CN110468090B - Microorganism and use thereof - Google Patents

Abstract

The invention provides a microorganism. The flux ratio of MEP pathway to MVA pathway contained in the microorganism was 4:3. The energy and the reduction equivalent in the microbial metabolic pathway are relatively balanced, which is beneficial to the production of the farnesene and the yield of the farnesene is high.

Description

Microorganism and use thereof

Technical Field

The present invention relates to the field of bioengineering, in particular to microorganisms and their use, more particularly to microorganisms, methods of preparing farnesene and methods of preparing microorganisms.

Background

Farnesene was originally isolated from apple trees and plays an important role in plant defense. As the modified starch is an important chemical raw material, the modified starch has wide market value in the fields of emerging aviation fuels, rubber, natural vitamin E and the like, and is widely paid attention in recent years.

Farnesene is very low in plant content and cannot be applied to the market in a way of extracting natural products. Although the chemical synthesis method has the advantages of easily available and cheap raw materials, mild reaction conditions, high reaction rate, easy separation of products from a reaction system and the like, the quality, the safety and the application range of the products are limited due to the fact that the three-dimensional configuration of the beta-farnesene double bond is difficult to control and chemical reagent residues with different degrees are remained in the synthesis process. The microbial fermentation method mainly utilizes the biological metabolism of microorganisms to convert cheap raw materials such as glucose and the like into farnesene, and the method is free from the influence of factors such as seasons, regions, weather and the like, and is easy to obtain raw materials, short in production period, simple in process operation, low in cost, controllable in product quality, easy to purify and high in safety, and less in environmental pollution, so that the farnesene is produced by microorganisms in a feasible mode.

However, further studies are needed to increase the yield of beta-farnesene produced by microorganisms.

Disclosure of Invention

The present application is made based on the discovery and recognition by the inventors of the following facts and problems:

the biggest problem of microbial fermentation is how to increase the yield, and the current pathway for synthesizing nisene mainly comprises the MEP pathway and the MVA pathway, and reference is made to FIG. 1. On this basis, farnesene can be produced by expressing farnesene synthase, see fig. 2. However, how these approaches are matched to achieve the more desirable effect is not known at present. Based on the above problems, the inventors constructed corresponding microorganisms by optimizing the flux ratio of the MEP pathway and the MVA pathway. The energy and the reduction equivalent in the microbial metabolic pathway are relatively balanced, which is beneficial to the production of the farnesene and the yield of the farnesene is high.

For this purpose, in a first aspect of the invention, the invention proposes a microorganism. According to an embodiment of the invention, the flux ratio of MEP pathway to MVA pathway contained in the microorganism is 4:3. Among them, the MEP pathway and MVA pathway are two conventional pathways for producing farnesene using microorganisms, and a specific process can be seen in fig. 1. The flux ratio refers to the ratio of carbon atoms entering the two metabolic pathways, for example, the number of carbon atoms entering the MEP pathway is 4, the number of carbon atoms entering the MVA pathway is 3, the flux ratio of the two metabolic pathways is 4:3, and the flux ratio of the present invention is not particularly limited by the kind of carbon source. The inventors found that the flux ratio of MEP pathway to MVA pathway contained in the microorganism is 4:3, and the energy and reduction equivalent in the microbial metabolic pathway are relatively balanced, which is beneficial to the production of farnesene and the yield of farnesene is high.

According to an embodiment of the present invention, the above microorganism may further include at least one of the following additional technical features:

according to an embodiment of the invention, the microorganism is E.coli, yeast or Streptomyces. The escherichia coli production period is short, the yeast fermentation method is mature, meanwhile, the inventor overcomes the technical difficulties of difficult genetic operation, low probability of obtaining positive binders and the like when streptomyces is introduced, and the yield and the efficiency of producing farnesene by utilizing the microorganism of the embodiment of the invention are further improved.

In a second aspect of the invention, the invention provides a method of preparing farnesene. According to an embodiment of the invention, the method comprises: the above microorganism is subjected to fermentation treatment under a suitable microorganism fermentation condition so as to obtain farnesene. By using the method provided by the embodiment of the invention, the farnesene can be obtained with high yield and high efficiency, and the farnesene has high purity.

In a third aspect of the present invention, the present invention provides a method for preparing the microorganism described above. According to an embodiment of the invention, the method comprises: introducing a first plasmid, a second plasmid and a third plasmid into escherichia coli, wherein the first plasmid carries ERG10, ERG12, tHMG1, erg13, ERG8, MVD1 and ERG20 genes, the copy number of the ERG10, ERG12, tHMG1, erg13, ERG8, MVD1 and ERG20 genes in the first plasmid is 1, the second plasmid carries dxs, ERG20, idi and tHMG1 genes, the copy number of the dxs and ERG20 genes in the second plasmid is 1, the copy number of the idi and tHMG1 genes in the second plasmid is 3, the copy number of the third plasmid carries J1-018-A genes, and the copy number of the J1-018-A genes in the third plasmid is 5. The inventor finds that after the plasmids with the structure and the copy number are introduced into the microorganism, the flux ratio of the MEP channel to the MVA channel in the microorganism is infinitely close to the optimal ratio of 4:3, the microorganism prepared by the method according to the embodiment of the invention has high amplification rate, the energy and the reduction equivalent in the metabolic channel of the microorganism are relatively balanced, the farnesene can be obtained with high yield and high efficiency, and the purity of the farnesene is high.

In a fourth aspect of the present invention, the present invention provides a method for preparing the microorganism described above. According to an embodiment of the invention, the method comprises: introducing a fourth plasmid, a fifth plasmid, a sixth plasmid, a seventh plasmid, an eighth plasmid, a ninth plasmid and a tenth plasmid into yeast, wherein the fourth plasmid carries ERG10, ERG12 and tHMG1 genes, the copy number of the ERG10, ERG12 and tHMG1 genes in the fourth plasmid is 1, the fifth plasmid carries ERG13, ERG8 and MVD1 genes, the copy number of the ERG13, ERG8 and MVD1 genes in the fifth plasmid is 1, the sixth plasmid carries ERG20 and J1-018-A genes, the copy number of the ERG20 genes in the sixth plasmid is 1, the copy number of the J1-018-A genes in the sixth plasmid is 2, the copy number of the seventh plasmid carries dxs and ERG20 genes, the dxs and ERG20 genes in the seventh plasmid is 1, the eighth plasmid carries idi genes in the eighth plasmid is 3, the copy number of the J1-018-A genes in the eighth plasmid is 3, and the copy number of the HMG 1-A genes in the ninth plasmid is 3. The inventor finds that after the plasmids with the structure and the copy number are introduced into the microorganism, the flux ratio of the MEP channel to the MVA channel in the microorganism is infinitely close to the optimal ratio of 4:3, the microorganism prepared by the method according to the embodiment of the invention has high amplification rate, the energy and the reduction equivalent in the metabolic channel of the microorganism are relatively balanced, the farnesene can be obtained with high yield and high efficiency, and the purity of the farnesene is high.

In a fifth aspect of the present invention, the present invention provides a method for preparing the microorganism described above. According to an embodiment of the invention, the method comprises: introducing an eleventh plasmid into strain a to obtain strain B, wherein strain a is a streptomycete strain; introducing a twelfth plasmid into the strain B so as to obtain the microorganism; wherein the eleventh plasmid carries ERG10, ERG12, tHMG1, erg13, ERG8, MVD1 and ERG20 genes, the copy number of the ERG10, ERG12, tHMG1, erg13, ERG8, MVD1 and ERG20 genes on the eleventh plasmid is 1, the twelfth plasmid carries dxs, ERG20, idi, tHMG1 and J1-018-A genes, the copy number of the dxs and ERG20 genes on the twelfth plasmid is 1, and the copy number of the idi, tHMG1 and J1-018-A genes on the twelfth plasmid is 3. The inventor finds that after the plasmids with the structure and the copy number are introduced into the microorganism, the flux ratio of the MEP channel to the MVA channel in the microorganism is infinitely close to the optimal ratio of 4:3, the microorganism prepared by the method according to the embodiment of the invention has high amplification rate, the energy and the reduction equivalent in the metabolic channel of the microorganism are relatively balanced, the farnesene can be obtained with high yield and high efficiency, and the purity of the farnesene is high.

Drawings

FIG. 1 is a schematic illustration of the MEP pathway and MVA pathway for the production of farnesene pathway precursors according to an embodiment of the invention; and

FIG. 2 is a schematic representation of the synthetic pathway of farnesene in a microorganism according to an embodiment of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings. The embodiments described below by referring to the drawings are illustrative and intended to explain the present invention and should not be construed as limiting the invention.

EXAMPLE 1 recombinant E.coli with optimal collocation of MVA and MEP pathways

Isopentyl diphosphate (IPP) and dimethylallyl Diphosphate (DMAPP) are two common substrates for isoprenoid biosynthesis. The two isoprenoid pathways, the Methyl Erythritol Phosphate (MEP) pathway and the Mevalonate (MVA) pathway, are responsible for IPP and DMAPP synthesis in nature. The MEP pathway is more efficient than the MVA pathway in converting carbon sources (e.g., glucose, glycerol) to isoprenoids. However, energy and reducing power are consumed in this process, and thus additional energy molecules ATP and reducing equivalent NADPH are required to be supplied from other pathways. At the same time, the MVA pathway, which overproduces isoprenoids, produces an excess of the reducing equivalent NADH. How does the MVA pathway be used to provide the reducing equivalent needed for the MEP pathway? By altering the flux of the MEP pathway and the MVA pathway, the construction of a metabolic pathway with a more balanced two pathways would be more beneficial to farnesene production.

If glucose is used as the sole carbon source to provide 1 IPP/DMAPP, 4 excess NADH is produced by the MVA pathway, consuming 1.5 glucose; through the MEP pathway, 1 glucose plus 2 NADPH and 3ATP are required per IPP/DMAPP. Additional ATP can be provided by oxidative phosphorylation of excess NADH (1 NADH. Apprxeq.3 ATP). Thus, when glucose is used, the optimum ratio of MEP to MVA is about 4:3, the energy and reducing equivalent of the combined pathway are relatively balanced and 1.215 glucose is utilized for each IPP/DMAPP.

Therefore, the inventor constructs recombinant escherichia coli according to the theoretical content, firstly, the ylinE and poxB genes in escherichia coli BL21 strain are knocked out, protein sequences of the genes coded in escherichia coli BL21 with the number of CP001509.3 in a genebank library are ACT42701.1 and ACT42771.1 in sequence, and the two genes are knocked out, so that the escherichia coli MEP pathway can be more efficient, and the escherichia coli J1-018-6 is constructed. The related proteins ERG10, ERG12, tHMG1, erg13, ERG8, MVD1 and ERG20 (the genes are coded in genebank under the numbers 856079, 855248, 854900, 854913, 855260, 855779, 853272 except 4-1659 bp) in the MVA pathway of Saccharomyces cerevisiae were cloned on pBBRIMCS/p15A according to the Gibson method, and the positive clone was sequenced under the name pJ1-018-8. The plasmid controls gene expression as a medium-strength lac promoter, and the replicon of the plasmid as a p15A replicon.

Plasmid pJ1-018-9 contains 1 copy of dxs gene (ACT 42267.1 in E.coli BL21, genebank accession number CP 001509.3), 1 copy of ERG20 gene, 3 copies of idi gene (said gene encoding accession number 855986 in genebank), 3 copies of tHMG1 gene, which were cloned on pBBR1MCS-2 plasmid by Gibson method, and the positive clone was sequenced under the designation pJ1-018-9. The plasmid controls gene expression to be a medium-strength lac promoter, and the replicon of the plasmid is pBBR1MCS replicon.

Plasmid pJ1-018-10 contains 5 copies of the J1-018-A gene, and the 5J 1-018-A genes were cloned on pET21a plasmid using the Gibson method, and the positive clone was sequenced under the designation pJ1-018-10. The plasmid controls gene expression to be a strong promoter T7, and the replicon of the plasmid is a pBBR3 high copy replicon. The J1-018-A gene sequence is shown in SEQ ID NO: 1.

ATGCCTCACAAGCACGTTCCTCTTAGACCAGTCAAGTTGACATTTGATCCTGTAGGATCAAACACCCTAGGTGTGCCAACCTTGGACTTTGAGTCTCTGTTCCGGGAAGACAGCGTCTCTGAGGATGCCCCTCTTGTTATCTACCCAGAGGATATGGGTGTCCCATGGAACACCTCTCTTCCTTGGACCAGACAATCCAAGTTCTGGGCTTACGCCGAGGCAGCTGGATATGAAATGGCCAACGGAATCAGCCTTGACAAGGCATCAGAGCGTGGCACACTACCCATGGAGTTGATGGATGAGCGTCGCAAGTGGAAGATTGATGAGCTAGTTGAGGATGCCATCTCTTGCTGTGCTTATCTTTACCCTACATCATCTCCTACCAGATTGGCGTTGTTGACCCAGTCTGTTCTGCTTCTATTCCTCCACGACGATGTTATTGAGCGAGGAGCTACTCAAAACGAAACCACAGTGGTAGACGAATTTCTTAGCATGGCTCCCAAGAACAGGC ATCTTAAGAAATTCTGGTCAGACGTATTGGAATGTGATCCCGTCCTTGGACCTGATCTGCTTTATGCTATCCATGCTTTCGTCCGTGATGGTCGTGTAAAGTCACCCTTTAAGCAGGATCACTATGCCACATTGGCTGATTACATGCTTTACCGTCGCAATGATGTTGGCAAGACATTTATGATTGCAGCTATCCGCTTCGGCTCTGGCGTGCAACAAACACGCGAAGAACTTGCTCCCTTTGACGAGCTTGCTGATCTTTACGTCAGACACTCAATTCTTATCAACGATCTCTACTCGTATGATAAGGAGGTGCACGAGGTCAAGACTATCGACGCGTCCATCGTGAACGCAGTTGCTGTCACAGAGCAGCTCCTTTCCGTGTCGCCTGACCTGGCCAAGAACTTAACCAGAGCTATTACCTTTGACATGGAGAAGGAGTTTTACGGCATTTGTGAGAAGTTTATGCACAGCCCTGATATCAACGATCGCCAGCGCGTGTTCGTTACTGCGCTCTTTGATGCGTTGACAGGCAATATCTTCCATTCTGCTACTTTGAGCAGATACGTTCGTCACGGCGAGAGACCACTTCCTTGCAAGTGTTAG(SEQ ID NO：1)。

Plasmids pJ1-018-8, pJ1-018-9 and pJ1-018-10 were introduced into E.coli J1-018-6 to construct E.coli J1-018-7, and the strains were subjected to shake flask fermentation according to the fermentation method in the literature (Zhu F, et al, 2014.In vitro reconstitution of mevalonate pathway and targeted engineering of farnesene overproduction in Escherichia coli.Biotechnol Bioeng.111 (7): 1396-405.) and the results showed that the shake flask yield of farnesene reached 2.9 g/L48 hours after induction, indicating that farnesene could be produced more efficiently by the MVA and MEP pathway collocation.

EXAMPLE 2 recombinant yeasts with optimal matching of MVA and MEP pathways

Meanwhile, the inventor also constructs recombinant saccharomyces cerevisiae according to the theoretical content, and plasmids pJ1-018-11 contain ERG10, ERG12 and tHMG1 in the MVA pathway of the saccharomyces cerevisiae, and the genes are obtained through PCR and respectively control the expression of genes, namely pGAL1, pGAL7 and pGAL10 promoters. The fragments are sequentially connected by designing primers, a 50bp overlapping sequence is formed between two adjacent genes, 1.5kb sequences homologous to the integration site are arranged on two sides of the target fragment, the fragments are cloned on a pRS423 vector by using a DNA assembly method, a NotI enzyme cutting site is arranged between the fragments and the vector, and the sequencing of the positive clone is named pJ1-018-11.

Plasmid pJ1-018-12 contains Erg13, ERG8 and MVD1 in the Saccharomyces cerevisiae MVA pathway, these genes are obtained by PCR and control the expression of the genes, pGAL1, pGAL7 and pGAL10 promoters, respectively. The fragments are sequentially connected by designing primers, a 50bp overlapping sequence is formed between two adjacent genes, 1.5kb sequences homologous to the integration site are arranged on two sides of the target fragment, the fragments are cloned on a pRS424 vector by using a DNA assembly method, a NotI enzyme cleavage site is contained between the fragments and the vector, and the sequencing of the positive clone is named pJ1-018-12.

Plasmid pJ1-018-13 contains ERG20 in the Saccharomyces cerevisiae MVA pathway and 2 copies of the J1-018-A gene, which are obtained by PCR and control the gene expression of pGAL1, pGAL7 and pGAL10 promoters, respectively. The fragments are sequentially connected by designing primers, a 50bp overlapping sequence is formed between two adjacent genes, 1.5kb sequences homologous to the integration site are arranged on two sides of the target fragment, the fragments are cloned on a pRS425 vector by using a DNA assembly method, a NotI enzyme cleavage site is contained between the fragments and the vector, and the sequencing of the positive clone is named pJ1-018-13.

The plasmid pJ1-018-14 contains 1 copy of dxs gene and 1 copy of ERG20 gene, which are obtained by PCR, and pGAL1 and pGAL10 promoters respectively control gene expression. The fragments are sequentially connected by designing primers, a 50bp overlapping sequence is formed between two adjacent genes, 1.5kb sequences homologous to the integration site are arranged on two sides of the target fragment, the fragments are cloned on a pRS423 vector by using a DNA assembly method, a NotI enzyme cutting site is arranged between the fragments and the vector, and the sequencing of the positive clone is named pJ1-018-14.

Plasmid pJ1-018-15 contains 3 copies of the idi genes, which are obtained by PCR and control the expression of the genes pGAL1, pGAL7 and pGAL10 promoters, respectively. The fragments are sequentially connected by designing primers, a 50bp overlapping sequence is formed between two adjacent genes, 1.5kb sequences homologous to the integration site are arranged on two sides of the target fragment, the fragments are cloned on a pRS424 vector by using a DNA assembly method, a NotI enzyme cleavage site is contained between the fragments and the vector, and the sequencing of the positive clone is named pJ1-018-15.

The plasmid pJ1-018-16 contains 3 copies of the tHMG1 gene, which are obtained by PCR and control the expression of the genes pGAL1, pGAL7 and pGAL10 promoters, respectively. The fragments are sequentially connected by designing primers, a 50bp overlapping sequence is formed between two adjacent genes, 1.5kb sequences homologous to the integration site are arranged on two sides of the target fragment, the fragments are cloned on a pRS425 vector by using a DNA assembly method, a NotI enzyme cleavage site is contained between the fragments and the vector, and the sequencing of the positive clone is named pJ1-018-16.

The plasmid pJ1-018-17 contains 3 copies of the J1-018-A gene, which are obtained by PCR and control the expression of the pGAL1, pGAL7 and pGAL10 promoters, respectively. The fragments are sequentially connected by designing primers, a 50bp overlapping sequence is formed between two adjacent genes, 1.5kb sequences homologous to the integration site are arranged on two sides of the target fragment, the fragments are cloned on a pRS423 vector by using a DNA assembly method, a NotI enzyme cutting site is arranged between the fragments and the vector, and the sequencing of the positive clone is named pJ1-018-17.

The seven plasmids pJ1-018-11, pJ1-018-12, pJ1-018-13, pJ1-018-14, pJ1-018-15, pJ1-018-16 and pJ1-018-17 are tangentially cut by NotI enzyme and then introduced into Saccharomyces cerevisiae INVSCI to construct Saccharomyces cerevisiae J1-018-8, and the specific method is as follows: sucking a proper amount of glycerol bacteria into a PA bottle containing 5mL of seed culture medium, wherein the seed culture medium comprises the following formula: peptone (20 g/L), yeast powder (10 g/L), glucose (20 g/L). Shaking up the primary seed solution by a shaking table at 30 ℃, culturing overnight (generally for 14-18 h), and transferring the primary seed solution into a 250mL shaking bottle containing 50mL fermentation medium according to the initial OD of 0.1, wherein the formula of the fermentation medium is as follows: peptone (20 g/L), yeast powder (10 g/L), glucose (10 g/L), galactose (10 g/L) are transferred and then covered with 20% of organic phase (n-dodecane or isopropyl myristate) and placed on a shaking table at 30 ℃ to start shaking flask fermentation. The results show that the flask yield of farnesene reaches 3.5 g/L72 hours after transfer, indicating that farnesene can be produced more efficiently by using MVA and MEP pathways in combination.

EXAMPLE 3 recombinant Streptomyces that optimally match the MVA and MEP pathways

From the above, the inventors cloned the related proteins ERG10, ERG12, tHMG1, erg13, ERG8, MVD1 and ERG20 in the Saccharomyces cerevisiae MVA pathway onto pIB139 according to the Gibson method when the flux ratio of MEP pathway to MVA pathway was 4:3, and the positive clone sequencing was named pJ1-018-26. The plasmid controls gene expression to be a low-strength ermE promoter, contains attP sites and Int integrase and is resistant to arabidopsis.

The resistance gene of plasmid pSET152 (Qian Liu.,2016.Development of Streptomyces sp.FR-008as an emerging chassis.Synth Syst Biotechnol.1 (3): 207-214.) was replaced with the resistance gene tsr of thiostrepton using PCR-targeting (Gust.B., 2003.PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc Natl Acad Sci U S A.100 (4): 1541-1546.), the clone designated pJ1-018-27. The ermE promoter, 1 copy of dxs gene, 1 copy of ERG20 gene, the SPL44 promoter (Qian Liu.,2016.Development of Streptomyces sp.FR-008as an emerging chassis.Synth Syst Biotechnol.1 (3): 207-214.) and 3 copies of idi gene, the SPL39 promoter (Qian Liu.,2016.Development of Streptomyces sp.FR-008as an emerging chassis.Synth Syst Biotechnol.1 (3): 207-214.) and 3 copies of tHMG1 gene and 3 copies of J1-018-A gene were cloned on pJ1-018-27 plasmid by the Gibson method by sequentially linking these gene fragments by designing primers and forming a 50bp overlapping sequence between the adjacent two genes, and these genes were cloned on pJ1-018-27 by the Gisbson method, the positive clone sequencing being designated pJ1-018-28. The plasmid controls the expression of dxs and ERG20 genes to be a weak promoter ermE, controls the expression of idi genes to be a strong promoter SPL44, controls the expression of tHMG1 and J1-018-A genes to be a strong promoter SPL39, contains attP sites and Int integrase and is thiostrepton resistance.

Plasmid pJ1-018-26 was transferred into Streptomyces albus J1074 by the method reported in the literature for conjugation transfer (Qian Liu.,2016.Development of Streptomyces sp.FR-008as an emerging chassis.Synth Syst Biotechnol.1 (3): 207-214), positive zygotes were selected for verification, the zygote that verified successfully was designated J1-018-14, and plasmid pJ1-018-28 was transferred into J1-018-14 by the method for conjugation transfer, and the positive zygote obtained was designated J1-018-15.

Culturing J1-018-15 strain with thallus Porphyrae, culturing seed in TSB culture medium at 30deg.C under 220rpm for two days, transferring new TSB culture medium containing 20% IPM cover according to 10% inoculum size, and culturing for 3 days. The results showed that farnesene production was detected in strain J1-018-15 at a yield of 2.8g/L and continued to increase in the subsequent stages. This yield is the reported yield of the first time that the process for synthesizing nisin in Streptomyces at present.

In the description of the present specification, a description referring to terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms are not necessarily directed to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, the different embodiments or examples described in this specification and the features of the different embodiments or examples may be combined and combined by those skilled in the art without contradiction.

While embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives and variations may be made to the above embodiments by one of ordinary skill in the art within the scope of the invention.

SEQUENCE LISTING

<110> wuhanzhen biotechnology Co., ltd

<120> microorganism and use thereof

<130> PIDC3182011

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 1116

<212> DNA

<213> Artificial

<220>

<223> J1-018-A Gene sequence

<400> 1

atgcctcaca agcacgttcc tcttagacca gtcaagttga catttgatcc tgtaggatca 60

aacaccctag gtgtgccaac cttggacttt gagtctctgt tccgggaaga cagcgtctct 120

gaggatgccc ctcttgttat ctacccagag gatatgggtg tcccatggaa cacctctctt 180

ccttggacca gacaatccaa gttctgggct tacgccgagg cagctggata tgaaatggcc 240

aacggaatca gccttgacaa ggcatcagag cgtggcacac tacccatgga gttgatggat 300

gagcgtcgca agtggaagat tgatgagcta gttgaggatg ccatctcttg ctgtgcttat 360

ctttacccta catcatctcc taccagattg gcgttgttga cccagtctgt tctgcttcta 420

ttcctccacg acgatgttat tgagcgagga gctactcaaa acgaaaccac agtggtagac 480

gaatttctta gcatggctcc caagaacagg catcttaaga aattctggtc agacgtattg 540

gaatgtgatc ccgtccttgg acctgatctg ctttatgcta tccatgcttt cgtccgtgat 600

ggtcgtgtaa agtcaccctt taagcaggat cactatgcca cattggctga ttacatgctt 660

taccgtcgca atgatgttgg caagacattt atgattgcag ctatccgctt cggctctggc 720

gtgcaacaaa cacgcgaaga acttgctccc tttgacgagc ttgctgatct ttacgtcaga 780

cactcaattc ttatcaacga tctctactcg tatgataagg aggtgcacga ggtcaagact 840

atcgacgcgt ccatcgtgaa cgcagttgct gtcacagagc agctcctttc cgtgtcgcct 900

gacctggcca agaacttaac cagagctatt acctttgaca tggagaagga gttttacggc 960

atttgtgaga agtttatgca cagccctgat atcaacgatc gccagcgcgt gttcgttact 1020

gcgctctttg atgcgttgac aggcaatatc ttccattctg ctactttgag cagatacgtt 1080

cgtcacggcg agagaccact tccttgcaag tgttag 1116

Claims (4)

1. A method of preparing a microorganism, comprising:

introducing the first plasmid, the second plasmid and the third plasmid into E.coli,

wherein the first plasmid carriesERG10、ERG12、tHMG1、Erg13、ERG8、MVD1and ERG20Genes of the order ofERG10、ERG12、tHMG1、Erg13、ERG8、MVD1and ERG20The copy number of the gene on the first plasmid is 1,

the second plasmid carriesdxs、ERG20、idiand tHMG1Genes of the order ofdxsand ERG20The copy number of the gene on the second plasmid is 1，The saididiand tHMG1The copy number of the gene on the second plasmid is 3,

the third plasmid carriesJ1-018-AGenes of the order ofJ1-018-AThe gene sequence is shown in SEQ ID NO:1, saidJ1-018-AThe copy number of the gene on the third plasmid is 5;

the flux ratio of MEP pathway to MVA pathway contained in the microorganism is 4:3.

2. A method of preparing a microorganism, comprising:

introducing the fourth plasmid, fifth plasmid, sixth plasmid, seventh plasmid, eighth plasmid, ninth plasmid and tenth plasmid into yeast,

wherein the fourth plasmid carriesERG10、ERG12and tHMG1Genes of the order ofERG10、ERG12and tHMG1The copy number of the gene on the fourth plasmid is 1,

the fifth plasmid carriesErg13、ERG8and MVD1Genes of the order ofErg13、ERG8and MVD1The copy number of the gene on the fifth plasmid is 1,

the sixth plasmid carriesERG20and J1-018-AGenes of the order ofERG20Copy number of Gene in the sixth plasmidIs 1, saidJ1-018-AThe copy number of the gene on the sixth plasmid is 2,

the seventh plasmid carriesdxsand ERG20The copy number of the genes dxs and ERG20 on the seventh plasmid is 1,

the eighth plasmid carriesidiGenes of the order ofidiThe copy number of the gene on the eighth plasmid is 3,

the ninth plasmid carriestHMG1Genes of the order oftHMG1The copy number of the gene on the ninth plasmid is 3,

the tenth plasmid carriesJ1-018-AGenes of the order ofJ1-018-AThe gene sequence is shown in SEQ ID NO:1, saidJ1-018-AThe copy number of the gene on the tenth plasmid is 3;

the flux ratio of MEP pathway to MVA pathway contained in the microorganism is 4:3.

3. A method of preparing a microorganism, comprising:

introducing an eleventh plasmid into strain a to obtain strain B, wherein strain a is a streptomycete strain;

introducing a twelfth plasmid into the strain B so as to obtain the microorganism;

wherein the eleventh plasmid carriesERG10、ERG12、tHMG1、Erg13、ERG8、MVD1and ERG20Genes of the order ofERG10、ERG12、tHMG1、Erg13、ERG8、MVD1and ERG20The copy number of the gene on the eleventh plasmid is 1,

the twelfth plasmid carriesdxs、ERG20、idi、tHMG1and J1-018-AGenes of the order ofJ1-018-AThe gene sequence is shown in SEQ ID NO:1, saiddxsand ERG20The copy number of the gene on the twelfth plasmid is 1, theidi、tHMG1and J1-018-AThe copy number of the gene on the twelfth plasmid is 3;

the flux ratio of MEP pathway to MVA pathway contained in the microorganism is 4:3.

4. A process for preparing farnesene comprising: fermenting the microorganism prepared by the method of any one of claims 1 to 3 under suitable microorganism fermentation conditions to obtain farnesene.

Images