CN110452918A - A kind of molecular method for formulating high-perfume type petunia new germ plasm - Google Patents

A kind of molecular method for formulating high-perfume type petunia new germ plasm Download PDF

Info

Publication number
CN110452918A
CN110452918A CN201910811769.4A CN201910811769A CN110452918A CN 110452918 A CN110452918 A CN 110452918A CN 201910811769 A CN201910811769 A CN 201910811769A CN 110452918 A CN110452918 A CN 110452918A
Authority
CN
China
Prior art keywords
jstps4
petunia
procblis
fragrance
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910811769.4A
Other languages
Chinese (zh)
Other versions
CN110452918B (en
Inventor
袁媛
何弦
张月
伍炳华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fujian Agriculture and Forestry University
Original Assignee
Fujian Agriculture and Forestry University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fujian Agriculture and Forestry University filed Critical Fujian Agriculture and Forestry University
Priority to CN201910811769.4A priority Critical patent/CN110452918B/en
Publication of CN110452918A publication Critical patent/CN110452918A/en
Application granted granted Critical
Publication of CN110452918B publication Critical patent/CN110452918B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/60—Vectors containing traps for, e.g. exons, promoters

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Nutrition Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The purpose of the present invention is to provide a kind of molecular methods for formulating high-perfume type petunia.Implementation method of the present invention: the purpose of the present invention is to provide a kind of molecular methods for formulating high-perfume type petunia new germ plasm.This method can specifically obtain the height expression of fragrance synthase gene, synthesis, fragrance synzyme including promoter with the means of genetic transformation in petunia petalTPSThe amplification of (Terpene synthase) gene, expression vector establishment.Simultaneously by genetic manipulation leading-in petunia plant, the transgenic plant that fragrance significantly increases is obtained.It is characterized in that, artificial synthesized flower specific promoter, the crucial synthase gene of jasmine fragrance can be synthesized with its startingTPSIt is expressed in petunia flower, the rotating into because of plant to exist compared with the control in fragrance content of acquisition significantly improves.

Description

A kind of molecular method for formulating high-perfume type petunia new germ plasm
Technical field
The invention belongs to technical field of molecular biology, and in particular to a kind of molecule for formulating high-perfume type petunia new germ plasm Technology.
Background technique
Fragrance is the Horticultural Traits of gardening plant, it can not only assign ornamental plant specific odor characteristics, is determined Its economy and landscape application value are attracting insect pollinator, and cover crop is from biology and abiotic stress, mediated plant-plant Communication between object etc. equally plays a significant role, most important to plant life and procreation.Important work based on fragrance With being the importance of garden crop breeding work using molecular breeding means innovation odor type germplasm.
Jasmine is famous fragrant plant and spice crop, and fragrance faint scent is pleasant, refreshing, is more had by its scenting " jasmine tea " gain national fame, reflect the unique distinction of its fragrance.Petunia modern times Hybrid with the fragrance of a flower (Petunia hybrida) substantiallyP. axillarisOffspring, their fragrance of a flower volatile component is phenyl ring class chemical combination Object derives from phenylalanine metabolic pathway.By Jasmine characteristic fragrance synthesis key gene by flower specific promoter short It leads a cow special expression in floral organ, new/high-perfume type germplasm can be obtained.
Summary of the invention
The purpose of the present invention is to provide a kind of molecular methods for formulating high-perfume type petunia new germ plasm.This method is with heredity The means of conversion can specifically obtain the height expression of fragrance synthase gene, including promoter in petunia petal Synthesis, fragrance synzymeTPSThe amplification of (Terpene synthase) gene, expression vector establishment.Pass through heredity behaviour simultaneously Make leading-in petunia plant, obtains the transgenic plant that fragrance significantly increases.It is characterized in that, artificial synthesized flower specific starting Son can synthesize the crucial synthase gene of jasmine fragrance with its startingTPSIt is expressed in petunia flower, acquisition rotates into It is significantly improved because plant exists compared with the control in fragrance content.
The present invention is achieved by the following technical solutions:
1, pK7FWG2.0- proCbLIS is constructed:JsTPS4Expression vector
(1) flower specific promoter sequence is synthesized.
Building commission Invitrogen (Shanghai) Trading Co., Ltd. synthesizes flower specific promoter proCbLIS nucleotides sequence It arranges (GeneBank accession number AF067601.1).
(2) pK7FWG2.0- proCbLIS empty carrier is constructed.
Flower specific promoter proCbLIS is passed through unidirectional restriction endonuclease sites by the method connected using digestionSPe I andSacI displaces the CaMV35S promoter of expression vector pK7FWG2.0, obtains the pK7FWG2.0- of reconstruct ProCbLIS expression vector.
(3) amplification Jasmine fragrance synthesizes key geneJsTPS4Coded sequence.
Jasmine petal total serum IgE is extracted, using RACE(SMARTerTM RACE cDNA Amplification Kit, Clontech Laboratories, Inc.) kit expands to obtainJsTPS45 ' and 3 ' cDNA sequences, obtained after splicing CDNA overall length,And obtain its coded sequence.
(4) pK7FWG2.0- proCbLIS is constructed:JsTPS4Expression vector
It willJsTPS4Coded sequence is cloned into pENTR/D-TOPO carrier (Invitrogen) and obtains TOPO- JsTPS4Centre carries Body recycles LR enzyme (Gateway LR Clonase Π Enzyme Mix, Invitrogen) by TOPO- JsTPS4In Carrier carries out displacement with pK7FWG2.0-proCbLIS carrier and reacts, and makesJsTPS4Sequence substitutions enterproCbLISPromoter it Under, obtain pK7FWG2.0- proCbLIS:JsTPS4Expression vector.
2、PK7FWG2.0- proCbLIS:JsTPS4Expression vector converts petunia
(1) the petunia Callus of Leaf for conversion is obtained
The petunia plant leaf of clip vigorous growth is softly cleaned up in tap water.The side of suitable size is cut into after disinfection Block be placed in solid pre-culture medium (4.43g/L MS powder+20g/L sucrose+6g/L agar+2mg/L 6-BA+0.2mg/L NAA, PH=5.8) on carry out preculture, rear blade arches upward within 3-4 days, and blade wound tissue prepares dip dyeing when expanding.
(2) pK7FWG2.0-LisPro:JsTPS4Convert petunia callus
By pK7FWG2.0-LisPro:JsTPS4Plasmid by PCR by being detected as in freeze-thaw method conversion Agrobacterium (GV3101) After positive colony, using the LB culture medium containing Spe, Rif, Gm antibiotic in 28 DEG C of cultures to OD=0.8, then 4000rmp, 4 DEG C centrifugation 15min, remove supernatant, add isometric re-suspension liquid (+150 μM of AS of 1/2MS fluid nutrient medium) and be resuspended.It is super In net platform, the petunia blade after preculture being put into infected liquid and impregnates 10 min, taking-up is placed on suck dry moisture on filter paper, It is subsequently placed in and co-cultures base (4.43g/L MS powder (M519)+20g/L sucrose+8g/L agar+2mg/L 6-BA+0.2mg/L NAA+15mg/L AS, pH=5.8) on, in tissue culture room shading culture 2 ~ 3 days.To prevent Agrobacterium from polluting culture medium, training It supports primary surface and overlays one layer of sterilizing filter paper.
(3) acquisition of transgenic petunia
It uses the sterile water containing cephalo (300mg/L) gently to shake in the blade after co-cultivation and cleans 15 min, after sterile water wash 3 times Surface moisture is blotted on filter paper, is placed in differential medium (4.43g/L MS powder+20g/L sucrose+8g/L agar+2mg/L 6- BA+0.2mg/L NAA+300mg/L Cef+100mg/L Kan, pH=5.8) culture.
It is that 4 ~ 5 cm are transferred to root media (2.215g/L when having 4 ~ 5 leaves when differentiation seedling grows into height MS+10g/L sucrose+6g/L agar+0.1mg/L IBA+0.1mg/L NAA+300mg/L cef, pH=5.8) It is cultivated, flourishing root system can be grown within 4 weeks or so, be transplanted in aseptic substrate grow later.Plant after transplanting is placed in people Work climatic chamber is cultivated, and light application time is day night=16h/8h, and temperature is day night=24 DEG C/20 DEG C, humidity 70%.
3, the identification of transgenic petunia and the detection of flower fragrance component
(1) identification of positive strain
Transgenic petunia leaf tissue is extracted, DNA is extracted, carries out PCR verifying screening transgenic positive plant with Kana primer.
(2) measurement of aroma substance
The florescence is initially entered to transgenic petunia, the flower for taking multiple single plants pollen occur carries out fragrance ingredient detection, with phase It is grown under inoculation, identical environment between simultaneously and the rigid flower of non-transgenic petunia of identical degree of opening is control.
The petal samples of 0.3 g are abundant with liquid nitrogen Yan Mo, it is transferred to 1.5 ml normal hexanes (chromatographic grade, Sigma) reagent In [containing concentration be 1 ug/ml internal standard isobutyl-benzene (Isobutyl benzene)], room temperature be vortexed 2 h, 13000 rpm 10 min are centrifuged, supernatant is taken, using 0.45 μm of organic membrane filter, filtered solution can be used to detect.
It is measured and is extracted using gas chromatograph-mass spectrometer (GC-MS) (8 model of PerkinElemer company, U.S. Clarus SQ) Fragrance component and content in object, chromatographic column are HP-5 chromatographic column (mm × 0.25 μm 30 m × 0.25).Electron bombardment (EI) ion source, mass scan range: 40 × 500 amu.Qualitative analysis: by the mass spectral results of acquisition in 11.0 matter of NIST Retrieval initial characterization, then the retention index with them are carried out in modal data library (11.0 MS data library of NIST) (retention indices, RIs) is compared.Quantitative analysis: with target concentration interior in extract solution and corresponding peak face Product calculates the relatively interior target content of each component, and the multiple proportion of same components in different samples, is that the multiple after Internal standard correction methods closes System.
Beneficial effects of the present invention:
The total fragrance component of petunia flower obtained using the invention, especially Ergol (Benzyl Benzoate) and Methyl benzoate (Methyl benzoate) content is significantly improved, and can obtain new high-perfume type petunia germplasm.The skill Ratio of the high-perfume type petunia plant that art obtains in post-conversion in reaches 50% or more.
Detailed description of the invention
Fig. 1 is transgenic petunia plant (LisPro:JsTPS4) and wild type petunia plant (WT) flower fragrance GC- The TIC figure of MS detection.
Fig. 2 is transgenic petunia plant (LisPro:JsTPS4) always fragrant compared to wild type petunia plant (WT) flower Gas content and Ergol (Benzyl Benzoate) and benzoic acid (Benzoic acid) content difference, * is indicated in figure There were significant differences compared with wild type (T-test, n=3, P < 0.05).
Specific embodiment
Present invention will be further explained below with reference to specific examples.Test method without specific conditions in embodiment, Usually according to normal condition, such as the molecular clonings such as Sambrook: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in
Embodiment 1, building pK7FWG2.0- proCbLIS:JsTPS4Expression vector
(1) flower specific promoter is synthesized
Invitrogen (Shanghai) Trading Co., Ltd. is entrusted to synthesize flower specific promoter proCbLIS(GeneBank accession number AF067601.1) nucleotide sequence, sequence both ends are respectively provided with oneSPe I andSacI restriction enzyme site.
Flower specific promoter proCbLIS sequence is as follows, and dashed part is restriction enzyme site:
GAGCTCGCGGCCGCAAGCTTATCTAATAATGTATCAAAATCTAAAATAAAATTTAGGTTAAGAAGTGGGTGC AATTTGTTAGGCACCCACTTCTTAATGATCCATGTGTAATGTTTGTTAGGCACGCTAAGCTGGAGTGCACATTATT TGTTGGCTTTGTCTTGATGTGGTAATTTTATTTTTGCCAAATTATCACGTATATTTGCCCGATCGGGCATTCTAAT ATCTAATCTAAAAATATAATTTTAAGTTAGATAATAATATCTTACGAAATAAACATTTATAATATTTAAAACTAAT ATTAACTTTTGTCCTTCAAATATTTATTATCGTGTCTTACGTAACACACGAGGTGATTATATATAAATTTAAAACG AATCACAGAAAAATTTATGTCATTAAATAATTATTGATATATATTTTATTTAATTTACTATAATATTATCTACTCG AATCATAATTTTTTTAAGGTATTTTGATTTACAAACGGTTTATTTCAAGTAAAAAACATTTTGGAATGAACATGGA TTATATAACATTTCGAACAAGCGTACACCATAAGAAGTTAATTAACAATAATGTGTATATGTTTGTTTAATATATT AATTTAGAAAATGAATTTATATATGATGGTCGAGTGATTGATAATATAATACAAATATACAAGTTTCATTTAATAT GCGCGGGTTAGTGGCTAGTTCAAATTACTTCATGAGCTTTTCTATTCAAACATTTACTATTGCATAAGCTGACCCA ACTCTTGTATTAACCCTTATAAATTTAAATGATCAGTTTGACCATGACAGATTATATTAATTCCGATTAGATTAAT TAATTTATTATAATTGGCAATTAAAACTCATTTATTATATATTATGTATAGTAATAAAATAATTGATGATGTTAGG ATGGAAGGGACGGGAGATGAGTGCAGTAATTAAATTAAGGCCACATCCTATCATATCCCAGTCTATAAATACAGAT CCAGATCCACTTCATATAAGCAAGCTATCTTCCCAGAAAACCAAACCACCTTAAACAAGACAACCATCTCGAGCCC GGGACTAGT。
(2) pK7FWG2.0- proCbLIS empty carrier is constructed
It usesSPe I andSacI enzyme (Thermal) by proCbLIS promoter sequence and expression vector pK7FWG2.0 respectively into Row double digestion is removed 35S initiating sequence on pK7FWG2.0 carrier, and is suitable for and proCbLIS promoter sequence phase Match.50 μ l of digestion system includes 5 μ l Digest buffer, 2 μ l Spe I、2μl SacI, 1 μ gPK7FWG2.0Or 1 μ G proCbLIS promoter sequence and ddH2O, 37 DEG C of 15 min of reaction.Carrier after digestion and promoter sequence are returned respectively It receives (Axygen PCR clean Kit), after electrophoresis detection is errorless, is attached using T4 ligase (Takara).Linked system For 10 μ l, including after 1 μ l T4 ligase, 1 μ l 10 × ligation buffer, digestion proCbLIS promoter sequence, PK7FWG2.0 carrier sequence after digestion, wherein proCbLIS promoter sequence and carrier also can molar ratio 3:1 to 10:1 it Between (volume is depending on concentration), 16 DEG C connection overnight.Connection product is connected with Easy-Blunt carrier (Beijing Quan Shijin), is turned Change E. coli competent, be coated with Amp resistant panel, picking monoclonal is simultaneously cultivated, drawn using sequence characteristic is started Object (F:5 '-TCTATAAATACAGATCCAGATCCACTTC-3 '；R:5 '-AGCTTGCCGTAGGTGGCATCG-3 ') it carries out PCR detection.Plasmid is extracted from the bacterium solution of the PCR positive, is reusedSpeI andSacI enzyme carries out double digestion, and detection digestion produces Whether object, verifying proCbLIS promoter have successfully replaced the CaMV35S promoter of PK7FWG2.0.Verifying is positive Plasmid send sequencing, veritifies the accuracy of sequence.So far, flower specific promoter proCbLIS successfully displaces expression vector The CaMV35S promoter of pK7FWG2.0 obtains the pK7FWG2.0-proCbLIS expression vector of reconstruct.
(3) amplification Jasmine fragrance synthesizes key geneJsTPS4Coded sequence
Well-grown is selected, the jasmine petal (3 petals of mixing) of no disease and pests harm utilizes TransZol Up Plus Rna Kit (the full formula gold biology in Beijing) extracted total RNA.With the integrality of electroresis appraisal RNA, the pure of RNA is then measured on spectrophotometer Degree and concentration.
Use SMARTerTMRACE cDNA Amplification Kit(Clontech Laboratories, Inc.) Carry out cDNA full-length clone.5 ' terminal sequences are obtained: first using 5 ' RACE ready cDNA as template by two wheel nest-type PRCs Wheel: UPM+JsTPS4-5-1(5 '-GCTGAGGCTTCAAGAGCGGCATCG -3 ');Second wheel: NUP+JsTPS4-5- 2(5 '-ATGGTCAAGATGATCGAGTCGAGCGA -3 ').3 ' terminal sequences pass through using 3 ' RACE ready cDNA as template Two wheel nest-type PRCs obtain: the first round: UPM+JsTPS4-3-1(5 '-GGCGGATTTTGGGGCGAGATAGACG -3 '); Second wheel: NUP+JsTPS4-3-2(5 '-TGACACCCACATACAATGTTGACCCG -3 '), response procedures are according to explanation Book executes.UPM and NUP provide for kit, and 5 ' and 3 ' RACE sequences are separately recovered, and connection easy-blunt cloning vector is simultaneously E. coli competent DH5 α is converted, 50 μ g/ml Amp plates are coated with, monoclonal is chosen and carries out bacterium solution PCR verifying, positive bacterium solution Send sequencing.Sequencing result is by carrying out BLAST(http: //blast.ncbi.nlm.nih.gov/ in the website NCBI) it compares Some databases (GenBank), nucleic acid sequence and coding albumen and other species terpene synzyme homologys are high.
5 ' and 3 ' sequences are spliced and BLAST is submitted to analyze, and combine the ORF Finding(http of NCBI: // Www.ncbi.nlm.nih.gov/gorf it) predicts, obtains the coded sequence of 2535 bp Jasmine JsTPS4 albumen.
(4) pK7FWG2.0- proCbLIS is constructed:JsTPS4Expression vector
Designed for amplificationJsTPS4Coded sequence overall length and connect TOPO carrier primer (F: caccATGGAGACGTCAAAGTATTCCTC；R:GATGGAACAGAAACTAAACCTCATTGG), using cDNA as template, obtain The PCR product obtained, send sequencing after recycling, take the correct recovery product of sequencing and pENTR/D-TOPO carrier (Invitrogen) phase Even, 6 μ l of linked system is to include 1.0 μ l topo carriers, 100 ng PCR recovery products, ddH2O polishing, 25 DEG C of connections 15min.Connection product is totally converted E. coli competent DH5 α, is coated with 50 μ g/ml Kana plates, chooses monoclonal progress Bacterium solution PCR verifying, positive bacterium solution send sequencing.
Correct TOPO- will be sequenced JsTPS4Intermediate vector utilizes LR enzyme (Gateway LR Clonase Π Enzyme Mix, Invitrogen) displacement is carried out with pK7FWG2.0-proCbLIS carrier reacts, reaction system totally 10 μ l, packet Plasmid containing topo (50-150ng), pK7FWG2.0-proCbLIS plasmid (150ng), LR Clonese 2 μ l, ddH2O polishing, 1 μ l k solution is added after 25 DEG C of 2 h of connection, then at 37 DEG C of reaction 10min.After reaction, Escherichia coli sense is converted By state DH5 α, 50 μ g/ml Spec plates are coated with, monoclonal is chosen and carries out bacterium solution PCR verifying, positive bacterium solution send sequencing.Sequencing is just True bacterium solution extracts plasmid, so far,JsTPS4Sequence substitutions enterproCbLISUnder promoter, pK7FWG2.0- is obtained proCbLIS:JsTPS4Over-express vector.
Embodiment 2,PK7FWG2.0- proCbLIS:JsTPS4Expression vector converts petunia
(1) the petunia Callus of Leaf for conversion is obtained
The petunia plant leaf of clip vigorous growth, softly cleans up under tap water.2w/v% chlorine is used on the super-clean bench Sour sodium sterilizes 6-8 min, then with sterile water wash 3 times.1 × 2 cm is cut into after blade after disinfection is removed vein2Size Square is placed on pre-culture medium, is formulated as 4.43g/L MS powder+20g/L sucrose+8g/L agar+2mg/L 6-BA+0.2mg/L NAA, pH=5.8.3-4 days rear blades of culture arch upward, and blade wound tissue prepares dip dyeing when expanding.
(2) preparation contains PK7FWG2.0LisPro:JsTPS4The Agrobacterium bacterium solution of expression vector simultaneously disseminates petunia
By PK7FWG2.0-LisPro:JsTPS4Plasmid is by the way that (plasmid is put into competence in freeze-thaw method conversion Agrobacterium GV3101 In, 10 min of ice bath, liquid nitrogen cold shock 5min, 28 DEG C of 5min add 800 μ l LB to be applied after 28 DEG C of 200 rpm shakes bacterium 4-5h containing 50 The plate of μ g/ml Gm, 50 μ g/ml Rif and 50 μ g/ml Spec antibiotic), verifying expression vector by bacterium solution PCR is It is no to be successfully transferred to Agrobacterium GV3101, then the Agrobacterium containing expression vector is used and contains 50 μ g/ml Gm, 50 μ g/ml Rif It cultivates with 28 DEG C of the LB culture medium, 180 rpm of 50 tri- kinds of antibiotic of μ g/ml Spec to OD about 0.8, then by bacterium solution 4000 Rmp, 4 DEG C of 15 min of centrifugation remove supernatant, and isometric re-suspension liquid (+150 μM of AS of 1/2MS fluid nutrient medium) progress is added Be resuspended, be stored at room temperature 2 hours it is spare.
In super-clean bench, the petunia blade obtained in (1) is put into the Agrobacterium re-suspension liquid prepared and impregnates 10 min, Taking-up is placed on suck dry moisture on filter paper, is subsequently placed in and co-cultures on base shading culture 2 ~ 3 days.The culture medium prescription of co-cultivation is 4.43g/L MS powder (M519)+20g/L sucrose+8g/L agar+2mg/L 6-BA+0.2mg/L NAA+15mg/L AS, pH= 5.8.To prevent Agrobacterium from polluting culture medium, one layer of sterilizing filter paper is overlayed in media surface.
(3) acquisition of transgenic petunia
On super-clean bench, the sterile water containing cephalo (300 mg/L) is used gently to shake 2 min of cleaning in the blade after co-cultivation, then sterile Water clean 3 times, surface moisture is blotted on filter paper, is placed in differential medium culture, be formulated for 4.43g/L MS powder+20g/L sucrose+ 8g/Lq agar+2mg/L 6-BA+0.2mg/L NAA+300mg/L Cef+100mg/L Kan, pH=5.8.
It is that 4 ~ 5 cm are transferred to root media culture when having 4 ~ 5 leaves when the seedling in tissue culture bottle grows to height, Formula be 2.215g/L MS+10g/L sucrose+6g/L agar+0.1mg/L IBA+0.1mg/L NAA+ 300mg/L cef, pH=5.8.Flourishing root system can be grown within 4 weeks or so.
Gently the good and flourishing tissue-cultured seedling of root growth is taken out using long tweezers, protect as far as possible rhizome portion not by Wound, the culture medium being attached on root is softly washed away with clear water, is transplanted at room temperature yin into sterilization matrix, matrix formulations are vermiculite: Sterilize fertile soil=1:2/V:V.Plant after transplanting is placed in phjytotron and is cultivated, and light application time is day night=16h/ 8h, temperature are day night=24 DEG C/20 DEG C, humidity 70%.
Embodiment 3, the identification of transgenic petunia and the detection of flower fragrance component
(1) identification of positive strain
Use CTAB method extract with transgene tobacco genomic DNA, using this DNA as template, with kana resistance primer (Kana-F: 5'-ATGATTGAACAAGATGGATTGCACGCAG-3'；Kana-R:5 '-CTCAGAAGAACTCGTCAAGAAGGCGA-3 ') PCR amplification is carried out with screening transgenic positive plant.
(2) measurement of transgenic plant fragrance
Transgenic petunia after transplanting initially enters the florescence, the pollen stage take each 3 plants of flowers of 6 transgenosis series into It holds or participate in a prayer service at a temple gas ingredient analysis, to be grown under same time inoculation, identical environment and the non-transgenic petunia of identical degree of opening Rigid flower is control.
The petal samples of 0.3 g are abundant with liquid nitrogen Yan Mo, it is transferred to 1.5 ml normal hexanes (chromatographic grade, Sigma) solution [containing concentration be 1 ug/ml internal standard isobutyl-benzene (Isobutyl benzene)], room temperature be vortexed 2 h, 13000 rpm from 10 min of the heart, takes supernatant, and using 0.22 μm of organic membrane filter, filtered solution is transferred in 2 ml GC ampoules for examining It surveys.
It is measured and is extracted using gas chromatograph-mass spectrometer (GC-MS) (8 model of PerkinElemer company, U.S. Clarus SQ) Fragrance component and content in object, chromatographic column are HP-5 chromatographic column (mm × 0.25 μm 30 m × 0.25).Chromatographic condition Are as follows: 50 DEG C of 3min rise to 200 DEG C with 6 DEG C/min speed, keep 1min, then rise to 240 DEG C with 20 DEG C/min speed, 2 min are kept, totally 33 min.Mass Spectrometry Conditions are as follows: electron bombardment (EI) ion source, mass scan range: 40 × 500 amu.It is fixed Property analysis: by the mass spectral results of acquisition in 11.0 mass spectrometry database of NIST (11.0 MS data library of NIST) into Row retrieval initial characterization, then be compared with their retention index (retention indices, RIs).Quantitative analysis: with In extract solution interior target concentration and corresponding calculated by peak area each component relatively in target content, of the same race group in different samples The multiple proportion divided is the multiple proportion after Internal standard correction methods.
The result shows that transgenic petunia is compared with compareing (unconverted) petunia flower, under identical condition of culture, The peak area of the total aroma substance of transgenic petunia flower of all detections, Ergol (Benzyl especially therein Benzoate) and the peak area of methyl benzoate (Methyl Benzoate) dramatically increases (Fig. 1), shows that transgenosis is short Lead a cow total aroma substance in flower, Ergol summation methyl benzoate content be significantly improved.Through Internal standard correction methods, There are 4 to be and have significantly to total aroma substance, Ergol, methyl benzoate is impinged upon in 6 transgenosis systems as the result is shown Difference, wherein total fragrance content is 1.09-1.38 times of control, Ergol increases 1.21-3.94 times, and methyl benzoate increases Add 1.57-14.35 times (Fig. 2), shows to allow the total fragrance component of petunia flower after transgenosis using this molecular engineering, it is special It is not that Ergol and methyl benzoate content are significantly improved, new high-perfume type petunia germplasm can be obtained.The skill Ratio of the high-perfume type petunia plant that art obtains in post-conversion in reaches 50% or more.
SEQUENCE LISTING
<110>University Of Agriculture and Forestry In Fujian
<120>a kind of molecular method for formulating high-perfume type petunia new germ plasm
<130> 12
<160> 12
<170> PatentIn version 3.3
<210> 1
<211> 2535
<212> DNA
<213>artificial sequence
<400> 1
atggagacgt caaagtattc ctcaattaaa tctctagtta gcgagatcaa ggaggagtat 60
ttctcaagtg ataatcctca tgcatttgtt cctgcatctg cctatgatac agcttggtta 120
gccatgattc ctgctgataa tgcacgtaaa caaaatcgtc ccatgttcaa gaattgcttg 180
aactggatac tcgaaaacca aaaaagcggc ggattttggg gcgagataga cgaggagggt 240
ttttcatcta tcgatgctct acccgcaact cttgtttgca tggttgccct caaaacatgg 300
aatataggcc aaaaaaatat agaaaaagga ttgaagtttg taaattccaa catagagatg 360
ctttcggaaa taaatgacga ggatcttcct cgacggtttg tcatggtttt tccggggatg 420
atcgcgcttg ctcaagaagc cggcatcgag cttgttttac ctcagcgatc gggaggagca 480
atagccaata ttttcttcag acgccaacaa atactgaaaa aggaagagct ggtcgatgag 540
tcgcaatctt gtgagcttcc tgtgttggcg tacctagaaa gcttgacacc cacatacaat 600
gttgacccgc gccaaatagt tagccatttg agcgatgatg gttcgttatt tcagtcaccc 660
tctgcaacag tttccgcata tatggccaca ggagacacga actgtagaag atatctcgag 720
tctcttgtag aaaattgtcc aaatggagga gtaccagcaa ggtatcctgc agacgaagag 780
ctaatagagc tttccatggt tgatcatctt caaaggctgg ggttggctga gcatttcaac 840
caagagattg atgagattct cgggaaaatt gacaggaatc agaagaattc cgtgaagtcc 900
aagccaatga aaacaaacat tttacaaccc atgaaattat acaaggactc cttggctttt 960
cgactccttc gcatgcaagg atatgatgta aatccaggga agttttgctg gtttctgaat 1020
gatgcagaaa tcctaaagca tatggaggaa aactgtgaaa aattcattac agtgatgcac 1080
agtgtatata cagccacaga tttacaattt ccaggagagt atgaattaga agaagcaaga 1140
tcattttcca aaagaattct tcaaaaatca atcaaaccaa actgggatca tgactttatg 1200
cattccaagg gattgcacaa tgtggttaag catgagttga agcttccgtg gatcgctcga 1260
ctcgatcatc ttgaccatag gaagtggatt gaagaatata aatccacccc aatgtggatt 1320
gggagtgatt ctttttacag gttgccattt ctagatgaca aaaagctaat gcagcttgct 1380
gtcgaaaatt atgagtttcg acaattgatc ttcaaaaatg aattagagga actcaaaagg 1440
tggagtgtga aatggggact cagtaacatg ggatttggga gagaaaaaac aacatattta 1500
tactttgctg ttgctaccaa cattttccag cctataaatt caactggtcg ttcaattatt 1560
gcaaaagctg caataattgt cacagttgct gatgatttct atgacatgga aggttctctt 1620
aatgagttgg aaaccttaac agatgcaatt aaaagatggg atggaaaagg actgcaagga 1680
catagtaaca ctatctttag cgtccttgat catttgatcg aagacattgc attgaagttc 1740
gaaacacaag agagaaatga aatgagggaa aaacttcggg atatatggcg cgaaacattt 1800
gattcttgga tggtggagaa aagttggagc cacagtggat atataccctc catggatgag 1860
tatcttaaaa ccgggatgat atcaatctct gcacacatgc ttgctcttct agcctcatgt 1920
ttttcgaatc cacgcataca aaaggcagag ctcaaaccta cggaatatga gaacatcaca 1980
aaattgctca tgattatagc ccgattgttg aacgacactc aaagttatga gaaagaaaag 2040
gcagatggga aaatgaatct tgtgttgctc cacttgaacg aaaatccaga ggtctgtatc 2100
gaagaatcga ttgcctacgt aaacgagatt gtgggactca aatggaaaga atttctcaag 2160
catgttttga tggacggttc tgatgatatg ccaaaatcat gcaagagaat tcatctggct 2220
tgtttgaaag catttcaaat gtttttcaac tcagggaact tgtttgatag caagacagca 2280
cttgtggatg acattaagaa agctatttac ttacctatta atgattgcga gccgatgccg 2340
ctcttgaagc ctcagccatt gacaattaat gggacaacca aacacagagt tcctaaagta 2400
tcggcaagtt ggaaccgagc cataaaaaat ccaaagacca taagtatgat caaacagtct 2460
aatattggga aaatatctat taatcaaact gcaaaacttc atgttccaat gaggtttagt 2520
ttctgttcca tctga 2535
<210> 2
<211> 1069
<212> DNA
<213>artificial sequence
<400> 2
gagctcgcgg ccgcaagctt atctaataat gtatcaaaat ctaaaataaa atttaggtta 60
agaagtgggt gcaatttgtt aggcacccac ttcttaatga tccatgtgta atgtttgtta 120
ggcacgctaa gctggagtgc acattatttg ttggctttgt cttgatgtgg taattttatt 180
tttgccaaat tatcacgtat atttgcccga tcgggcattc taatatctaa tctaaaaata 240
taattttaag ttagataata atatcttacg aaataaacat ttataatatt taaaactaat 300
attaactttt gtccttcaaa tatttattat cgtgtcttac gtaacacacg aggtgattat 360
atataaattt aaaacgaatc acagaaaaat ttatgtcatt aaataattat tgatatatat 420
tttatttaat ttactataat attatctact cgaatcataa tttttttaag gtattttgat 480
ttacaaacgg tttatttcaa gtaaaaaaca ttttggaatg aacatggatt atataacatt 540
tcgaacaagc gtacaccata agaagttaat taacaataat gtgtatatgt ttgtttaata 600
tattaattta gaaaatgaat ttatatatga tggtcgagtg attgataata taatacaaat 660
atacaagttt catttaatat gcgcgggtta gtggctagtt caaattactt catgagcttt 720
tctattcaaa catttactat tgcataagct gacccaactc ttgtattaac ccttataaat 780
ttaaatgatc agtttgacca tgacagatta tattaattcc gattagatta attaatttat 840
tataattggc aattaaaact catttattat atattatgta tagtaataaa ataattgatg 900
atgttaggat ggaagggacg ggagatgagt gcagtaatta aattaaggcc acatcctatc 960
atatcccagt ctataaatac agatccagat ccacttcata taagcaagct atcttcccag 1020
aaaaccaaac caccttaaac aagacaacca tctcgagccc gggactagt 1069
<210> 3
<211> 28
<212> DNA
<213>artificial sequence
<400> 3
tctataaata cagatccaga tccacttc 28
<210> 4
<211> 21
<212> DNA
<213>artificial sequence
<400> 4
agcttgccgt aggtggcatc g 21
<210> 5
<211> 24
<212> DNA
<213>artificial sequence
<400> 5
gctgaggctt caagagcggc atcg 24
<210> 6
<211> 26
<212> DNA
<213>artificial sequence
<400> 6
atggtcaaga tgatcgagtc gagcga 26
<210> 7
<211> 25
<212> DNA
<213>artificial sequence
<400> 7
ggcggatttt ggggcgagat agacg 25
<210> 8
<211> 26
<212> DNA
<213>artificial sequence
<400> 8
tgacacccac atacaatgtt gacccg 26
<210> 9
<211> 27
<212> DNA
<213>artificial sequence
<400> 9
caccatggag acgtcaaagt attcctc 27
<210> 10
<211> 27
<212> DNA
<213>artificial sequence
<400> 10
gatggaacag aaactaaacc tcattgg 27
<210> 11
<211> 28
<212> DNA
<213>artificial sequence
<400> 11
atgattgaac aagatggatt gcacgcag 28
<210> 12
<211> 26
<212> DNA
<213>artificial sequence
<400> 12
ctcagaagaa ctcgtcaaga aggcga 26

Claims (10)

1. a kind of Jasmine fragrance synthesizes key geneJsTPS4, which is characterized in that the nucleotides sequence of the gene is classified as SEQ ID NO:1.
2. synthesizing key gene containing Jasmine fragrance described in claim 1JsTPS4Recombinant expression carrier pK7FWG2.0- proCbLIS:JsTPS4。
3. recombinant expression carrier pK7FWG2.0- proCbLIS as claimed in claim 2:JsTPS4Construction method, it is special Sign is, comprising the following steps:
(1) flower specific promoter proCbLIS sequence is synthesized；
(2) pK7FWG2.0- proCbLIS empty carrier is constructed: the method connected using digestion, by flower specific promoter ProCbLIS passes through unidirectional restriction endonuclease sitesSPe I andSacI displaces the CaMV35S of expression vector pK7FWG2.0 Promoter obtains the pK7FWG2.0-proCbLIS expression vector of reconstruct；
(3) amplification Jasmine fragrance synthesizes key geneJsTPS4Coded sequence: TransZol Up Plus Rna is used Kit extracts Jasmine petal total serum IgE, uses SMARTerTMRACE cDNA Amplification Kit expands to obtainJsTPS45 ' and 3 ' cDNA sequences, after splicing obtain cDNA overall length,And it obtainsJsTPS4Coded sequence；
(4) willJsTPS4Coded sequence is cloned into pENTR/D-TOPO carrier and obtains TOPO- JsTPS4Intermediate vector recycles LR enzyme is by TOPO- JsTPS4Middle carrier carries out displacement with pK7FWG2.0-proCbLIS carrier and reacts, and makesJsTPS4Sequence substitutions EnterproCbLISUnder promoter, pK7FWG2.0- proCbLIS is obtained:JsTPS4Expression vector.
4. synthesizing key gene containing Jasmine fragrance described in claim 1JsTPS4Petunia plant.
5. the construction method of petunia plant as claimed in claim 4, which comprises the following steps:
(1) the petunia Callus of Leaf for conversion: the petunia plant leaf of clip vigorous growth is obtained, it is light in tap water It is soft to clean up；The square that suitable size is cut into after disinfection, which is placed on solid pre-culture medium, carries out preculture, 3-4 days rear blade arches It rises, blade wound tissue prepares dip dyeing when expanding；
(2) pK7FWG2.0-LisPro:JsTPS4Convert petunia callus: by pK7FWG2.0-LisPro:JsTPS4Matter Grain by freeze-thaw method convert Agrobacterium GV3101 in, by PCR test positive clone after, using contain Spe, Rif, Gm antibiosis The LB culture medium of element is in 28 DEG C of cultures to OD=0.8, and then 4000rmp, 4 DEG C of centrifugation 15min, remove supernatant, adds isometric Re-suspension liquid be resuspended；In super-clean bench, the petunia blade after preculture is put into infected liquid and impregnates 10 min, after taking-up It is placed in suck dry moisture on filter paper, is subsequently placed in and co-cultures on base, in tissue culture room shading culture 2 ~ 3 days；To prevent Agrobacterium dirty Culture medium is contaminated, overlays one layer of sterilizing filter paper in media surface；
(3) blade after co-cultivation gently the acquisition of transgenic petunia: is shaken into cleaning 15 using the sterile water of the cephalo containing 300mg/L Min blots surface moisture after sterile water wash 3 times on filter paper, is placed in differential medium culture；
It is that 4 ~ 5 cm are transferred to root media and are cultivated when having 4 ~ 5 leaves when differentiation seedling grows into height, 4 weeks or so Flourishing root system can be grown, is transplanted in aseptic substrate grows later, the plant after transplanting is placed in phjytotron and is cultivated, Light application time is day night=16h/8h, and temperature is day night=24 DEG C/20 DEG C, humidity 70%.
6. according to the method described in claim 5, it is characterized in that, step (1) the solid pre-culture medium includes following component: 4.43g/L MS powder, 20g/L sucrose, 6g/L agar, 2mg/L 6-BA, 0.2mg/L NAA adjust pH=5.8 after distilled water dissolution.
7. according to the method described in claim 5, it is characterized in that, step (2) the resuspension formula of liquid are as follows: the training of 1/2MS liquid Support the AS that base adds 150 μM of final concentration.
8. according to the method described in claim 5, it is characterized in that, step (2) the co-cultivation based formulas are as follows: 4.43g/L MS Powder, 20g/L sucrose, 8g/L agar, 2mg/L 6-BA, 0.2mg/L NAA, 15mg/L AS adjust pH=5.8 after distilled water dissolution.
9. according to the method described in claim 5, it is characterized in that, step (3) the differential medium formula are as follows: 4.43g/L MS powder, 20g/L sucrose, 8g/L agar, 2mg/L 6-BA, 0.2mg/L NAA, 300mg/L Cef, 100mg/L Kan, distillation PH=5.8 are adjusted after water dissolution.
10. according to the method described in claim 5, it is characterized in that, step (3) prescription of rooting medium is 2.215g/L MS, 10g/L sucrose, 6g/L agar, 0.1mg/L IBA, 0.1mg/L NAA, 300mg/L cef, distilled water dissolution after adjust pH= 5.8。
CN201910811769.4A 2019-08-30 2019-08-30 Molecular method for creating novel high-aroma petunia germplasm Active CN110452918B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910811769.4A CN110452918B (en) 2019-08-30 2019-08-30 Molecular method for creating novel high-aroma petunia germplasm

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910811769.4A CN110452918B (en) 2019-08-30 2019-08-30 Molecular method for creating novel high-aroma petunia germplasm

Publications (2)

Publication Number Publication Date
CN110452918A true CN110452918A (en) 2019-11-15
CN110452918B CN110452918B (en) 2021-03-09

Family

ID=68490085

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910811769.4A Active CN110452918B (en) 2019-08-30 2019-08-30 Molecular method for creating novel high-aroma petunia germplasm

Country Status (1)

Country Link
CN (1) CN110452918B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113337534A (en) * 2021-07-06 2021-09-03 河南省农业科学院园艺研究所 Tissue culture method for improving genetic transformation efficiency of petunia hybrida

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997015584A2 (en) * 1995-10-12 1997-05-01 The Regents Of The University Of Michigan Use of linalool synthase in genetic engineering of scent production
CN107630025A (en) * 2017-10-17 2018-01-26 华南农业大学 A kind of lily terpene floral base is because of LoTPS3 and its application
CN110128517A (en) * 2019-04-25 2019-08-16 四川天艺优境环境科技有限公司 Primula forbesii fragrance of a flower related gene PfLIS/NES and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997015584A2 (en) * 1995-10-12 1997-05-01 The Regents Of The University Of Michigan Use of linalool synthase in genetic engineering of scent production
CN107630025A (en) * 2017-10-17 2018-01-26 华南农业大学 A kind of lily terpene floral base is because of LoTPS3 and its application
CN110128517A (en) * 2019-04-25 2019-08-16 四川天艺优境环境科技有限公司 Primula forbesii fragrance of a flower related gene PfLIS/NES and application thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CSEKE,L等: "登录号AF067601.1：Clarkia breweri linalool synthase 1 (LIS1) gene, partial cds", 《GENBANK》 *
俞滢等: "茉莉花萜类合成酶基因JsTPS 的克隆及其表达分析", 《园艺学报》 *
陈笛等: "茉莉花芳樟醇生物合成关键基因的克隆与表达分析", 《西北植物学报》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113337534A (en) * 2021-07-06 2021-09-03 河南省农业科学院园艺研究所 Tissue culture method for improving genetic transformation efficiency of petunia hybrida

Also Published As

Publication number Publication date
CN110452918B (en) 2021-03-09

Similar Documents

Publication Publication Date Title
RU2350653C2 (en) Methods of abiotic stress tolerance enhancement and/or biomass increase for plants, and plants obtained by method
KR20210039306A (en) Gene editing method using transgenic plants expressing CRISPR/Cas9 and gRNA, respectively
CN110872598B (en) Cotton drought-resistant related gene GhDT1 and application thereof
CN109609527A (en) CDPK18L gene is improving the application in tomato bacterial leaf spot resistance and high temperature resistance as negative regulatory factor
CN111233988B (en) Eggplant potassium ion channel protein SmAKT1, and coding gene and application thereof
CN110468118B (en) Chimonanthus nitens SUMO E3 ligase gene CpSIZ1 and application thereof
CN108441500A (en) A kind of stress resistance of plant related gene and its coding albumen and purposes
CN102586250A (en) Promoter of terpene floral scent gene Hctps1 in hedychium gardneranum and application of promoter
CN110452918A (en) A kind of molecular method for formulating high-perfume type petunia new germ plasm
CN110819634B (en) Clone of lilium tenuifolium gene LpNAC6 and application thereof
JP2010183891A (en) Method for promoting flowering of rose family fruit tree using apple latent spherical virus vector
CN113604475B (en) Application of cotton GH_D03G1517 gene in promotion of drought resistance and salt tolerance
CN110218247A (en) Two kinds of interactions between protein collaborations of PwRBP1 and PwNAC1 improve plant stress tolerance and its application
CN109837297A (en) GhAGD13 gene relevant to resistance to verticillium wilt and its application
CN112322651B (en) Application of tomato autophagy gene in improving plant root-knot nematode resistance
CN114456242A (en) PRP protein and coding gene and application thereof
CN108866074B (en) Application of herbicide-resistant gene PAR3(G311E)
WO2006126294A1 (en) Transporter gene selective for mugineic acid-iron complex
CN113564182B (en) Application of iris japonica SVP-like gene and method for obtaining iris japonica gene silencing or plant knockout
CN113717981B (en) DTX6 mutant gene and application thereof in herbicide diquat resistance
CN114573671B (en) Closed flower pollination trait regulatory gene Bnac03.FBA, flower organ specific expression promoter PFBA and application thereof
CN111118029B (en) Key gene PmARF6 for regulating and controlling blossoming of masson pine and application thereof
CN116814651B (en) Application of oat flower MYB4a transcription factor in regulating and controlling plant flower column elongation
CN113789313B (en) Lagerstroemia indica salt-tolerant gene LiCIPK24 and application thereof
CN110835367B (en) Pear flowering regulating transcription factor PbrSPL15 and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant