CN111690586A - Method for enhancing intracellular propionyl coenzyme A metabolism and improving steroid precursor production - Google Patents

Abstract

The invention belongs to the technical field of biocatalysis, and particularly relates to a method for improving steroid precursor production by enhancing intracellular propionyl coenzyme A metabolism. The invention obtains and utilizes PCCA, PCCB, PCCC, PCCD, MCEE, MTUA and MTUB to construct a steroid precursor production strain with PCCA, PCCB, PCCC, MCEE, MTUA and MTUB singly or in combination for strengthening and PCCD knocking out and any combination of all strengthening forms and knocking out, so as to strengthen the metabolism of propionyl coenzyme A in the steroid precursor production strain, solve the problem that propionyl coenzyme A is excessively accumulated to generate toxic action on cells, cause production stagnation and product degradation, and be beneficial to improving the conversion rate, yield and production efficiency of steroid alcohol. The method can be effectively used for strengthening the propionyl coenzyme A metabolism of other industrial production strains, has wide application value and provides a new method for reducing the production cost of the steroid precursor.

Description

Method for enhancing intracellular propionyl coenzyme A metabolism and improving steroid precursor production

The technical field is as follows:

the invention belongs to the technical field of biocatalysis, and particularly relates to a method for improving steroid precursor production capacity by enhancing intracellular propionyl coenzyme A metabolism.

Background art:

the main precursors used in the production of steroid drugs are 4-androstene-3, 17-dione (AD), 1, 4-androstene-3, 17-dione (ADD) and 9 α -hydroxyandrost-4-ene-3,17-dione (9 α -hydroxyandrostenedione), most of the steroid hormones can be synthesized by AD⁺Cofactors such as coenzyme A are converted to NADH, propionyl-CoA and acetyl-CoA. NADH enters an oxidative phosphorylation pathway to provide proton potential for ATP synthesis, and acetyl coenzyme A can directly enter a tricarboxylic acid cycle to participate in NADH and FADH₂And GTP synthesis.

The coenzyme A substance is a key bridging substance of substance metabolism and energy metabolism in the process of converting sterol by mycobacteria, and plays an important role in maintaining the balance of metabolic flow and energy supply in thalli. During the production of steroid precursors, the accumulation of large amounts of products will lead to the formation of large amounts of intermediates such as NADH, acetyl-CoA and propionyl-CoA. The excessive accumulation of the intermediate products has an inhibiting effect on the metabolic process of converting sterol substances into steroid prodrugs, and is one of the reasons for influencing the efficient generation of the steroid prodrugs.

The invention content is as follows:

in order to solve the above technical problems, the present invention introduces propionyl-CoA carboxylase (PCC), methylmalonyl-CoA epimerase (MCEE) and methylmalonyl-CoA Mutase (MTU) present in a microorganism belonging to the genus steroid-producing strain. PCC consists of three subunits of PCCA, PCCB and PCCC and is respectively coded by pccA, pccB and pccC genes; MCEE is encoded by the MCEE gene; MTU consists of two subunits MTUA and MTUB, which are encoded by two genes, mutA and mutB, respectively. In addition, the invention also knocks out a transcription regulatory factor PCCD which has an inhibiting effect on pccA, pccB and pccC genes and is coded by pccD genes, wherein the transcription regulatory factor PCCD is present in the steroid drug production strain.

The invention obtains and utilizes pccA, pccB, pccC, pccD, mcee, mtuA and mtuB genes to construct steroid precursor production strains of single or combined reinforcement of the pccA, pccB, pccC, mcee, mtuA and mtuB genes, pccD knockout and any combination of all reinforcement forms and knockout, so as to realize the reinforcement of propionyl coenzyme A metabolism and improve the conversion rate, yield and production efficiency of steroid. The method can be effectively used for strengthening the propionyl coenzyme A metabolism of other industrial production strains, has wide application value and provides a new method for reducing the production cost of the steroid precursor.

In order to achieve the above object, the present invention provides a technical solution of constructing an engineered bacterium by reinforcing pccA, pccB, pccC, mcee, mtuA and mtuB genes alone or in combination and by combining with a comprehensive application of pccD gene knockout, wherein a host of the engineered bacterium is a bacterium or fungus having a steroid precursor producing ability;

the steroid precursors include, but are not limited to, Androst-4-ene-3,17-dione (Androst-4-ene-3,17-dione, AD), 9 α -hydroxyandrost-4-ene-3,17-dione (9 α -hydroxyandrost-4-ene-3,17-dione, 9 α -OH-AD), Androst-1,4-diene-3,17-dione (Androst-1,4-diene-3,17-dione, ADD), a-ring degradant, and the like;

preferably, the host is a rapid-growing Mycobacterium neogold (Mycobacterium sp) MNR M3, which has been deposited with the china industrial culture collection center for microorganisms under the collection number cic c 21097;

the pccA is a nucleotide sequence shown in SEQ ID NO.1, encodes A subunit (PCCA) of propionyl coenzyme A carboxylase, the size of the PCCA is 654 amino acids, and the sequence is shown in SEQ ID NO. 2;

the pccB is a nucleotide sequence shown as SEQ ID NO.3, encodes a B subunit (PCCB) of propionyl-CoA carboxylase, the size of the PCCB is 542 amino acids, and the sequence is shown as SEQ ID NO. 4;

the pccC is a nucleotide sequence shown as SEQ ID NO. 5, encodes a C subunit (PCCC) of propionyl coenzyme A carboxylase, the size of the PCCC is 93 amino acids, and the sequence is shown as SEQ ID NO. 6;

the MCEE is a nucleotide sequence shown as SEQ ID NO. 7, codes methylmalonyl coenzyme A epimerase (MCEE), has the size of 158 amino acids, and has a sequence shown as SEQ ID NO. 8;

mtuA is a nucleotide sequence shown in SEQ ID NO. 9, encodes A subunit (MTUA) of methylmalonyl coenzyme A mutase, the size of MTUA is 611 amino acids, and the sequence is shown in SEQ ID NO. 10;

the mtuB is a nucleotide sequence shown in SEQ ID NO. 11, encodes a B subunit (MTUB) of methylmalonyl-CoA mutase, the size of the MTUB is 754 amino acids, and the sequence is shown in SEQ ID NO. 12.

The pccD is a nucleotide sequence shown in SEQ ID NO. 13, encodes a transcription regulating factor (PCCD) of propionyl-CoA carboxylase, the size of the PCCD is 405 amino acids, and the sequence is shown in SEQ ID NO. 14.

Preferably, the genetically engineered bacterium is over-expressed by using a genetically engineered expression vector to at least one coding gene of PCCA, PCCB, PCCC, MCEE, MTUA and MTUB;

preferably, the genetic engineering bacteria knock out the PCCD coding gene by using a knock-out vector;

preferably, the genetic engineering expression vector is a bacterial expression vector;

preferably, the bacterial expression vector is an escherichia coli expression vector, a bacillus subtilis expression vector or a mycobacterium expression vector; preferably, the genetic engineering knockout vector is a bacterial knockout vector;

preferably, the bacterial knockout vector is a mycobacterium knockout vector;

more preferably, the E.coli expression vector is a PET expression vector, the Bacillus subtilis expression vector is plasmid pWB980, the Mycobacterium expression vector is a pMV306 or PFZ36 Mycobacterium integration vector or a pAL5000 or pFZ2 or a pMV261 Mycobacterium-E.coli shuttle expression vector; the mycobacterium knockout vector is a plasmid containing all or partial sequences of p2NIL and pGO19 plasmids or a CRISPR-Cas system.

Preferably, the host cell is Escherichia coli BL21 strain, Bacillus subtilis (Bacillus subtilis), Mycobacterium (Mycobacterium sp.) NRRLB-3683, Mycobacterium (Mycobacterium sp.) NRRLB-3805, Mycobacterium smegmatis (Mycobacterium smegmatis), Mycobacterium fortuitum, Mycobacterium flavum (Mycobacterium gilvum), Mycobacterium neoformans (Mycobacterium neoaurum), Mycobacterium Phlei (Mycobacterium Phlei), Mycobacterium avium (Mycobacterium avium), etc.;

preferably, the host cell is Mycobacterium fortuitum (Mycobacterium fortuitum) ARL-91, the strain is preserved in the common microorganism center of the china committee for culture collection and management of microorganisms, and the preservation number is cgmccno. 16771.

The invention also provides the application of the genetic engineering bacteria in producing steroid precursors, in particular the application in producing androst-4-ene-3, 17-dione;

the application in the production of androstane-4-alkene-3, 17-diketone is as follows:

transferring the culture solution of genetically engineered strain seed into fermentation culture medium at an inoculum size of 2-10%, and culturing at 25-35 deg.C and 50-200rpm for 24-168 hr; the yield of androstane-4-ene-3, 17-dione can reach 0.3-30g/L, and the molar conversion rate can reach 50% -99%;

the fermentation medium comprises the following components: k₂HPO₄0.1-3g/L，MgSO₄0.1-3g/L, 0.01-0.2g/L ferric ammonium citrate, 1-5g/L citric acid, 1-10g/L diammonium hydrogen phosphate, 5-50g/L glucose, 1-50g/L phytosterol and the balance of water, wherein the pH value is 6.0-7.5.

Has the advantages that:

the invention constructs a gene engineering recombinant strain for steroid precursor production by singly or in combination of overexpression pccA, pccB, pccC, mcee, mtuA and mtuB genes and/or knockout of pccD and any combination of overexpression and knockout. Compared with the original strain, the content of propionyl coenzyme A in the genetically engineered strain is reduced by more than 16 percent and can be reduced by 63 percent at most; the method has the advantages that the thallus activity of the genetically engineered strain is unexpectedly found to be effectively improved by more than 10 percent; the mol conversion rate of androstane-4-ene-3, 17-diketone is improved from 74.21 percent to 95.76 percent; the invention provides a new method for improving the production capacity of the steroid precursor production strain. The method can also be used for strengthening propionyl coenzyme A metabolism in other industrial production strains, and has wide application value.

Description of the drawings:

FIG. 1 is a nucleic acid electrophoresis diagram showing an amplification product of pccB gene

Wherein lane M is a DNA standard marker, and lanes 1-2 are pccB gene amplification bands;

FIG. 2 is a restriction enzyme digestion verification map of pMV261-pccB overexpression vector construction process

Wherein, Lane M is DNA standard marker, Lanes 1 and 2 are the result of double digestion of pMV261-pccB by BamHI and Hind III;

pYK in FIG. 3_delEnzyme digestion verification map of pccD knockout vector construction process

Wherein Lane M is DNA Standard marker, Lane pYK_del-pccD is pYK_del-pccD knockout vectorPerforming single enzyme digestion by PacI;

FIG. 4 is a verification of pccD knockdown bacterium genotype

Wherein Lane M is DNA standard marker, Lane MNR is an amplified band containing the complete pccD gene, Lane MUT_pccDIs a pccD gene amplification band containing deletion 903pb after knockout;

FIG. 5 original strain M3, pccB overexpression strain M3_pccBpccD knock-out strain Mut_pccDAnd pccD knock-out pccB overexpression Strain M3_pccB/△pccDA change in strain viability;

FIG. 6 original strain M3, pccB overexpression strain M3_pccBpccD knock-out strain Mut_pccDAnd pccD knock-out pccB overexpression Strain M3_pccB/△pccDProduction curve of meso-androst-4-ene-3, 17-dione.

The specific implementation mode is as follows:

in order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the present patent and are not intended to limit the present invention.

The experimental procedures not specified in the following examples were generally carried out under conventional conditions, as described in molecular cloning instructions (fourth edition) (scientific publishers 2017).

Example 1 acquisition of encoding genes for PCCA, PCCB, PCCC, MCEE, MTUA and MTUB, Single Gene overexpression vector construction

This example illustrates the cloning of the PCCB encoding gene PCCB from Mycobacterium (Mycobacterium neoaurum) MNR M3 using PCR methods alone, SEQ ID NO:3 sequence (b).

The PCR primers were PCCB-1 and PCCB-2 (PCCB-1: GGATCCAGCTGCAGAATTCATGACGAGCA-CTATCGAGCC; PCCB-2: CGCTAGTTAACTACGTCGACCTACAGCGGGATGTTGCCGT).

PCR was performed using genomic DNA of Mycobacterium neoaurum MNR M3 as a template to obtain pccB gene of MNRM3 (shown in SEQ ID NO. 3). The amplified products were detected by nucleic acid electrophoresis (FIG. 1) and then sequenced. The sequencing result shows that the obtained nucleotide fragment is the pccB gene.

The pMV261 plasmid is used for constructing a genetic engineering expression vector for the overexpression of the pccB gene, and the process comprises the following steps: the pccB gene gel obtained above is recovered, mixed with pMV261 plasmid recovered by EcoRI and SalI double-enzyme gel cutting, connected by using Minerva Super Fusion Cloning Kit seamless Cloning Kit, the connection product is transferred into Escherichia coli DH5 alpha by a chemical conversion method, and positive clone is obtained by kanamycin screening. The plasmids in the extracted positive clones are subjected to enzyme digestion verification (figure 2) and sequencing to obtain the successfully constructed expression vector pMV261-pccB for the overexpression genetic engineering of the pccB gene.

The acquisition of the coding genes PCCA, PCCC, MCEE, MTUA and MTUB was carried out with reference to the acquisition method of the coding gene PCCB, and the primers used are shown in Table 1. The overexpression plasmids of pccA, pccC, mcee, mtuA and mtuB genes were constructed by referring to the method of pMV261-pccB, and named pMV261-pccA, pMV261-pccC, pMV261-mcee, pMV261-mutA, and pMV261-mutB, respectively, based on the genes contained therein.

TABLE 1 primers used for the acquisition of the genes coding for PCCA, PCCC, MCEE, MTUA and MTUB

Example 2 construction of tandem overexpression vectors for genes encoding PCCA, PCCB, PCCC, MCEE, MTUA and MTUB

Obtaining an amplification product containing PCCB and PCCC coding genes by using the genomic DNA of the Mycobacterium neoaurum MNR M3 as a template and using the primers PBC-1 and PBC-2 in the table 1; obtaining an amplification product containing the MCEE coding gene by using the primers MCEE-3 and MCEE-4, and obtaining an amplification product containing the MTU coding gene by using the primers MTU-1 and MTU-2. The amplification products were separately recovered by gel mixing with the pMV261-pccA plasmid recovered by HpaI single-enzyme gel cutting. A tandem overexpression vector of the genes encoding PCCA, PCCB, PCCC, MCEE, MTUA and MTUB was constructed according to the method described in example 1 and named pMV 261-pc-MCEE-mtu.

Example 3 construction of Gene-potentiated strains encoding PCCA, PCCB, PCCC, MCEE, MTUA, and MTUB

Preparation of mycobacterial MNR M3 competent cells: MNR M3 strain is inoculated into LB culture medium and cultured at 30 ℃ to 0D₆₀₀About 1.0 percent, transferring the strain into a seed culture medium according to the inoculation amount of 10 percent to carry out secondary seed culture; after 24h, 2% glycine was added and the culture was continued for 24 h. Centrifuging to collect thallus, washing suspended thallus with 1 time, 3/4 times, 1/2 times and 1/4 times of 10% precooled glycerol of fermentation broth volume, centrifuging, adding 1/25 times of 10% glycerol suspended thallus, and packaging;

construction of a PCCB-encoding gene-enhanced strain, 10. mu.L of the pMV261-pccB gene engineering expression vector obtained in example 1 was added to 100. mu.L of the competent bacteria, placed for 30 minutes and then transferred to an electric rotary cup for clicking. After the electric shock condition is 2kV/cm, 25 muF and 720 omega, the mixture is electrically rotated for 3 to 6ms under the condition of electric shock, placed on ice for 5min, transferred into a newly sterilized 1.5mL for centrifugation, added with 500 muL of a fresh sterilized LB culture medium and recovered for 2 to 4 hours at the temperature of 30 ℃ and 200 rpm.

Screening and verifying recombinants: coating the recovered culture on an LB medium plate containing kanamycin (50mg/L), standing and culturing at 30 ℃ for 4-7d, picking out a single colony to the LB medium for culturing for 2-3d, and extracting plasmids for double enzyme digestion and sequencing verification. Positive transformants verified to be correct are named recombinant bacterium M3_pccB。

The construction of the PCCA, PCCB, PCCC, MCEE, MTUA and MTUB coding gene single gene and multi-gene tandem reinforced strain is carried out according to the construction method of the PCCB coding gene reinforced strain. The single gene enhanced strains of the genes encoding PCCA, PCCC, MCEE, MTUA and MTUB are respectively named as M3_pccA、M3_pccC、M3_mcee、M3_mtuAAnd M3_mtuB. The multiple gene tandem enhancement strain for encoding genes of PCCA, PCCB, PCCC, MCEE, MTUA and MTUB is named as M3_pcc-mcee-mtu。

Example 4 construction of PCCD encoding Gene deletion engineering bacteria

Constructing a mycobacterium gene knockout plasmid, electrically transforming the mycobacterium gene knockout plasmid into a mycobacterium competence, and carrying out double-antibody screening and blue-white-spot screening simultaneously by utilizing hygromycin and kanamycin. The correct strains were screened for sucrose plate screening and kanamycin resistance rescreening simultaneously to obtain knock-out clones. The knockout clones were verified by PCR.

The method comprises the following specific steps:

1. construction of a knock-out plasmid: designing upper and lower arm primers of PCCD gene, upper arm primers QC-PDU-F and QC-PDU-R (QC-PDU-F: CTGCAGCTGCTGGTGCGGATGT; QC-PDU-R: AAGCTTCCATGCTGACCGCGT), lower arm primers QC-PDD-F and QC-PDD-R (QC-PDD-F: AAGCTTAGTGGGCGCGCCTGCTGTCCGAGGTCCGAA and QC-PDD-R: GGATCCGGCGCCAAGATGATG), and amplifying the upstream and downstream homologous arms of pccD by using genomic DNA of Mycobacterium neoaurum MNR M3 as a template.

The upstream and downstream homologous arm genes of the target gene pccD are respectively cloned to a pMD19-T vector, then enzyme digestion is respectively carried out by PstI, HindIII and BamHI, and the enzyme digestion products are respectively connected to the mycobacterium gene knockout plasmid p2NIL which is correspondingly enzyme digested. The plasmid and pGOAL19 plasmid were digested separately with PacI and then non-directionally ligated to construct the knock-out plasmid pYKdel-pccD (the digestion was confirmed in FIG. 3).

The knockout plasmid was electroporated into MNR M3 competent cells according to the same conditions as in example 2. Adding the electrotransformation product into a culture medium to recover the culture for 3-24 hours, coating the electrotransformation product on an LB solid culture medium containing hyg 50 mu g/ml, Kn 20 mu g/ml, X-gal 50 mu g/ml and IPTG mu g/ml to culture for 5-7 days, picking colonies with blue spots, and obtaining the single-exchange strain if the PCR verification is correct. Coating the single exchange strain on a 2% sucrose-containing plate, culturing for 3-7 days, selecting white colony, extracting genome, and performing PCR (polymerase chain reaction) verification (figure 4), wherein the gene deletion strain is named Mut_pccD。

Example 5 pccD Gene deletion pccB Gene-enhanced Strain construction

Gene-deleted Strain Mut_pccDPreparing competent cells: will Mut_pccDInoculating the strain into LB culture medium, and culturing at 30 deg.C to 0D₆₀₀About 1.0 percent, transferring the strain into a seed culture medium according to the inoculation amount of 12 percent to carry out secondary seed culture; after 36h, 2% glycine was added and the culture was continued for 24 h. Centrifuging to collect thallus, washing suspended thallus with 10% precooled glycerol of 1 time of fermentation broth volume, centrifuging for three times, adding 1/25 times of 10% glycerol suspended thallus, and subpackaging for storage;

the pMV261-pccB plasmid was electrotransformed: mu.L of the pMV261-pccB gene engineering expression vector obtained in example 2 was taken and added to 100. mu.L of Mut_pccDAnd placing the susceptible bacteria in an electric revolving cup for 30 minutes and then clicking. After the electric shock condition is 1800kV/cm, 25 muF and 720 omega, the mixture is electrically rotated for 3 to 6ms under the condition of electric shock, placed on ice for 5min, transferred into a newly sterilized 1.5mL for centrifugation, added with 500 muL of a fresh sterilized LB culture medium and recovered for 3 to 6 hours at the temperature of 30 ℃ and 200 rpm.

Screening and verifying recombinants: coating the recovered culture on an LB medium plate containing kanamycin (50mg/L), standing and culturing at 30 ℃ for 4-7d, picking out a single colony to the LB medium for culturing for 2-3d, and extracting plasmids for double enzyme digestion and sequencing verification. Positive transformants verified to be correct are named recombinant bacterium M3_pccB/△pccD。

Examples 6M 3, M3_pccB、M3_pcc-mcee-mtu、Mut_pccD、M3_pccB/△pccDIntracellular propionyl-CoA levels in androst-4-ene-3,17-dione production

1. Strain activation and seed preparation

Mixing M3 and M3_pccB、M3_pcc-mcee-mtu、Mut_pccD、M3_pccB/△pccDRespectively transferring to fresh LB culture medium, culturing at 30 deg.C for 2-4 days, washing with 20mL of 0.5% Tween 80 sterile water solution, absorbing lmL eluate, adding into 50mL seed culture medium, and shake culturing at 30 deg.C and 200rpm for 36h to obtain seed solution;

the seed culture medium comprises the following components: k₂HPO₄0.5g/L，MgSO₄0.5g/L, 0.05g/L ferric ammonium citrate, 2g/L citric acid, 2g/L ammonium nitrate, 20g/L glycerin, 5g/L glucose, CaCO₃1g/L, the balance water, pH 7.2.

2. Androst-4-ene-3,17-dione production process

Respectively transferring the seed culture solution obtained in the step 1 into a 250mL baffle bottle filled with a fermentation culture medium by an inoculation amount of 5%, and performing shake culture for 120-168h at the temperature of 30 ℃ and the speed of 150 rpm;

the fermentation medium comprises the following components: k₂HPO₄0.5g/L，MgSO₄0.5g/L, 0.05g/L ferric ammonium citrate2g/L of citric acid, 3.5g/L of diammonium phosphate, 10g/L of glucose, 25mM of hydroxypropyl β -cyclodextrin, 5g/L of phytosterol and the balance of water, wherein the pH value is 7.2.

3. Detection of intracellular propionyl coenzyme A

According to step 2, using M3, M3_pccB、M3_pcc-mcee-mtu、Mut_pccD、M3_pccB/△pccDThe strain is subjected to androstane-4-ene-3, 17-dione production, 2mL of the strain is sampled under an aseptic condition in the production process, the strain is collected by centrifugation at 12000rpm at 4 ℃ for 5 minutes, liquid nitrogen is ground and then centrifuged at 14000rpm at 4 ℃ for 15 minutes to collect supernatant, and intracellular propionyl coenzyme A level detection of the strain is carried out.

The detection of the coenzyme A substance adopts a high performance liquid phase method to detect the intracellular coenzyme A substance: c18 chromatography column, detection wavelength 260nm, mobile phase component a: acetonitrile; b: 100mM ammonium acetate (pH 5.8), detection temperature 30 ℃, and using a gradient elution method at a flow rate of 0.4 mL/min.

The gradient elution procedure was as follows:

gradient from 2% a to 5% a from 0-5 min; gradient to 40% A for 5-7 min; 7-7.1 min, gradient to 60% A; 7.1-8 minutes, maintain at 60% A; gradient back to 2% A for 8-8.1 min; 8.1-11 minutes, held at 2% A to re-equilibrate the column.

4. Comparison of results

Table 2 shows M3, M3_pccB、M3_pcc-mcee-mtu、Mut_pccD、M3_pccB/△pccDVariation in intracellular propionyl-CoA content of each strain. Propionyl coenzyme A is always in an ascending state in all strains, and the fact that excessive accumulation of propionyl coenzyme A exists in the production of androst-4-ene-3,17-dione is proved. The cascade overexpression of PCCB, PCCA, PCCB, PCCC, MCEE, MTUA and MTUB, the knockout of PCCD and the knockout combined application of PCCB overexpression and PCCD can reduce the intracellular propionyl coenzyme A level, and the content of the intracellular propionyl coenzyme A is reduced by more than 16 percent, wherein the effect of the combined application of PCCB overexpression and PCCD knockout is most obvious, the content of the intracellular propionyl coenzyme A can be reduced by 63 percent at the maximum within 120 hours, and the excessive accumulation of the propionyl coenzyme A in cells is effectively relieved.

TABLE 2 M3、M3_pccB、M3_pcc-mcee-mtu、Mut_pccD、M3_pccB/△pccDIntracellular propionyl-CoA levels (μ M/gDCW) in androst-4-ene-3,17-dione production

Sampling point	M3	M3pccB	M3pcc-mcee-mtu	MutpccD	M3pccB/△pccD
						72 hours	4.62	3.86	2.86	3.52	2.26
96 hours	23.6	17.8	10.53	14.4	9.2
						120 hours	52.6	36.5	28.9	30.4	28.2
144 hours	89.8	41.2	34.8	39.6	33.2

Examples 7M 3, M3_pccB、M3_pcc-mcee-mtu、Mut_pccDAnd M3_pccB/△pccDThallus activity level in production of androstane-4-ene-3, 17-dione

1. Strain viability assay

The method according to example 6 was utilized using M3, M3_pccB、M3_pcc-mcee-mtu、Mut_pccD、M3_pccB/△pccDThe strain is subjected to androstane-4-ene-3, 17-dione production, and 1mL of the strain is sampled under an aseptic condition for strain activity detection.

The strain activity detection adopts an improved CCK-8 method, and the detection method comprises the following steps: 2- (2-methoxy-4-nitrophenyl) -3- (4-nitrophenyl) -5- (2, 4-disulfophenyl) -2H-tetrazole monosodium salt (WST-8) can be reduced to orange-yellow water-soluble Formazan by bacterial dehydrogenase in the presence of an electron carrier, and the production amount and the activity of the strain are in positive correlation. The maximum absorption peak of Formazan at 450nm can reflect the activity of the thallus by detecting the absorbance value (A450) at 450 nm. The OD was adjusted with Tris-HCl buffer (pH7.2)₆₀₀After the value was adjusted to 1, 190. mu.L of the protein was added to a 96-well plate, WST-810. mu.L of the protein was added to each well, and after incubation at 30 ℃ for 1 hour, the absorbance at 450nm was measured using Infinite M200 Pro.

2. Comparison of results

M3、M3_pccB、M3_pcc-mcee-mtu、Mut_pccD、M3_pccB/△pccDThe viability of the strains varied as shown in FIG. 5, throughout the productionIn the process, the activities of all the bacteria show a trend of increasing firstly and then decreasing, and the strain M3_pccB、M3_pcc-mcee-mtu、Mut_pccD、M3_pccB/△pccDThe viability of the strain of (a) was consistently greater than that of the MNR M3. In particular at 96h, M3_pccB、M3_pcc-mcee-mtu、Mut_pccD、M3_pccB/△pccDThe activity of the strain is respectively 10.3%, 35.7%, 20.6% and 46.8% higher than that of MNR M3. Thus, overexpression of pccA, pccB, pccC, mcee, mtuA and mtuB genes and knockout of negative regulatory factors are beneficial to improving the activity of the strain.

Example 8 original strains M3, M3_pccB、M3_pcc-mcee-mtu、Mut_pccDAnd M3_pccB/△pccDProduction of androst-4-ene-3,17-dione

The original strain M3, pccB overexpressing strain M3 were used according to the method of example 6_pccBpccD knock-out strain Mut_pccDpccD knock-out pccB overexpression strain M3_pccB/△pccDAnd pccA, pccB, pccC, mcee, mtuA and mtuB gene tandem overexpression strain M3_pcc-mcee-mtuThe method is used for producing androstane-4-ene-3, 17-dione.

The production results are shown in FIG. 6, and four genetically engineered strains M3_pccB、M3_pcc-mcee-mtu、Mut_pccDAnd M3_pccB/△pccDThe mole conversion rate of the androstane-4-ene-3, 17-dione is always higher than that of the original strain M3. At 96h, strain M3_pccB、M3_pcc-mcee-mtu、Mut_pccDAnd M3_pccB/△pccDThe mole conversion rates of androst-4-ene-3,17-dione are 55.92%, 68.96%, 62.15% and 75.92%, respectively, which are 1.5 times, 1.86 times, 1.67 times and 2.04 times of the original strain M3; at 144h, strain M3_pccB、M3_pcc-mcee-mtu、Mut_pccDAnd M3_pccB/△pccDThe mole conversion rates of androst-4-ene-3,17-dione were 87.77%, 92.35%, 85.23% and 95.76%, respectively, which were 1.21 times, 1.27 times, 1.17 times and 1.32 times of the original strain M3. Therefore, the overexpression of pccA, pccB, pccC, mcee, mtuA and mtuB genes and the knockout of negative regulatory factors are beneficial to the improvement of the conversion rate of androst-4-ene-3, 17-dione.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the patent. It should be noted that, for those skilled in the art, various changes, combinations and improvements can be made in the above embodiments without departing from the patent concept, and all of them belong to the protection scope of the patent. Therefore, the protection scope of this patent shall be subject to the appended claims.

Sequence listing

<110> Tianjin science and technology university

<120> a method for enhancing intracellular propionyl-CoA metabolism to enhance steroid precursor production

<130>1

<141>2020-07-03

<160>14

<170>SIPOSequenceListing 1.0

<210>1

<211>1965

<212>DNA

<213> Mycobacterium new (M3M sp. M)

<400>1

atgatcagca gagttctcgt cgccaaccgt ggtgagatcg cccgccgggt gttcagcacc 60

tgccgtcgtc tcggtatcgg caccgtcgcg gtctacaccg accccgacgc cgacgccccg 120

cacgtcgccg aggccgactt ccgggtccgg ctcgagggcc gcaacggcta tctggacagc 180

gcccagctca tcgcggcggc gcgtgccgcc ggcgccgacg cggtacatcc cggttacggg 240

ttcctctcgg agaaccccga tttcgcggcc gcggtggccg acgccggtct gacctggatc 300

ggaccgccgg tggccgccgt gcaggccatg ggctccaaga tcgaggccaa gaagctgatg 360

gccgcggccg gcgtgccggt gctggccgaa ctggacccgg ccaccgtcac cgccgaccag 420

ttgcccgtcc tgatcaaggc gtccgccggt ggtggcggtc gcggtatgcg ggtggtccgg 480

gagctgtccg acctgcccgc cgaggtcgcc gcggcgcagc gcgaggcgca gtcggcgttc 540

ggggatccca ccgtcttctg cgagcgctac ctggccgccg ggcaccacat cgaggtacag 600

gtgatggccg accggcacgg caccgtgtgg gcggtcgggg aacgcgagtg ctcgatccag 660

cgcaggcatc agaaggtcat cgaagaggca ccgtcgcccc tggtggaacg gactccgggc 720

atgcgcgaca ggctcttcga agccgcccgc ctggccgccg aggcgatcgg ctacaccggc 780

gcgggaaccg tcgagttcat ggccagctcc gatcctgggg ccaacggcga cttctacttc 840

ctggagatga acacccgcct gcaggtggaa cacccggtca ccgaggagac caccggcgta 900

gacctggtgg cactgcagat cgacgtcgcc gacggcatcc gcctcgatgc ccgcccgccg 960

gccacccgtg gacactcgat cgaggcgcgg ctctacgccg aggacccggc caaggactgg 1020

caaccacagg ccggaacgct gcaccggttc gccgtcccgg ccgcccgcac cgaattcggc 1080

accctcggcc gcaccggggt ccggctggat tccggcgtgg tcgacggatc ggtcatctcg 1140

gtgttctacg acccgatgct ggccaaggtg atctcgttcg ccgatacccg agagcgggcc 1200

gccgccgcgc tcgccgaggc gttggcccgc gccgtcgtcc acggccccgg taccaaccgt 1260

gaccttctgg tcaacgtgtt gcggcacccg gcattccttg ccggggacac cgacaccgcg 1320

ttcttcgaca cccacggcct tgaccgattg gcagcggccc aggacatcac cgcgccgtcg 1380

acgctggccg ccgcgctcgc cgacgccgcg cacaaccgcg ccacggcaac ggcattcgga 1440

cccgcaccga gcggatggcg caacctgttc tccgggtatc agacccgcgc cttccgcgat 1500

gccgacgacc gggagcacct ggtccgctac cggatcggac gcgacggtgt cgaggtgccc 1560

gacggcgatg atgtcacggt ggtgtccacc agccctgggc gagtggtgtt gtcggtcaac 1620

ggcgtcgaag agtccttcac ggtggcgcgt tacggcgcag cggttttcgt cgattcgccg 1680

cgcggtaccg tccggctcac cagcgtcccg cgattccccg atccggactc ggcggtggcg 1740

cacggatcgc tgctggcgcc gatgcccggc tcggtggtcc gggtcggcgc cgcggccggt 1800

gacgccgtga ccgccgggca gccgttgatc tggctagagg ccatgaagat ggagcacacg 1860

attgccgcac cgagcgacgg tgtgctcgcc gaattgaacg tacaggcagg ccagcaggtc 1920

gaggtcggca cggtgctggc ccgaatagaa ggagaacagt catga 1965

<210>2

<211>654

<212>PRT

<213> Mycobacterium new (M3M sp. M)

<400>2

Met Ile Ser Arg Val Leu Val Ala Asn Arg Gly Glu Ile Ala Arg Arg

1 5 10 15

Val Phe Ser Thr Cys Arg Arg Leu Gly Ile Gly Thr Val Ala Val Tyr

20 25 30

Thr Asp Pro Asp Ala Asp Ala Pro His Val Ala Glu Ala Asp Phe Arg

35 40 45

Val Arg Leu Glu Gly Arg Asn Gly Tyr LeuAsp Ser Ala Gln Leu Ile

50 55 60

Ala Ala Ala Arg Ala Ala Gly Ala Asp Ala Val His Pro Gly Tyr Gly

65 70 75 80

Phe Leu Ser Glu Asn Pro Asp Phe Ala Ala Ala Val Ala Asp Ala Gly

85 90 95

Leu Thr Trp Ile Gly Pro Pro Val Ala Ala Val Gln Ala Met Gly Ser

100 105 110

Lys Ile Glu Ala Lys Lys Leu Met Ala Ala Ala Gly Val Pro Val Leu

115 120 125

Ala Glu Leu Asp Pro Ala Thr Val Thr Ala Asp Gln Leu Pro Val Leu

130 135 140

Ile Lys Ala Ser Ala Gly Gly Gly Gly Arg Gly Met Arg Val Val Arg

145 150 155 160

Glu Leu Ser Asp Leu Pro Ala Glu Val Ala Ala Ala Gln Arg Glu Ala

165 170 175

Gln Ser Ala Phe Gly Asp Pro Thr Val Phe Cys Glu Arg Tyr Leu Ala

180 185 190

Ala Gly His His Ile Glu Val Gln Val Met Ala Asp Arg His Gly Thr

195 200 205

Val Trp Ala Val Gly Glu Arg Glu Cys Ser Ile Gln ArgArg His Gln

210 215 220

Lys Val Ile Glu Glu Ala Pro Ser Pro Leu Val Glu Arg Thr Pro Gly

225 230 235 240

Met Arg Asp Arg Leu Phe Glu Ala Ala Arg Leu Ala Ala Glu Ala Ile

245 250 255

Gly Tyr Thr Gly Ala Gly Thr Val Glu Phe Met Ala Ser Ser Asp Pro

260 265 270

Gly Ala Asn Gly Asp Phe Tyr Phe Leu Glu Met Asn Thr Arg Leu Gln

275 280 285

Val Glu His Pro Val Thr Glu Glu Thr Thr Gly Val Asp Leu Val Ala

290 295 300

Leu Gln Ile Asp Val Ala Asp Gly Ile Arg Leu Asp Ala Arg Pro Pro

305 310 315 320

Ala Thr Arg Gly His Ser Ile Glu Ala Arg Leu Tyr Ala Glu Asp Pro

325 330 335

Ala Lys Asp Trp Gln Pro Gln Ala Gly Thr Leu His Arg Phe Ala Val

340 345 350

Pro Ala Ala Arg Thr Glu Phe Gly Thr Leu Gly Arg Thr Gly Val Arg

355 360 365

Leu Asp Ser Gly Val Val Asp Gly Ser Val Ile Ser Val Phe TyrAsp

370 375 380

Pro Met Leu Ala Lys Val Ile Ser Phe Ala Asp Thr Arg Glu Arg Ala

385 390 395 400

Ala Ala Ala Leu Ala Glu Ala Leu Ala Arg Ala Val Val His Gly Pro

405 410 415

Gly Thr Asn Arg Asp Leu Leu Val Asn Val Leu Arg His Pro Ala Phe

420 425 430

Leu Ala Gly Asp Thr Asp Thr Ala Phe Phe Asp Thr His Gly Leu Asp

435 440 445

Arg Leu Ala Ala Ala Gln Asp Ile Thr Ala Pro Ser Thr Leu Ala Ala

450 455 460

Ala Leu Ala Asp Ala Ala His Asn Arg Ala Thr Ala Thr Ala Phe Gly

465 470 475 480

Pro Ala Pro Ser Gly Trp Arg Asn Leu Phe Ser Gly Tyr Gln Thr Arg

485 490 495

Ala Phe Arg Asp Ala Asp Asp Arg Glu His Leu Val Arg Tyr Arg Ile

500 505 510

Gly Arg Asp Gly Val Glu Val Pro Asp Gly Asp Asp Val Thr Val Val

515 520 525

Ser Thr Ser Pro Gly Arg Val Val Leu Ser Val Asn Gly Val Glu Glu

530 535 540

Ser Phe Thr Val Ala Arg Tyr Gly Ala Ala Val Phe Val Asp Ser Pro

545 550 555 560

Arg Gly Thr Val Arg Leu Thr Ser Val Pro Arg Phe Pro Asp Pro Asp

565 570 575

Ser Ala Val Ala His Gly Ser Leu Leu Ala Pro Met Pro Gly Ser Val

580 585 590

Val Arg Val Gly Ala Ala Ala Gly Asp Ala Val Thr Ala Gly Gln Pro

595 600 605

Leu Ile Trp Leu Glu Ala Met Lys Met Glu His Thr Ile Ala Ala Pro

610 615 620

Ser Asp Gly Val Leu Ala Glu Leu Asn Val Gln Ala Gly Gln Gln Val

625 630 635 640

Glu Val Gly Thr Val Leu Ala Arg Ile Glu Gly Glu Gln Ser

645 650

<210>3

<211>1629

<212>DNA

<213> Mycobacterium new (M3M sp. M)

<400>3

atgacgagca ctatcgagcc ggcggcagag cacgtagtcg atatccacac cacggccggc 60

aagctggccg acctgcgcaa gcgcgccgaa gaggcgctgc acccggtcgg tgaggccgcg 120

gtcgagaagg tgcacgccaa gggcaagctg accgcccgcg agcgcatcta cgcactgctg 180

gacgaggact ccttcgtcga actcgacgcg ttggcacgcc accgcagcac caacttcggg 240

ctggagtcca accgcccgct cggcgacggc gtggtgaccg gctacggcac catcgacggc 300

cgcgaggtct gcatcttcag ccaggacgcc accgtcttcg gcggcagcct cggcgaggtc 360

tacggcgaga agatcgtcaa ggtccaggaa ttggccatca agaccggccg cccgctgatc 420

ggtatcaacg acggcgccgg cgcccgcatc caggagggtg tggtctccct cggcctgtac 480

agccggatct tccacaacaa catcaaggcc tcgggcgtca tcccgcagat ctcgctgatc 540

atgggcgccg cggccggcgg ccacgtctac tcccccgcgc tgaccgactt cgtgatcatg 600

gtcgaccaga ccagccagat gttcatcacc ggtcccgatg tcatcaagac cgtcaccggt 660

gaggacgtca ccatggagga gctgggcggc gcccagaccc acatgtccaa gtccggcacc 720

gtgcactacg tggcctccgg cgaacaggac gccctggact acgtccgcga cctgctgagc 780

tacctgcccg ccaacaacta cgccgatccg ccgcgctacc cggcgccgcc gcacccgggc 840

gccatcgagg acaacctcac cgatgaggat atcgagctcg acaccctgat ccccgattcg 900

ccgaaccagc cctacgacat gcacgaggtc atctcgcgca tcctcgatga tgacgagttc 960

ctggagatcc aggccggtta cgcgcagaac atcatcgtcg gctacggccg tgtcgacggc 1020

cgcaccgtcg gcatcgtggc caaccagccg acccagttcg ccggctgcct cgacatcaac 1080

gcctcggaga aggccgcccg gttcatccgg acctgcgact gcttcaacat cccgatcgtg 1140

ctgctggtcg acgtgccggg cttcctgccg ggcaccggcc aggagtacaa cggcatcatc 1200

cgccgcggcg ccaagctgct gtacgcctac ggcgaggcga ccgtgcccaa gatcaccgtc 1260

atcacccgca agtcctacgg cggcgcgtac tgcgtgatgg gctccaagga catgggcgcc 1320

gacgtggtgg tggcgtggcc gacggcccag atcgcggtca tgggcgcctc cggcgcggtc 1380

ggcttcgtct accgccagga actcaagaag gccgcgcagg agggcgagga cgtcgacgcc 1440

ctgcgcctgg agctgcagca gtcctatgag gacaccctgg tcaacccgta catcgccgcc 1500

gagcgcggtt atgtcgacgc ggtcatcccg ccctcgcaca cccgcggtta cgtggcgacc 1560

tcgctgcgtc tgctggagcg caagatcagc caggtgccgc cgaagaagca cggcaacatc 1620

ccgctgtag 1629

<210>4

<211>542

<212>PRT

<213> Mycobacterium new (M3M sp. M)

<400>4

Met Thr Ser Thr Ile Glu Pro Ala Ala Glu His Val Val Asp Ile His

1 5 10 15

Thr Thr Ala Gly Lys Leu Ala Asp Leu Arg Lys Arg Ala Glu Glu Ala

20 25 30

Leu His Pro Val Gly Glu Ala Ala Val Glu Lys Val His Ala Lys Gly

35 40 45

Lys Leu Thr Ala Arg Glu Arg Ile Tyr Ala Leu Leu Asp Glu Asp Ser

50 55 60

Phe Val Glu Leu Asp Ala Leu Ala Arg His Arg Ser Thr AsnPhe Gly

65 70 75 80

Leu Glu Ser Asn Arg Pro Leu Gly Asp Gly Val Val Thr Gly Tyr Gly

85 90 95

Thr Ile Asp Gly Arg Glu Val Cys Ile Phe Ser Gln Asp Ala Thr Val

100 105 110

Phe Gly Gly Ser Leu Gly Glu Val Tyr Gly Glu Lys Ile Val Lys Val

115 120 125

Gln Glu Leu Ala Ile Lys Thr Gly Arg Pro Leu Ile Gly Ile Asn Asp

130 135 140

Gly Ala Gly Ala Arg Ile Gln Glu Gly Val Val Ser Leu Gly Leu Tyr

145 150 155 160

Ser Arg Ile Phe His Asn Asn Ile Lys Ala Ser Gly Val Ile Pro Gln

165 170 175

Ile Ser Leu Ile Met Gly Ala Ala Ala Gly Gly His Val Tyr Ser Pro

180 185 190

Ala Leu Thr Asp Phe Val Ile Met Val Asp Gln Thr Ser Gln Met Phe

195 200 205

Ile Thr Gly Pro Asp Val Ile Lys Thr Val Thr Gly Glu Asp Val Thr

210 215 220

Met Glu Glu Leu Gly Gly Ala Gln Thr His Met Ser Lys Ser Gly Thr

225 230 235 240

Val His Tyr Val Ala Ser Gly Glu Gln Asp Ala Leu Asp Tyr Val Arg

245 250 255

Asp Leu Leu Ser Tyr Leu Pro Ala Asn Asn Tyr Ala Asp Pro Pro Arg

260 265 270

Tyr Pro Ala Pro Pro His Pro Gly Ala Ile Glu Asp Asn Leu Thr Asp

275 280 285

Glu Asp Ile Glu Leu Asp Thr Leu Ile Pro Asp Ser Pro Asn Gln Pro

290 295 300

Tyr Asp Met His Glu Val Ile Ser Arg Ile Leu Asp Asp Asp Glu Phe

305 310 315 320

Leu Glu Ile Gln Ala Gly Tyr Ala Gln Asn Ile Ile Val Gly Tyr Gly

325 330 335

Arg Val Asp Gly Arg Thr Val Gly Ile Val Ala Asn Gln Pro Thr Gln

340 345 350

Phe Ala Gly Cys Leu Asp Ile Asn Ala Ser Glu Lys Ala Ala Arg Phe

355 360 365

Ile Arg Thr Cys Asp Cys Phe Asn Ile Pro Ile Val Leu Leu Val Asp

370 375 380

Val Pro Gly Phe Leu Pro Gly Thr Gly Gln Glu Tyr Asn Gly Ile Ile

385 390 395 400

Arg Arg Gly Ala Lys Leu Leu Tyr Ala Tyr Gly Glu Ala Thr Val Pro

405 410 415

Lys Ile Thr Val Ile Thr Arg Lys Ser Tyr Gly Gly Ala Tyr Cys Val

420 425 430

Met Gly Ser Lys Asp Met Gly Ala Asp Val Val Val Ala Trp Pro Thr

435 440 445

Ala Gln Ile Ala Val Met Gly Ala Ser Gly Ala Val Gly Phe Val Tyr

450 455 460

Arg Gln Glu Leu Lys Lys Ala Ala Gln Glu Gly Glu Asp Val Asp Ala

465 470 475 480

Leu Arg Leu Glu Leu Gln Gln Ser Tyr Glu Asp Thr Leu Val Asn Pro

485 490 495

Tyr Ile Ala Ala Glu Arg Gly Tyr Val Asp Ala Val Ile Pro Pro Ser

500 505 510

His Thr Arg Gly Tyr Val Ala Thr Ser Leu Arg Leu Leu Glu Arg Lys

515 520 525

Ile Ser Gln Val Pro Pro Lys Lys His Gly Asn Ile Pro Leu

530 535 540

<210>5

<211>282

<212>DNA

<213> Mycobacterium new (M3M sp. M)

<400>5

atgagccacg acgtcgatat cgtcgaagtc agcgatccgc gcgatatgac catcgacaac 60

ccggcacccc cggtgccgga gttccgggtg gtcaagggcg agccgtccga cgaggagctg 120

gcggccctgg tcgcggtgtt gtcggcggcc ggcggaaccg gtccgggtga accgggcccg 180

caggagctca acctgtgggg ccacccggtg gacaagctgc ggtaccagag ccactcctgg 240

cagcggatca cgctgctgga gcggacccac atgcgcaggt ga 282

<210>6

<211>93

<212>PRT

<213> Mycobacterium new (M3M sp. M)

<400>6

Met Ser His Asp Val Asp Ile Val Glu Val Ser Asp Pro Arg Asp Met

1 5 10 15

Thr Ile Asp Asn Pro Ala Pro Pro Val Pro Glu Phe Arg Val Val Lys

20 25 30

Gly Glu Pro Ser Asp Glu Glu Leu Ala Ala Leu Val Ala Val Leu Ser

35 40 45

Ala Ala Gly Gly Thr Gly Pro Gly Glu Pro Gly Pro Gln Glu Leu Asn

50 55 60

Leu Trp Gly His Pro Val Asp Lys Leu Arg Tyr Gln Ser His Ser Trp

65 7075 80

Gln Arg Ile Thr Leu Leu Glu Arg Thr His Met Arg Arg

85 90

<210>7

<211>477

<212>DNA

<213> Mycobacterium new (M3M sp. M)

<400>7

atgaccactg atcacgccga tgcccgtccg gcgcttgcga gcgcactggt gaccgccgtg 60

gatcacgtcg ggatcgccgt cccggatctg gacgcggcgg ccaagtggta ccacgaccac 120

ctcggcatga tcgtgctgca cgaggaggtc aacgaggagc agggcgtgcg cgaggccatg 180

ctgtcggtcc gcggcgcccc caagggcagc gcacagatcc agttgctcgc cccgctggac 240

gagaagtcca cgatcgccaa gttcatcgat cgcaacggcc ccggactgca gcagttggcc 300

taccgcacca gcgatatcga ggcgctctcc gagcggctgc gcgcagaagg catccgcctg 360

ctctacgacg caccgcggcg cggcaccgcc gactcccgga tcaacttcat ccaccccaag 420

gacgccggtg gcgtcctcat cgaattggtg gagcccagcg ccaccgccga tcactaa 477

<210>8

<211>158

<212>PRT

<213> Mycobacterium new (M3M sp. M)

<400>8

Met Thr Thr Asp His Ala Asp Ala Arg Pro Ala Leu Ala Ser Ala Leu

1 5 10 15

Val Thr Ala Val Asp His Val Gly Ile Ala Val Pro AspLeu Asp Ala

20 25 30

Ala Ala Lys Trp Tyr His Asp His Leu Gly Met Ile Val Leu His Glu

35 40 45

Glu Val Asn Glu Glu Gln Gly Val Arg Glu Ala Met Leu Ser Val Arg

50 55 60

Gly Ala Pro Lys Gly Ser Ala Gln Ile Gln Leu Leu Ala Pro Leu Asp

65 70 75 80

Glu Lys Ser Thr Ile Ala Lys Phe Ile Asp Arg Asn Gly Pro Gly Leu

85 90 95

Gln Gln Leu Ala Tyr Arg Thr Ser Asp Ile Glu Ala Leu Ser Glu Arg

100 105 110

Leu Arg Ala Glu Gly Ile Arg Leu Leu Tyr Asp Ala Pro Arg Arg Gly

115 120 125

Thr Ala Asp Ser Arg Ile Asn Phe Ile His Pro Lys Asp Ala Gly Gly

130 135 140

Val Leu Ile Glu Leu Val Glu Pro Ser Ala Thr Ala Asp His

145 150 155

<210>9

<211>1836

<212>DNA

<213> Mycobacterium new (M3M sp. M)

<400>9

atgtcctcga gcgtgatgga atcggaccgc gagcgctggc gctccggggt ggcggccgtg 60

ctggcgaaaa gcctgcgccg cgaggtggcc gacctccccg aggagcccga gcggctgctc 120

gactcaccca cctacgaggg cttcccggtg cggcccctct acacgagtct cgacggacat 180

tccgaacccg cgcttccggg tcagtggcca ttcgtccgtg gcggtgacgc ccgccgcgat 240

gtgctcagcg gatggaaggt ggccgaggag tttccggccg ggcacacctc cgcggccgac 300

gccaacaacg ccgcgctgct ggcactgacc gagggcgcca gcgcactggt gctcaaggtg 360

ggggcccatg gcgtggccgc cgaagagttc gcccagctgg tacagggcat ctacctggat 420

ctggttccgg tggtcgtcga cgccggagcc gattacgcgg atgccgccgc cgcgctgctc 480

ccactgttgg ccgacttcga cgacgaccag aattcgcgac tctcggtgga tctgggtgcc 540

gacccgttga ccgccccgct gagcggtcgg gccgcaccgg cgctcgccga cgtggtgacg 600

gtggcgaccg gaatcgccgg caggcagggc gtccgggcga tcacggtgga tggtcccgca 660

ctgcacaatc tcggtgccag cgcggtgtgg gagctggccg ccgtggtggc cgcgggtgtc 720

gagtatctgc gggcgctcgt cgccgcgggc ctcagccccg cacaggccct cggacagatc 780

agcctccggc tggcggccga tgacgatcag ttcacgacga tcgccaagat gcgcgcggtg 840

cgccggctgt gggcgcgggt cgccgaggtg atcggcgccc ccgaggccgg cgcggtcacc 900

gtgcatgcgg tgacctcggc gccgatgatg agccagcgtg acccgtgggt gaacatgttg 960

cgcaccacgc tggcggcatt cggtgccggc gtcggcggtg ccgacaccgt gctggtgcag 1020

cccttcgacg ccgcgatccc cggcgggctg ccgggaacgg cgacgagctt cacccggcgg 1080

atggcgcgca acacccaact gctgctgctc gaagaatcgc acctgggcaa ggtgctcgac 1140

ccgggagcgg gctcctggtt catcgaggac ctgaccgtgc agctggccga acacgcctgg 1200

gcgcacttcc aggatctgga gagccgcggc gggctcaccg ccgcgcgcga tcacctcgac 1260

gagcagatcg ccaccgtgcg cgggcagcgc gccgcggaca tcgcgcaccg gcggacctcg 1320

ctgaccggtg tgaacgagtt ccccaacctc gccgagaaac cgctaccggc ggggtcgcgc 1380

gccgaggaat ccgcccggat ctaccgctac gccgcggaat tcgaggccct gcgcgaccgg 1440

tccgatgcct atctggccga gcacgggacg cgcccgcagg ccgtcctgct accgctgggc 1500

ccgttggccg agcacaacat ccgcacgacc ttcgcggcca acctgctggc ctccggtggc 1560

atcgagacgg tcaacccggg caccgtggat cccgccggtg tggccgccgc ggtcggtacg 1620

cacaccgtgg ccgtcatctg cggtacggac gcccgctacg gcaccgaggt ctccgatatc 1680

gcggcggccg cgcgcgcggc cgggatcacg cacctgtacc tggccggacc ggagaaatcg 1740

gtcgccgagg cgaccgccaa gcccgacgag tacctcaccg ccaagatcaa cgccgtcgag 1800

gctctctcga ccctgctcac ccgattggga gcgtga 1836

<210>10

<211>611

<212>PRT

<213> Mycobacterium new (M3M sp. M)

<400>10

Met Ser Ser Ser Val Met Glu Ser Asp Arg Glu Arg Trp Arg Ser Gly

1 5 10 15

Val Ala Ala Val Leu Ala Lys Ser Leu Arg Arg Glu Val Ala Asp Leu

20 25 30

Pro Glu Glu Pro Glu Arg Leu Leu Asp Ser Pro Thr Tyr Glu Gly Phe

35 40 45

Pro Val Arg Pro Leu Tyr Thr Ser Leu Asp Gly His Ser Glu Pro Ala

50 55 60

Leu Pro Gly Gln Trp Pro Phe Val Arg Gly Gly Asp Ala Arg Arg Asp

65 70 75 80

Val Leu Ser Gly Trp Lys Val Ala Glu Glu Phe Pro Ala Gly His Thr

85 90 95

Ser Ala Ala Asp Ala Asn Asn Ala Ala Leu Leu Ala Leu Thr Glu Gly

100 105 110

Ala Ser Ala Leu Val Leu Lys Val Gly Ala His Gly Val Ala Ala Glu

115 120 125

Glu Phe Ala Gln Leu Val Gln Gly Ile Tyr Leu Asp Leu Val Pro Val

130 135 140

Val Val Asp Ala Gly Ala Asp Tyr Ala Asp Ala Ala Ala Ala Leu Leu

145 150 155 160

Pro Leu Leu Ala Asp Phe Asp Asp Asp Gln Asn Ser Arg Leu Ser Val

165 170 175

Asp Leu Gly Ala Asp Pro Leu Thr Ala Pro Leu Ser Gly Arg Ala Ala

180 185 190

Pro Ala Leu Ala Asp Val Val Thr Val Ala Thr Gly Ile Ala Gly Arg

195 200 205

Gln Gly Val Arg Ala Ile Thr Val Asp Gly Pro Ala Leu His Asn Leu

210 215 220

Gly Ala Ser Ala Val Trp Glu Leu Ala Ala Val Val Ala Ala Gly Val

225 230 235 240

Glu Tyr Leu Arg Ala Leu Val Ala Ala Gly Leu Ser Pro Ala Gln Ala

245 250 255

Leu Gly Gln Ile Ser Leu Arg Leu Ala Ala Asp Asp Asp Gln Phe Thr

260 265 270

Thr Ile Ala Lys Met Arg Ala Val Arg Arg Leu Trp Ala Arg Val Ala

275 280 285

Glu Val Ile Gly Ala Pro Glu Ala Gly Ala Val Thr Val His Ala Val

290 295 300

Thr Ser Ala Pro Met Met Ser Gln Arg Asp Pro Trp Val Asn Met Leu

305 310 315 320

Arg Thr Thr Leu Ala Ala Phe Gly Ala Gly Val Gly Gly Ala Asp Thr

325 330 335

Val Leu Val Gln Pro Phe Asp Ala Ala Ile Pro Gly Gly Leu Pro Gly

340 345 350

Thr Ala Thr Ser Phe Thr Arg Arg Met Ala Arg Asn Thr Gln Leu Leu

355 360 365

Leu Leu Glu Glu Ser His Leu Gly Lys Val Leu Asp Pro Gly Ala Gly

370 375 380

Ser Trp Phe Ile Glu Asp Leu Thr Val Gln Leu Ala Glu His Ala Trp

385 390 395 400

Ala His Phe Gln Asp Leu Glu Ser Arg Gly Gly Leu Thr Ala Ala Arg

405 410 415

Asp His Leu Asp Glu Gln Ile Ala Thr Val Arg Gly Gln Arg Ala Ala

420 425 430

Asp Ile Ala His Arg Arg Thr Ser Leu Thr Gly Val Asn Glu Phe Pro

435 440 445

Asn Leu Ala Glu Lys Pro Leu Pro Ala Gly Ser Arg Ala Glu Glu Ser

450 455 460

Ala Arg Ile Tyr Arg Tyr Ala Ala Glu Phe Glu Ala Leu Arg Asp Arg

465 470 475 480

Ser Asp Ala Tyr Leu Ala Glu His Gly Thr Arg Pro Gln Ala Val Leu

485 490 495

Leu Pro Leu Gly Pro Leu Ala Glu His Asn Ile Arg Thr Thr Phe Ala

500 505 510

Ala Asn Leu Leu Ala Ser Gly Gly Ile Glu Thr Val Asn Pro Gly Thr

515 520 525

Val Asp Pro Ala Gly Val Ala Ala Ala Val Gly Thr His Thr Val Ala

530 535 540

Val Ile Cys Gly Thr Asp Ala Arg Tyr Gly Thr Glu Val Ser Asp Ile

545 550 555 560

Ala Ala Ala Ala Arg Ala Ala Gly Ile Thr His Leu Tyr Leu Ala Gly

565 570 575

Pro Glu Lys Ser Val Ala Glu Ala Thr Ala Lys Pro Asp Glu Tyr Leu

580 585 590

Thr Ala Lys Ile Asn Ala Val Glu Ala Leu Ser Thr Leu Leu Thr Arg

595 600 605

Leu Gly Ala

610

<210>11

<211>2265

<212>DNA

<213> Mycobacterium new (M3M sp. M)

<400>11

atgacgtcaa cggagaagac cgaaacggcg gccatcgcca gcttcgccga tgtgccgctg 60

cagggggaca ccaccccggc cgcagccacc gccgaaggtg tcgccgagct ggccgccggg 120

gccgccgcgg cacacggcta cacccccgaa caactggtgt gggcgacgcc ggagggcatc 180

gacgtcaagc cggtctacat cgccgccgac cgtgaccagg ccgccgccgc cggatatccg 240

gtggacagct tccccggcga cccgccgttc atccgcgggc cctacccgac gatgtacgtc 300

aaccagccat ggacgatccg ccagtacgcc ggtttctcca ccgcggccga gtccaacgcc 360

ttctaccggc gcaacctggc cgccggtcag aagggtctgt cggtcgcctt cgatctggcc 420

acccaccgcg gttacgactc cgaccatccg cgggtcgccg gcgatgtcgg tatggcgggt 480

gtggccatcg attcgatcct ggacatgcgc caactcttcg acggtatcga cctgggcagc 540

gtgtcggtct cgatgacgat gaacggcgcg gtgctgccga tcctggcgct ctacgtggtg 600

gccgccgagg agcagggggt ggctccggag aaactggccg ggaccatcca gaacgacatc 660

ctcaaagagt tcatggtccg caacacctac atctacccgc ccaaaccgtc gatgcggatc 720

atctccgaca tcttcggcta caccagcgcc aagatgccga agttcaacag catctcgatc 780

tcgggttacc acatccagga ggcgggcgcg acggccgatc tggagctggc ctacacgctg 840

gccgacggcg tcgagtacat caaggcgggc ctggacgccg gcctggacat cgacaagttc 900

gcaccgcggc tgtccttctt ctggggcatc gggatgaact tcttcatgga ggtggccaag 960

ctgcgtgccg gccggctgct gtggagtgag ctggtttcgc aattcgaccc gaagagctcc 1020

aaatcgcttt ccctgcgcac ccattcgcag acctcgggtt ggtcgttgac cgcgcaggac 1080

gtcttcaaca acgtcgcgcg cacctgtgtg gaggcgatgg ccgccaccca ggggcacacc 1140

cagtcgttgc acaccaacgc cctcgacgag gcgctggcgc tgccgaccga cttctccgct 1200

cggatcgccc gcaacaccca gctgttgctg cagcaggagt cgggcacgac gcggccgatc 1260

gatccgtggg gtggctcgta ttacgtcgag tggctgaccc atcagctcgc cgaccgggcc 1320

agggcacata tcgaggaggt cgccgaatac ggcggcatgg cccaggccat cgacgcgggc 1380

atccccaaga tgcgcatcga ggaggccgcc gcgcgcaccc aggcacgcat cgactccggt 1440

gtgcaggcac tgatcggtgt gaacaagtac caggtcgccg aggatcagga gatcgaggtc 1500

ctcaaggtcg agaacagccg ggtgcgcgcc gaacagctgg ccaagctgga gcgcctccgt 1560

tcggaaagag atgagcacgc cacccaggcc gcgcttgccg aattgacccg tgccgctggg 1620

gagaacgtgg ccaccgggga ggatggtctc ggcaacaacc tgatggcgct ggccatcaac 1680

gcggcccgcg cccacgccac cgtcggtgag atatccgatg cgttggagaa ggtgtacggc 1740

cgtcatgtcg cggagatccg caccatctcc ggcgtgtatc gcgacgaggt cgggaaggct 1800

ggcaacgtga gtaccgcgac ggatctggtg gagcgcttcg ccgaggccga cggacgacgt 1860

ccgcgcatcc tggtggccaa gatgggccag gacggacacg accgcggaca gaaggtgatc 1920

gcgacggcat tcgccgatat cggcttcgac gtggacgtcg gttcgctgtt ctccactccg 1980

gacgaggtgg cccgccaggc cgccgacaac gacgtgcacg tcgtcggggt gtcctcgctg 2040

gctgccggtc acctcacgtt ggtgcccgca ctgcgcgacg cgctggccga ggtgggtcgc 2100

ccggacatca tggtcgtggt gggcggggtc atcccgcccg gcgacttcga cgagttgtat 2160

gccgcgggtg ccaccgcgat cttcccgccg ggaaccgtga tcgccgatgc agcgatcggc 2220

ctgctgcaca agctggccga gcgactcggg tacagcctgg cttga 2265

<210>12

<211>754

<212>PRT

<213> Mycobacterium new (M3M sp. M)

<400>12

Met Thr Ser Thr Glu Lys Thr Glu Thr Ala Ala Ile Ala Ser Phe Ala

1 5 10 15

Asp Val Pro Leu Gln Gly Asp Thr Thr Pro Ala Ala Ala Thr Ala Glu

20 25 30

Gly Val Ala Glu Leu Ala Ala Gly Ala Ala Ala Ala His Gly Tyr Thr

35 40 45

Pro Glu Gln Leu Val Trp Ala Thr Pro Glu Gly Ile Asp Val Lys Pro

50 55 60

Val Tyr Ile Ala Ala Asp Arg Asp Gln Ala Ala Ala Ala Gly Tyr Pro

65 70 75 80

Val Asp Ser Phe Pro Gly Asp Pro Pro Phe Ile Arg Gly Pro Tyr Pro

85 90 95

Thr Met Tyr Val Asn Gln Pro Trp Thr Ile Arg Gln Tyr Ala Gly Phe

100 105 110

Ser Thr Ala Ala Glu Ser Asn Ala Phe Tyr Arg Arg Asn Leu Ala Ala

115 120 125

Gly Gln Lys Gly Leu Ser Val Ala Phe Asp Leu Ala Thr His Arg Gly

130 135 140

Tyr Asp Ser Asp His Pro Arg Val Ala Gly Asp Val Gly Met Ala Gly

145 150 155 160

Val Ala Ile Asp Ser Ile Leu Asp Met Arg Gln Leu Phe Asp Gly Ile

165 170 175

Asp Leu Gly Ser Val Ser Val Ser Met Thr Met Asn Gly Ala Val Leu

180 185 190

Pro Ile Leu Ala Leu Tyr Val Val Ala Ala Glu Glu Gln Gly Val Ala

195 200 205

Pro Glu Lys Leu Ala Gly Thr Ile Gln Asn Asp Ile Leu Lys Glu Phe

210 215 220

Met Val Arg Asn Thr Tyr Ile Tyr Pro Pro Lys Pro Ser Met Arg Ile

225 230 235 240

Ile Ser Asp Ile Phe Gly Tyr Thr Ser Ala Lys Met Pro Lys Phe Asn

245 250 255

Ser Ile Ser Ile Ser Gly Tyr His Ile Gln Glu Ala Gly Ala Thr Ala

260 265 270

Asp Leu Glu Leu Ala Tyr Thr Leu Ala Asp Gly Val Glu Tyr Ile Lys

275 280 285

Ala Gly Leu Asp Ala Gly Leu Asp Ile Asp Lys Phe Ala Pro Arg Leu

290 295 300

Ser Phe Phe Trp Gly Ile Gly Met Asn Phe Phe Met Glu Val Ala Lys

305 310 315 320

Leu Arg Ala Gly Arg Leu Leu Trp Ser Glu Leu Val Ser Gln Phe Asp

325 330 335

Pro Lys Ser Ser Lys Ser Leu Ser Leu Arg Thr His Ser Gln Thr Ser

340 345 350

Gly Trp Ser Leu Thr Ala Gln Asp Val Phe Asn Asn Val Ala Arg Thr

355 360 365

Cys Val Glu Ala Met Ala Ala Thr Gln Gly His Thr Gln Ser Leu His

370 375 380

Thr Asn Ala Leu Asp Glu Ala Leu Ala Leu Pro Thr Asp Phe Ser Ala

385 390 395 400

Arg Ile Ala Arg Asn Thr Gln Leu Leu Leu Gln Gln Glu Ser Gly Thr

405 410 415

Thr Arg Pro Ile Asp Pro Trp Gly Gly Ser Tyr Tyr Val Glu Trp Leu

420 425 430

Thr His Gln Leu Ala Asp Arg Ala Arg Ala His Ile Glu Glu Val Ala

435 440 445

Glu Tyr Gly Gly Met Ala Gln Ala Ile Asp Ala Gly Ile Pro Lys Met

450 455 460

Arg Ile Glu Glu Ala Ala Ala Arg Thr Gln Ala Arg Ile Asp Ser Gly

465 470 475 480

Val Gln Ala Leu Ile Gly Val Asn Lys Tyr Gln Val Ala Glu Asp Gln

485 490 495

Glu Ile Glu Val Leu Lys Val Glu Asn Ser Arg Val Arg Ala Glu Gln

500 505 510

Leu Ala Lys Leu Glu Arg Leu Arg Ser Glu Arg Asp Glu His Ala Thr

515 520 525

Gln Ala Ala Leu Ala Glu Leu Thr Arg Ala Ala Gly Glu Asn Val Ala

530 535 540

Thr Gly Glu Asp Gly Leu Gly Asn Asn Leu Met Ala Leu Ala Ile Asn

545 550 555 560

Ala Ala Arg Ala His Ala Thr Val Gly Glu Ile Ser Asp Ala Leu Glu

565 570 575

Lys Val Tyr Gly Arg His Val Ala Glu Ile Arg Thr Ile Ser Gly Val

580 585 590

Tyr Arg Asp Glu Val Gly Lys Ala Gly Asn Val Ser Thr Ala Thr Asp

595 600 605

Leu Val Glu Arg Phe Ala Glu Ala Asp Gly Arg Arg Pro Arg Ile Leu

610 615 620

Val Ala Lys Met Gly Gln Asp Gly His Asp Arg Gly Gln Lys Val Ile

625 630 635 640

Ala Thr Ala Phe Ala Asp Ile Gly Phe Asp Val Asp Val Gly Ser Leu

645 650 655

Phe Ser Thr Pro Asp Glu Val Ala Arg Gln Ala Ala Asp Asn Asp Val

660 665 670

His Val Val Gly Val Ser Ser Leu Ala Ala Gly His Leu Thr Leu Val

675 680 685

Pro Ala Leu Arg Asp Ala Leu Ala Glu Val Gly Arg Pro Asp Ile Met

690 695 700

Val Val Val Gly Gly Val Ile Pro Pro Gly Asp Phe Asp Glu Leu Tyr

705 710 715 720

Ala Ala Gly Ala Thr Ala Ile Phe Pro Pro Gly Thr Val Ile Ala Asp

725 730 735

Ala Ala Ile Gly Leu Leu His Lys Leu Ala Glu Arg Leu Gly Tyr Ser

740 745 750

Leu Ala

<210>13

<211>1218

<212>DNA

<213> Mycobacterium new (M3M sp. M)

<400>13

atgtcaacag tcggccgccc ggtgccggct ggtaggcgtg ctcccgaccg cagggcgcag 60

atcgtgaagg cctccgcgga cgcgttcagc gcgctcggat accacgcggt cagcatggag 120

gacatcgcat cgcgggtcgg catctccgcg gccgcgttgt accggcactc gccgggcaag 180

tacgagctgt tccgcgaggc ggtggtcgcg ttgggacagc agctggtgga cggtaccgag 240

atcatcgatc cggatgccga tccggcgatc caactcgacg acctggtggg cgccctggtc 300

gacatcgtca tcgccaaccg tagctccgga ggcctgtacc gctgggaggg ccggtatctc 360

aacgatgacg accaggccgt cctgaacggg cagatcgagc tggtcaaccg acgcctgcaa 420

caaccgttga agcagctgcg cccgcagctc acctcgcggg aacgctggac gctgtcctcg 480

gcggccatca gcgtgatcgg cagcatcacc gaccaccgtg ccgcgctgcc gatcggcgag 540

ttgcgcaccc tgatggcggg cctggcatcg gcggtgctgt gggcggagct gcccgccccc 600

gccgaatccg gcgagccggt ccggccgctg cgcagcggtg ccgccgtcgg cggcaagtac 660

gagatcctgt tgcacgaatc gctgctgctg ttccaccgca agggttttcg ggaaaccagt 720

gtggaggaca tcgccgcggc cgcgggcatg caaccctcgg gcatctatcg gttcttcccg 780

agcaagggtg acatcctggc cgcgtcctat cggcgcagcg ccgacagggt gtccggggac 840

atctccagtg tccttgccgt gcaacgggat ccggaacgag cgctggccga actggtgcgc 900

cgttacgtcg accgttcctt cggtgatccc gaattggcct atgtgtatta caccgagcgc 960

accaacgttc ccgaggctga ccgcatggtg ctgcgcaaca tccaacgcgc caccgtcgac 1020

gagtgggcgc gcctgctgtc cgaggtccga accgaattca gccacgccca agcacgtttc 1080

gccgtgcacg ccgcgttcgg cctggtggtc gacctgggtc ggctggtaca ccatgaggac 1140

accgcgcatt cgcgggccgg tgtccggctg ctgatggaac tgacgctgct gggccgaccg 1200

tcgcggtcgc tcagctga 1218

<210>14

<211>405

<212>PRT

<213> Mycobacterium new (M3M sp. M)

<400>14

Met Ser Thr Val Gly Arg Pro Val Pro Ala Gly Arg Arg Ala Pro Asp

1 5 10 15

Arg Arg Ala Gln Ile Val Lys Ala Ser Ala Asp Ala Phe Ser Ala Leu

20 25 30

Gly Tyr His Ala Val Ser Met Glu Asp Ile Ala Ser Arg Val Gly Ile

35 40 45

Ser Ala Ala Ala Leu Tyr Arg His Ser Pro Gly Lys Tyr Glu Leu Phe

50 55 60

Arg Glu Ala Val Val Ala Leu Gly Gln Gln Leu Val Asp Gly Thr Glu

65 70 75 80

Ile Ile Asp Pro Asp Ala Asp Pro Ala Ile Gln Leu Asp Asp Leu Val

85 90 95

Gly Ala Leu Val Asp Ile Val Ile Ala Asn Arg Ser Ser Gly Gly Leu

100 105 110

Tyr Arg Trp Glu Gly Arg Tyr Leu Asn Asp Asp Asp Gln Ala Val Leu

115 120 125

Asn Gly Gln Ile Glu Leu Val Asn Arg Arg Leu Gln Gln Pro Leu Lys

130 135 140

Gln Leu Arg Pro Gln Leu Thr Ser Arg Glu Arg Trp Thr Leu Ser Ser

145 150 155 160

Ala Ala Ile Ser Val Ile Gly Ser Ile Thr Asp His Arg Ala Ala Leu

165 170 175

Pro Ile Gly Glu Leu Arg Thr Leu Met Ala Gly Leu Ala Ser Ala Val

180 185 190

Leu Trp Ala Glu Leu Pro Ala Pro Ala Glu Ser Gly Glu Pro Val Arg

195 200 205

Pro Leu Arg Ser Gly Ala Ala Val Gly Gly Lys Tyr Glu Ile Leu Leu

210 215 220

His Glu Ser Leu Leu Leu Phe His Arg Lys Gly Phe Arg Glu Thr Ser

225 230 235 240

Val Glu Asp Ile Ala Ala Ala Ala Gly Met Gln Pro Ser Gly Ile Tyr

245 250 255

Arg Phe Phe Pro Ser Lys Gly Asp Ile Leu Ala Ala Ser Tyr Arg Arg

260 265 270

Ser Ala Asp Arg Val Ser Gly Asp Ile Ser Ser Val Leu Ala Val Gln

275 280 285

Arg Asp Pro Glu Arg Ala Leu Ala Glu Leu Val Arg Arg Tyr Val Asp

290 295 300

Arg Ser Phe Gly Asp Pro Glu Leu Ala Tyr Val Tyr Tyr Thr Glu Arg

305 310 315 320

Thr Asn Val Pro Glu Ala Asp Arg Met Val Leu Arg Asn Ile Gln Arg

325 330 335

Ala Thr Val Asp Glu Trp Ala Arg Leu Leu Ser Glu Val Arg Thr Glu

340 345 350

Phe Ser His Ala Gln Ala Arg Phe Ala Val His Ala Ala Phe Gly Leu

355 360 365

Val Val Asp Leu Gly Arg Leu Val His His Glu Asp Thr Ala His Ser

370 375 380

Arg Ala Gly Val Arg Leu Leu Met Glu Leu Thr Leu Leu Gly Arg Pro

385 390 395 400

Ser Arg Ser Leu Ser

405

Claims (9)

1. A prodrug-producing bacterium which is constructed by expressing at least one of the genes encoding PCCA, PCCB, PCCC, MCEE, MTUA or MTUB in a bacterial or fungal host cell having a prodrug-producing ability and/or knocking out the gene expressing PCCD.

2. An steroid precursor producing bacterium according to claim 1, wherein said steroid precursor is androst-4-ene-3,17-dione, 9 α -hydroxyandrost-4-ene-3,17-dione, androst-1,4-diene-3,17-dione or an A-ring degradant.

3. A pro-steroid producing bacterium according to claim 1, wherein the host cell is Escherichia coli BL21 strain, Bacillus subtilis (Bacillus subtilis), Mycobacterium (Mycobacterium sp.) NRRLB-3683, Mycobacterium (Mycobacterium sp.) NRRLB-3805, Mycobacterium smegmatis (Mycobacterium smegmatis), Mycobacterium fortuitum (Mycobacterium fortuitum), Mycobacterium microflavus (Mycobacterium gilvum), Mycobacterium neoformans (Mycobacterium neoaurum), Mycobacterium Phlei (Mycobacterium Phlei) or Mycobacterium avium (Mycobacterium avium).

4. A pro-steroid producing bacterium according to claim 3, wherein the host cell is Mycobacterium neogold (Mycobacterium sp.) MNR M3.

5. A pro-steroid producing bacterium according to claim 1, wherein the expression vector used for gene expression is a PET expression vector, a plasmid pWB980, pMV306, PFZ36, pAL5000, pFZ2, pMV261 or a vector containing all or part of the sequence of a plasmid p2NIL, pGO19, or a plasmid containing a CRISPR-Cas system.

6. A steroid precursor producing bacterium according to claim 1, wherein the gene knockout vector is used for knocking out a gene encoding PCCD.

7. A pro-steroid producing bacterium according to claim 4, wherein the genes expressing PCCA, PCCB, PCCC, MCEE, MTUA and MTUB are pccA, pccB, pccC, MCEE, mtuA and mtuB, respectively, and the nucleotide sequences are shown in SEQ ID Nos. 1, 3, 5, 7, 9 and 11 of the sequence Listing; the gene for expressing the PCCD is pccD, and the nucleotide sequence is shown in a sequence table SEQ ID NO. 13.

8. Use of a steroid precursor producing bacterium according to any one of claims 1 to 7 in the production of a steroid precursor.

9. The use according to claim 8, characterized in that the use in the production of androst-4-ene-3,17-dione is specified below:

inoculating 2-10% inoculum size of steroid precursor production strain seed culture solution into fermentation culture medium, and culturing at 25-35 deg.C and 50-200rpm for 24-168 hr;

the fermentation medium comprises the following components: k₂HPO₄0.1-3g/L，MgSO₄0.1-3g/L, 0.01-0.2g/L ferric ammonium citrate, 1-5g/L citric acid, 1-10g/L diammonium hydrogen phosphate, 5-50g/L glucose, 1-50g/L phytosterol and the balance of water, wherein the pH value is 6.0-7.5.

Images