | Method of modulating metabolite biosynthesis in recombinant cells |
| CN105592692A (en) * | 2013-06-05 | 2016-05-18 | 耶达研究及发展有限公司 | Plant with altered content of steroidal glycoalkaloids |
| US20170009249A1 (en) * | 2014-02-18 | 2017-01-12 | Vib Vzw | Means and methods for regulating secondary metabolite production in plants |
Non-Patent Citations (6)
| Title |
|---|
| GUANGTAO ZHU等: "Rewiring of the Fruit Metabolome in Tomato Breeding", 《CELL》 * |
| NCBI REFERENCE SEQUENCE: "PREDICTED: Solanum lycopersicum transcription factor MYC2-like (LOC101264068), transcript variant X2, mRNA", 《NCBI》 * |
| PABLO D. CA´RDENAS等: "GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in the plant mevalonate pathway", 《NATURE COMMUNICATIONS》 * |
| 姚娜等: "茉莉酸信号通路中的转录因子对药用植物次生代谢调控的研究进展", 《中国中药杂志》 * |
| 王翠翠等: "茄属生物碱的研究进展", 《中国生物工程杂志》 * |
| 陶永霞等: "番茄碱的研究现状及应用前景", 《现代食品科技》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904111A (en) * | 2019-12-19 | 2020-03-24 | 西南大学 | sgRNA sequence for targeted knockout of FcMYC2 gene, CRISPR/Cas9 vector and application thereof |
| CN110938126A (en) * | 2019-12-19 | 2020-03-31 | 西南大学 | Citrus FcMYC2 gene and application of coding protein thereof in regulation and control of citrus essential oil synthesis |
| CN110938126B (en) * | 2019-12-19 | 2021-06-11 | 西南大学 | Citrus FcMYC2 gene and application of coding protein thereof in regulation and control of citrus essential oil synthesis |
| CN113061614A (en) * | 2021-03-30 | 2021-07-02 | 四川大学 | Application of tomato SlWRKY35 gene in improving content of carotenoid compounds or/and chlorophyll in tomatoes |
| CN113061614B (en) * | 2021-03-30 | 2023-04-28 | 四川大学 | Application of tomato SlWRKY35 gene in improving carotenoid compound or/and chlorophyll content of tomatoes |
| CN113174376A (en) * | 2021-04-25 | 2021-07-27 | 四川大学 | Application of polyphenol oxidase and method for synthesizing flavone |
| CN113174376B (en) * | 2021-04-25 | 2023-06-16 | 四川大学 | Application of polyphenol oxidase and method for synthesizing flavone |
| CN115807028A (en) * | 2022-11-21 | 2023-03-17 | 海南大学 | Application of transcription factor SlDOG1 in improving content of plant steroid alkaloids |
| CN115820669A (en) * | 2022-12-12 | 2023-03-21 | 海南大学 | Application of SlGA2ox gene in regulation of toxic alkaloid content in tomato |
| CN115820669B (en) * | 2022-12-12 | 2024-02-20 | 海南大学 | Application of SlGA2ox gene in regulating tomato toxic alkaloid content |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110526961B (en) | 2021-02-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110526961A (en) | Participate in the application of regulation tomato steroid alkaloid synthesis transcription factor | |
| CN102171344B (en) | The nucleotide sequence of the transcription factor of coding and regulating alkaloid synthesis and the application in improvement plant metabolism thereof | |
| KR102114493B1 (en) | Recombinant production of steviol glycosides | |
| EP3456825A1 (en) | Plant genome editing method | |
| JP6967217B2 (en) | How to make transformed plants | |
| Goh et al. | Physiological changes and anti-oxidative responses of Arabidopsis plants after acute and chronic γ-irradiation | |
| CN112969785A (en) | Cellulose synthase-like enzyme and use thereof | |
| EP2591112B1 (en) | Transgenic plants having altered dahp synthase activity | |
| CN108486136A (en) | Flavonols 3-O- glucosyltransferase MdUGT71B1 genes and its coding albumen and application | |
| CN107937414B (en) | Belladonna WRKY class transcription factor gene and its recombinant plant expression vector and application | |
| EA008669B1 (en) | A method of increasing the total or soluble carbohydrate content or sweetness of an endogenous carbohydrate by catalysing the conversion of an endogenous sugar to an alien sugar | |
| CN107190015B (en) | Application of corn glycosyltransferase gene UFGT2 in improving flavone content in plant | |
| CN106749580B (en) | Plant salt tolerance GAP-associated protein GAP TaPUB15-D and its encoding gene and application | |
| CN109402164B (en) | Method for overexpression of squalene epoxidase gene in alfalfa and application | |
| US20160002664A1 (en) | Generation of crops resistant to cereal rust disease by silencing of specific pathogen genes | |
| CN109706169A (en) | Rice grain shape GAP-associated protein GAP and its encoding gene and application | |
| JPWO2006057306A1 (en) | Gramineae plant with improved stress tolerance and / or productivity, and method for producing the same | |
| JP6300377B2 (en) | Agrobacterium with high efficiency of gene transfer into plants | |
| TW201035315A (en) | Application of ERF genes from Bupleurum kaoi | |
| CN113755508B (en) | Paraquat resistance gene EiKCS and application thereof | |
| CN110452896A (en) | A kind of plant anti-insect GAP-associated protein GAP OsPAL6 and OsPAL8 and its encoding gene and application | |
| CN114409752B (en) | Application of GmUVR8 gene family in improving isoflavone content of plants | |
| CN116286705B (en) | Broussonetia papyrifera homocysteine thiomethyltransferase gene BpHMT2 and application thereof | |
| CN115948423B (en) | Application of SNAC1 gene in improving resistance of rice to brown planthoppers | |
| CN108085326A (en) | A kind of application of switchgrass adenosyl homocysteine in terms of changing lignin monomer and improving cell wall degradation efficiency |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |