CN109609424B - Escherichia coli for producing farnesene - Google Patents

Abstract

The β -farnesene producing strain is constructed through genetic engineering, is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No. 16709. the β -farnesene producing strain can realize the effective accumulation of β -farnesene in fermentation liquor through fermentation, has the β -farnesene yield of 250 mg/L and has industrial prospect.

Description

Escherichia coli for producing farnesene

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a genetic engineering production strain for producing β -farnesene with high yield.

Background

When the aphid is frightened, an aphid anti- β -farnesene (E- β -farnesene, E β F or EBF) can be firstly separated and identified in 1972 by Bowers, et al, Francis et al, find that EBF is the main or only component of 16 aphid pheromones (Bowers et al, 1972; Francis et al, 2005). when the pheromone is applied to the field, the density of aphids in a certain range can be controlled within a threshold value, at the moment, the influence of pests and diseases on crops is not large, E β F is not only present in the warning hormone, but also one of a plurality of plant secondary metabolites, E β F is rich in a plurality of plants, high-concentration special essential oil can be obtained by classification and purification, such as Lamiaceae hemizygie, when the aphid is also present in the warning hormone, E β F is also one of a plurality of plant secondary metabolites, when the plant is rich in E387 2F, the special essential oil can be obtained by classification and purification, high-concentration special essential oil can be obtained by classification and purification, such as a high-concentration special essential oil, the aphid is obtained by using the biological pesticide, and the plant pesticide of the plant origin of the plant, such as the aphid has high-protecting effect of aphid, the aphid (EBF, the aphid is high-protecting plant-controlling the aphid, the plant-origin of the aphid is similar to the aphid, the aphid is similar to the plant-origin of the aphid, the aphid-origin of the aphid, the plant-origin of the aphid is similar to the plant-origin of the aphid, the plant-origin of the plant-origin.

In addition, β -farnesene has found many applications in the fields of chemical industry and medicine, such as vitamin E synthesis, besides the field of pesticides, and has a wide market value, and has received much attention in recent years.

The biggest bottleneck of the microbial fermentation method is that the expression level of enzymes related to the biosynthesis of farnesene in microbial cells is low, so that the construction of engineering bacteria which can synthesize β -farnesene at a high level and are suitable for industrial application is the key to industrialization.

Disclosure of Invention

In order to overcome the defect of low fermentation level of the conventional β -farnesene production strain, the invention utilizes a genetic engineering technology to transform escherichia coli producing isoprene, and obtains a high-yield β -farnesene production strain by enhancing genes related to β -farnesene production and replacing isoprene branch metabolic pathways.

Accordingly, a first object of the present invention is to provide an β -farnesene-producing strain.

The second purpose of the invention is to provide the application of the β -farnesene producing strain in producing β -farnesene.

It is a third object of the present invention to provide a method for producing β -farnesene.

In order to achieve the above object, the present invention systematically studied and screened genes related to the β -farnesene metabolic pathway in E.coli, and

designing a gene engineering bacteria construction and screening scheme which comprises the following steps:

A. constructing a plasmid PHGFH comprising petH, petF, ispG, ispH, replication region p15A gene;

constructing plasmid PAGEs which comprise mvaE, mvaS, fldA, ispG and replicon repA genes;

constructing a plasmid pAKF containing escherichia coli-derived ispA, methanosarcina mazeri-derived mvaK (the gene is described in Chen Yang, et al, Metabolic engineering.37(2016) 79-91), codon-optimized bfs (β -farnesene synthase gene ) with a sequence of SEQ ID NO:1, and a replicon ColE1 gene;

B. co-transforming the plasmids PHGFH, PAGEs and pAKF constructed in step A into E.coli, preferably E.coli capable of producing isoprene, to obtain positive clones containing genes mvaE, mvaS, mk, pmk, pmd, idi, ispA and bfs, wherein the E.coli capable of producing isoprene contains genes mk, pmk, pmd and idi of mevalonate pathway;

C. and B, screening out a strain for producing β -farnesene from the positive clone constructed in the step B.

Preferably, the isoprene producing E.coli strain described in step B is strain CIBTS1758 described in the literature (Synergy beta methylenetetrahydrofolate phosphate pathway and mevalonate pathway for isoprene production in Escherichia coli Chen Yang, et al, Metabolic Engineering,37(2016) 79-91).

Through the construction of the genetic engineering, a bacterial strain with high yield of β -farnesene is screened out and is preserved in the China general microbiological culture Collection center with the preservation number of CGMCC No. 16709.

The constructed genetically engineered bacterium CGMCC No.16709 contains related genes mvaE, mvaS, mk, pmk, pmd and idi of mevalonate pathway, related gene ispA synthesized by farnesene and bfs (β -farnesene synthase gene ) with the sequence of SEQ ID NO.1, wherein the gene ispA replaces the original ispS gene in escherichia coli CIBTS1758 for producing isoprene.

According to the second aspect of the invention, the application of the genetically engineered bacterium CGMCC No.16709 in the production of β -farnesene is provided.

In one embodiment, β -farnesene is produced by fermenting the β -farnesene-producing strain described above.

The medium used in the fermentation may be any medium suitable for growth and fermentation of Escherichia coli.

In a preferred embodiment, the β -farnesene-producing strain is fermented by a seed culture stage and a fermentation stage (production fermentation stage), wherein the seed culture medium and the production fermentation medium are used in the two stages, respectively, and may be different.

Preferably, the seed medium is, for example, L B medium, which may comprise 100. mu.g/ml ampicillin, 34. mu.g/ml chloramphenicol and 100. mu.g/ml spectinomycin the seed amplification medium is, for example, V7S medium, which may comprise 100. mu.g/ml ampicillin, 34. mu.g/ml chloramphenicol and 100. mu.g/ml spectinomycin the production fermentation medium is, for example, V7E medium, which may comprise 100. mu.g/ml ampicillin, 34. mu.g/ml chloramphenicol and 100. mu.g/ml spectinomycin and 0.1mM IPTG.

The V7S culture medium comprises glucose 10 g/L, yeast powder 5 g/L0.1.1M/L, (NH)₄)₂SO₄5g/L，Na₂HPO₄1g/L，KH₂PO₄0.4g/L，MgSO₄0.5g/L，CaCl₂·2H₂O0.1 g/L, vitamin B12 mg/L, 100 times of trace element solution (citric acid monohydrate 10 g/L)₄·7H₂O 2g/L,FeSO₄·7H₂O 0.5g/L,ZnSO₄·7H₂O0.2g/L,CuSO₄·5H₂O 0.05g/L,0.05g CoCl₂·6H₂O,Na₂MoO₄·2H₂O 0.05g/L)。

The V7E culture medium comprises glucose 5 g/L, yeast powder 1 g/L0.1M/L, (NH)₄)₂SO₄5g/L，Na₂HPO₄1g/L，KH₂PO₄0.4g/L，MgSO₄0.5g/L，CaCl₂·2H₂O0.1 g/L, vitamin B12 mg/L, 100 times of trace element solution (citric acid monohydrate 10 g/L)₄·7H₂O 2g/L,FeSO₄·7H₂O 0.5g/L,ZnSO₄·7H₂O0.2g/L,CuSO₄·5H₂O 0.05g/L,0.05g CoCl₂·6H₂O,Na₂MoO₄·2H₂O0.05 g/L). the β -farnesene producing strain CGMCC No.16709 constructed by the invention can realize the effective accumulation of β -farnesene in fermentation liquor through fermentation, and the yield of β -farnesene is up to 10 mg/L, thus having industrial application prospect.

The latin scientific name of the β -farnesene high-yield genetic engineering bacteria constructed by the invention is Escherichia coli, the Chinese name is Escherichia coli, namely Escherichia coli, which is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, the preservation date is 11 months and 05 days in 2018, the preservation address is the microorganism institute of China academy of sciences, No. 3 of North West Lu No.1 of the morning area in Beijing, and the preservation number is CGMCC No. 16709.

Drawings

FIG. 1 is a schematic diagram of the structure of plasmid pAKF.

Based on the isoprene producing strain CIBTS1758, after the genetic engineering transformation of the invention, farnesyl pyrophosphate synthase IspA is used for replacing isoprene synthase IspS, and β -farnesene synthase BFS (the coding gene of the farnesyl pyrophosphate synthase IspA is BFS with the sequence of SEQ ID NO: 1) is introduced, so that the genes related to β -farnesene production are enhanced, the isoprene branching metabolic pathway is replaced, and the farnesene synthetic strain is constructed.

Detailed Description

The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

The addition amount, content and concentration of various substances are referred to herein, wherein the percentage refers to the mass percentage unless otherwise specified.

Different from the prior art, in order to provide an engineering bacterium which can produce β -farnesene with high yield, effectively reduce the production cost of β -farnesene and is suitable for industrial fermentation, escherichia coli which produces isoprene with high yield is taken as a starting bacterium based on metabolic engineering, and the gene engineering bacterium obtained by blocking the synthesis of isoprene and efficiently expressing farnesyl pyrophosphate synthase IspA and β -farnesene synthase genes can realize the effective accumulation of β -farnesene in a low-cost fermentation culture medium.

In this context, for the present invention, the terms "β -farnesene genetically engineered bacterium", "β -farnesene genetically engineered bacterium", "farnesene producing bacterium", "Escherichia coli CIBTS 2509C" and "CIBTS 2509C strain" mean the same meaning, and all refer to β -farnesene producing bacterium CGMCC No. 16709.

In this context, the terms "Escherichia coli CIBTS 1758", "strain CIBTS 1758", "CIBTS 1758" mean the same meaning, and all refer to the original strain CIBTS1758 as the basis for the construction of farnesene-producing bacterium CGMCC No.16709, which has been constructed and deposited by the research and development center of Industrial biotechnology of Shanghai and which is described in the literature Synergy beta methyl erythrotriphate pathway and mevaloThe natural pathway for isopene production is described in detail in Chen Yang et al, Metabolic Engineering 37(2016) 79-91, the strain CIBTS1758 is constructed based on E.coli B L21, the genotype is B L21, glmS-pstS:: P_L*MK_MMPMK_SCPMD_SCidi_SC,Δidi::PGI*idi_SC,P_L**dxs,PGI*dxr。

The plasmid PHGFH, PAGEs and pAKF are co-transferred into escherichia coli CIBTS1758, and the obtained positive clone strain CIBTS1758/PHGFH/PAGEs/pAKF is screened and named as CIBTS2509C to obtain farnesene producing strain CGMCC No. 16709. It contains the genes mvaE, mvaS, mk, pmk, pmd, idi, ispA and bfs. Wherein the genes mvaE and mvaS are obtained by transforming plasmids PHGFH and PAGEs into a host CIBTS1758, the genes mk, pmk, pmd and idi are mevalonate pathway related genes contained in the host CIBTS1758, and the genes ispA and bfs are obtained by transforming a plasmid pAKF into the host CIBTS 1758.

The control strain as a comparison of farnesene production capacity was the strain CIBTS 1758/PHGFH/PAEs/pAK obtained by co-transferring plasmids PHGFH, PAEs and pAK into E.coli CIBTS1758 since plasmid pAKF contains gene ispA related to farnesene synthesis and bfs with the sequence SEQ ID NO:1, and plasmid pAK contains a gene ispA related to farnesyl pyrophosphate synthesis but does not contain bfs gene, this gene difference makes E.coli CIBTS2509C have β -farnesene production capacity, while the control strain does not have this capacity.

Examples

Materials and methods

The whole gene synthesis, primer synthesis and sequencing herein were performed by Nanjing Kingsrei Biotechnology Ltd.

The molecular biological experiments herein include plasmid construction, enzyme digestion, competent cell preparation, transformation, etc., which are mainly performed with reference to molecular cloning, a guide to experiments (third edition), J. SammBruk, D.W. Lassel (America), Huangpetang, et al, scientific Press, Beijing, 2002). For example, the methods for competent cell transformation and competent cell preparation are described in Chapter 1, 96 of molecular cloning, A laboratory Manual (third edition). The specific experimental conditions can be determined by simple experiments if necessary.

The plasmid PHGFH was supplied by the Shanghai Industrial Biotechnology research and development center and contains the petH, petF, ispG, ispH, replication region p15A gene.

Plasmid PAGEs were provided by the research and development center for industrial biotechnology in shanghai and contained mvaE, mvaS, fldA, ispG, replicon repA genes.

Plasmid pSK, provided by the research and development center for Industrial biotechnology in Shanghai, contains ispS and mvaK genes.

Plasmid pUC57-150-1 was synthesized by Nanjing Kingsry Biotech, Inc., and contains bfs gene having the sequence SEQ ID NO:1, which is an optimized codon preferred for E.coli.

Escherichia coli CIBTS1758 was constructed and supplied by the Shanghai Industrial biotechnology research and development center.

Plasmids PHGFH, PAGEs and E.coli CIBTS1758 have been disclosed in the literature by the Synergy beta metallocene phosphate pathway and the mevalonate pathway for isoprenergic production in Escherichia coli Chen Yang, et al, Metabolic Engineering 37(2016) 79-91.

Main culture medium:

the seed medium is, for example, L B medium, which may comprise 100. mu.g/ml ampicillin, 34. mu.g/ml chloramphenicol, and 100. mu.g/ml spectinomycin the seed amplification medium is, for example, V7S medium, which may comprise 100. mu.g/ml ampicillin, 34. mu.g/ml chloramphenicol, and 100. mu.g/ml spectinomycin the production fermentation medium is, for example, V7E medium, which may comprise 100. mu.g/ml ampicillin, 34. mu.g/ml chloramphenicol, and 100. mu.g/ml spectinomycin, and 0.1mM IPTG.

The V7S culture medium comprises glucose 10 g/L, yeast powder 5 g/L0.1.1M/L, (NH)₄)₂SO₄5g/L，Na₂HPO₄1g/L，KH₂PO₄0.4g/L，MgSO₄0.5g/L，CaCl₂·2H₂O0.1 g/L, vitamin B12 mg/L, 100 times of trace element solution (citric acid monohydrate 10 g/L)₄·7H₂O 2g/L,FeSO₄·7H₂O 0.5g/L,ZnSO₄·7H₂O0.2g/L,CuSO₄·5H₂O 0.05g/L,0.05g CoCl₂·6H₂O,Na₂MoO₄·2H₂O 0.05g/L)。

The V7E culture medium comprises glucose 5 g/L, yeast powder 1 g/L0.1M/L, (NH)₄)₂SO₄5g/L，Na₂HPO₄1g/L，KH₂PO₄0.4g/L，MgSO₄0.5g/L，CaCl₂·2H₂O0.1 g/L, vitamin B12 mg/L, 100 times of trace element solution (citric acid monohydrate 10 g/L)₄·7H₂O 2g/L,FeSO₄·7H₂O 0.5g/L,ZnSO₄·7H₂O0.2g/L,CuSO₄·5H₂O 0.05g/L,0.05g CoCl₂·6H₂O,Na₂MoO₄·2H₂O 0.05g/L)。

Example 1: construction of plasmid pAKF

The primer sequence information used in the construction of plasmid pAKF is shown in Table 1.

TABLE 1 primer sequences

In Table 1, "-F" in the name represents the forward direction; "-R" represents reverse.

1.1 taking Escherichia coli MG1655 genome as template, ispA-FG/ispA L-R2 as primer, PCR amplifying ispA L fragment, about 969bp (amplification homology arm + ispA + linker), PCR condition, 95 ℃ denaturation 5min, 95 ℃ denaturation 30s, 58 ℃ annealing 30s,68 ℃ extension 1min, setting 32 cycles, 68 ℃ heat preservation 10min, finally 16 ℃ heat preservation 10 min.

Recovering the ispA L fragment by glue, taking the ispA L fragment as a template, taking ispA-FG/ispA-RG as a primer, amplifying the ispA L G fragment by PCR (amplification homology arm + ispA + linker + homology arm) under the PCR conditions of denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 68 ℃ for 1min, setting 32 cycles, keeping the temperature at 68 ℃ for 10min, and finally keeping the temperature at 16 ℃ for 10 min.

The pSK plasmid was digested with NcoI/NruI, the approximately 5.4kb fragment was gel recovered, the ispA L G fragment was ligated to the above 5.4kb recovered fragment using Gibson cloning, the ligated fragment was transferred into E.coli DH5 α competent cells, plated on ampicillin plates, cultured at 37 ℃ and positive clones were picked and sequenced to obtain plasmid pAK.

1.2 plasmid pUC57-150-1 was digested with BamHI/HindIII, a band of 1.7kb was recovered, ligated with the plasmid pAK fragment recovered by the same digestion, the ligated fragment was transferred to DH5 α competent cells, plated on ampicillin plates, cultured at 37 ℃ and positive clones were picked up and sequenced to obtain plasmid pAKF, the structure of which is shown in FIG. 1.

Example 2 construction of β -farnesene-producing bacterium

2.1 the plasmids PHGFH, PAGEs and pAKF in example 1 were co-transformed into E.coli CIBTS1758 directly by the electric transformation method to obtain the strain CIBTS1758/PHGFH/PAGEs/pAKF, which is named CIBTS 2509C.

2.2 plasmids PHGFH, PAGEs and pAK in example 1 were co-transferred into E.coli CIBTS1758 by an electrotransformation method to obtain strains CIBTS1758/PHGFH/PAGEs/pAK as control strains.

Example 3 fermentative production of β -farnesene by the Strain

3.1 Strain CIBTS2509C culture fermentation

Picking a single colony of CIBTS2509 into L B culture medium containing 100 mu g/ml ampicillin, 34 mu g/ml chloramphenicol and 100 mu g/ml spectinomycin, culturing at 37 ℃ at 220rpm overnight, then inoculating the single colony into V7S culture medium containing the three antibiotics according to the inoculation amount of 8% V/V, continuing culturing at 37 ℃ and 220rpm for 8-12h, then inoculating the single colony into V7E culture medium containing the three antibiotics and 0.1mM IPTG according to the inoculation amount of 8% V/V, continuing culturing at 37 ℃ and 220rpm for 8-12h, adding 1/5 volume of decane to continue culturing for 4 h.12000rpm, centrifuging for 10min, collecting decane phase, and sending the decane phase to GC-MS for analysis.

The GC analysis method for farnesene is as follows: an agent 7890A gas chromatograph equipped with 5975 MS; chromatography column Agilent HP-1(30mx0.25mm,0.25 μm); sample introduction amount: 0.5 mul; sample inlet temperature: the split ratio is 10:1 at 280 ℃; gassaver 20 ml/min; column flow rate: 1 ml/min; carrier gas: high-purity nitrogen, column front pressure: 11.724psi, average rate: 26.511 cm/sec; column temperature: (1) keeping the temperature at 60 ℃ for 0 min; (2) heating to 150 deg.C at a rate of 10 deg.C/min, and maintaining for 0 min; (3) 30 ℃/min, heating to 280 ℃, and keeping for 2 min. Total run time 15.33 min. Detector (FID): temperature: 300 ℃, hydrogen flow rate: 40 ml/min; air flow rate: 400 ml/min; blowing at the tail for 25 ml/min; target peak-off time: 11.07 min.

The yield of the target product β -farnesene is 250 mg/L confirmed by GC-MS.

3.2 control Strain CIBTS1758/PHGFH/PAGEs/pAK culture fermentation

The strain CIBTS1758/PHGFH/PAGEs/pAK is cultured and fermented according to the same method as the step 3.1, and the yield of β -farnesene is detected, and the control strain does not produce β -farnesene by GC-MS confirmation.

Experiments prove that the strain CIBTS2509C has β -farnesene production capacity, can realize high-concentration accumulation of β -farnesene in fermentation liquor, and has industrial application prospect.

Sequence listing

<110> Zhejiang pharmaceutical products Ltd

<120> Escherichia coli for producing farnesene

<130>SHPI1812281

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>1725

<212>DNA

<213> Artificial sequence ()

<400>1

atgagcaccc tgccgatcag cagcgtgagc agcagcagca gcaccagccc gattgtggtt 60

gacgataaag acagcaccaa gccggatgtt atccgtcaca ccaccaactt caacgcgagc 120

atttggggcg accagtttct gacctacgac gagccggaag atctggtgat gaagaaacaa 180

ctggttgagg aactgaaaga ggaagtgaag aaagagctga tcaccattaa aggtagcaac 240

gaaccgatgc agcacgtgaa gctgatcgag ctgattgacg cggttcaacg tctgggcatc 300

gcgtaccact tcgaggaaga gatcgaagag gcgctgcagc acattcacgt gacctatggc 360

gagcagtggg ttgataaaga aaacctgcaa agcattagcc tgtggttccg tctgctgcgt 420

cagcaaggtt ttaacgtgag cagcggcgtt ttcaaggact ttatggatga gaagggtaaa 480

tttaaggaaa gcctgtgcaa cgacgcgcag ggcatcctgg cgctgtacga agcggcgttc 540

atgcgtgtgg aggacgaaac cattctggat aacgcgctgg agtttagcaa agttcacctg 600

gatatcattg cgaaggaccc gagctgcgat agcagcctgc gtacccagat ccaccaagcg 660

ctgaagcaac cgctgcgtcg tcgtctggcg cgtatcgaag cgctgcacta catgccgatt 720

tatcagcaag agaccagcca cgacgaagtg ctgctgaaac tggcgaagct ggatttcagc 780

gttctgcaga gcatgcacaa gaaagagctg agccacatct gcaaatggtg gaaggacctg 840

gatctgcaaa acaaactgcc gttcgtgcgt gaccgtgtgg ttgaaggcta cttttggatt 900

ctgagcattt actatgagcc gcagcacgcg cgtacccgta tgtttctgat gaagagctgc 960

atgtggctgg ttgtgctgga cgataccttc gacaactacg gtacctatga agagctggag 1020

atctttaccc aagcggtgga aaaatggagc attagctgcc tggatatgct gccggaatac 1080

atgaagctga tctatcagga gctggtgaac ctgcacgttg aaatggaaga gagcctggag 1140

aaagaaggca aggcgtacca aattcactat gttaaagaga tggcgaagga actggtgcgt 1200

aactacctgg ttgaggcgcg ttggctgaaa gaaggttaca tgccgaccct ggaagagtat 1260

atgagcgtga gcatggttac cggtacctac ggcctgatga ccgcgcgtag ctatgtgggt 1320

cgtggcgaca tcgttaacga agataccttc aaatgggtta gcagctatcc gccgatcgtg 1380

aaggcgagct gcgttatcattcgtctgatg gacgatattg tgagccacaa agaagagcag 1440

gagcgtggtc acgttgcgag cagcattgag tgctacagca aggaaagcgg cgcgagcgaa 1500

gaggaagcgt gcgaatatat cagccgtaaa gtggaagatg cgtggaaggt tattaaccgt 1560

gagagcctgc gtccgaccgc ggtgccgttc ccgctgctga tgccggcgat caacctggcg 1620

cgtatgtgcg aagtgctgta cagcgttaac gacggtttta cccacgcgga gggcgatatg 1680

aaaagctata tgaagagctt ctttgttcac ccgatggtgg tttaa 1725

<210>2

<211>53

<212>DNA

<213> Artificial sequence ()

<400>2

attaatgtat cgattaaata aggaggaata aaccatggac tttccgcagc aac 53

<210>3

<211>59

<212>DNA

<213> Artificial sequence ()

<400>3

aagcttgcgg atccgccgcc acccgagcca ccgccacctt tattacgctg gatgatgta 59

<210>4

<211>57

<212>DNA

<213> Artificial sequence ()

<400>4

acaggatacc atgttttttt acctccttta tgcagaagct tgcggatccg ccgccac 57

<210>5

<211>22

<212>DNA

<213> Artificial sequence ()

<400>5

gcattaagcg ccggagataa ag 22

<210>6

<211>23

<212>DNA

<213> Artificial sequence ()

<400>6

cgatcaaatc cgggtagctt tcg 23

Claims (10)

1. An β -farnesene producing strain, which is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No. 16709.

2. A method of constructing β -farnesene-producing strain according to claim 1, comprising the steps of:

A. constructing a plasmid PHGFH comprising petH, petF, ispG, ispH, replication region p15A gene;

constructing plasmid PAGEs which comprise mvaE, mvaS, fldA, ispG and replicon repA genes;

constructing a plasmid pAKF which comprises ispA from escherichia coli, mvaK from Methanosarcina mazei, bfs with a sequence of SEQ ID NO.1 and a replicon ColE1 gene;

B. co-transferring the plasmids PHGFH, PAGEs and pAKF constructed in the step A into escherichia coli to obtain positive clones containing genes mvaE, mvaS, mk, pmk, pmd, idi, ispA and bfs;

C. and B, screening out a strain for producing β -farnesene from the positive clone constructed in the step B.

3. Use of β -farnesene-producing strain according to claim 1 for producing β -farnesene.

4. The use of claim 3, wherein β -farnesene is produced by fermentation of β -farnesene-producing bacteria of claim 1.

5. Use according to claim 4, wherein the fermentation comprises a seed culture stage and a bacterial fermentation stage.

6. The use of claim 5, wherein the seed culture medium and the bacterial fermentation medium are different.

7. The use of claim 6, wherein the fermentation medium comprises glucose 5 g/L, yeast powder 1 g/L0.1.1M/L, (NH)₄)₂SO₄5g/L，Na₂HPO₄1g/L，KH₂PO₄0.4g/L，MgSO₄0.5g/L，CaCl₂·2H₂0.1 g/L of O, 12 g/12 mg/L of vitamin B and 100 times of trace element solution, wherein the trace element solution consists of 10 g/L g of citric acid monohydrate₄·7H₂O 2g/L,FeSO₄·7H₂O 0.5g/L,ZnSO₄·7H₂O 0.2g/L,CuSO₄·5H₂O0.05g/L,0.05g CoCl₂·6H₂O,Na₂MoO₄·2H₂O 0.05g/L。

8. The use according to claim 6, wherein the seed medium and the fermentation medium comprise 100. mu.g/ml ampicillin, 34. mu.g/ml chloramphenicol and 100. mu.g/ml spectinomycin, respectively.

9. The use according to claim 6, wherein the bacterial fermentation medium comprises 0.1mM IPTG.

10. The use according to claim 5, wherein the fermentation temperature is 37 ℃.

Images