CN110452810B - Biosensor for detecting MicroRNA (micro ribonucleic acid) and preparation method and application thereof - Google Patents
Biosensor for detecting MicroRNA (micro ribonucleic acid) and preparation method and application thereof Download PDFInfo
- Publication number
- CN110452810B CN110452810B CN201910753538.2A CN201910753538A CN110452810B CN 110452810 B CN110452810 B CN 110452810B CN 201910753538 A CN201910753538 A CN 201910753538A CN 110452810 B CN110452810 B CN 110452810B
- Authority
- CN
- China
- Prior art keywords
- biosensor
- dna
- agncs
- detection
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The invention relates to the technical field of biosensors, and provides a biosensor for detecting MicroRNA (micro ribonucleic acid) by regulating and controlling AuNPs coagulation quenching DNA/AgNCs luminescence based on a G-quadruplex DNAzyme technology. The catalytic performance of G-tetrad/heme horseradish peroxidase is applied to oxidize cysteine into cystine, and the plasma resonance coupling effect between cysteine and gold nanoparticles is inhibited, so that the agglomeration of gold nanoparticles is inhibited, at the moment, single-chain DNA/AgNCs can be adsorbed to the surface of the gold nanoparticles, and a fluorescence signal is weakened, so that the detection of miR-122 is realized, and the problems of low specificity and sensitivity and high cost of a method for detecting MicroRNA in the prior art are solved.
Description
Technical Field
The invention relates to the technical field of biosensors, in particular to a biosensor for detecting MicroRNA (micro ribonucleic acid) by regulating and controlling AuNPs coagulation quenching DNA/AgNCs luminescence based on a G-quadruplet DNAzyme technology, and also relates to a preparation method and application thereof.
Background
MicroRNA (miRNA) is a non-coding RNA of 17-25 nucleotides in length, which plays a role in RNA silencing and transcriptional regulation of genes, and they play key regulatory functions in many biological processes, such as tumorigenesis, metastasis, prognosis, cell differentiation, apoptosis, and protein synthesis. Aberrant miRNA expression can induce a variety of diseases, such as cancer, diabetes, cardiovascular disease, and neurological disorders. Therefore, mirnas have become biomarkers for diagnosis and treatment of various diseases such as cancer.
Over the last several decades, a number of analytical strategies including Northern blotting, real-time polymerase chain reaction (RT-PCR) and microarrays have been developed for the identification and quantification of mirnas. However, Northern blotting is time consuming, complex and has poor sensitivity. As for PCR, the need for skilled technicians and the vulnerability to contamination during handling largely limit its low sensitivity, specificity and reproducibility. Therefore, there is an urgent need to improve the ultra-high sensitivity and specificity of miRNA detection.
Disclosure of Invention
In order to solve the problems of low specificity and sensitivity and long detection period of the method for detecting the miRNA concentration in the prior art, the invention provides the biosensor for detecting the MicroRNA by regulating and controlling the AuNPs coagulation quenching DNA/AgNCs luminescence negative signal based on the G-quadruplet DNAzyme technology, which has high specificity and sensitivity and high detection speed.
A fluorescence biosensor for quantitatively detecting miRNA comprises homogeneous reaction liquid, target objects miR-122, an H1 chain, an H2 chain, a DNA/AgNCs chain, heme, potassium ions, cysteine and nanogold;
the homogeneous reaction solution is phosphate buffer PBS, and the composition and the concentration are as follows: 20 mM Na2HPO4，20 mM NaH2PO4，140 mM NaCl，1 mM MgCl2The pH value is 7.4;
the base sequence of the miR-122 is shown as SEQ No. 1;
the H1 base sequence is shown as SEQ No. 2;
the H2 base sequence is shown in SEQ No. 3;
the DNA/AgNCs base sequence is shown in SEQ No. 4.
The preparation method of the fluorescence biosensor comprises the following steps:
(1) uniformly mixing target objects miR-122, H1, H2 and 5 XPBS phosphate buffer solution, and reacting at constant temperature of 37 ℃;
(2) mixing DNA/AgNCs chain and phosphate buffer solution uniformly, adding AgNO3The solution is evenly mixed and then stands for a period of time, then sodium borohydride is added into the mixed solution, and the mixed solution stands for standby after being quickly vibrated and in a dark place;
(3) adding nanogold, cysteine and heme into the solution obtained in the step (1) and the step (2), uniformly mixing, and reacting at a constant temperature of 37 ℃;
(4) and (4) carrying out fluorescence intensity detection on the reaction liquid obtained in the step (3), wherein an excitation wavelength is 560 nm, an emission wavelength is 615 nm, and a detection range is 540 nm-660 nm.
The reaction time of the step (1) is 2 hours.
The AgNO added in the step (2)3The molar ratio of silver ions to DNA in the solution was 6: 1, and adding AgNO3The reaction temperature after the solution is uniformly mixed is 4 ℃ and the time is 15 min; after adding sodium borohydride, quickly shaking for 1 minute under the reaction condition that the temperature is 4 ℃ and the time is 6 hours.
The reaction time of the step (3) is 2 hours.
The fluorescent biosensor is applied to the detection of miRNA.
The fluorescent biosensor is applied to quantitative detection of miRNA.
In the invention, 4 chains are used together, and the sequences are respectively as follows:
miR-122: UGGAGUGUGACAAUGGUGUUUG
H1:GGGCGGGTGGGAGTGTGACTCACGGTAGCGGGCTACCAAACACCATTGTCACACTCCAGGGA
H2:TGGGCCGCTACCGTGAGTCAGGAGTGTGACAATGGTGTTTGGTAGCGGCCGGGATGGGCGGG
DNA/AgNCs: CCCTTAATCCCCCGTTGACTTGTGTTGCCCTAACTCCCC
the working principle of the biosensor is as follows:
h1 and H2 have bases capable of forming hairpin structures and G-quadruplexes, and H1 and H2 form hairpin structures to block the bases partially forming the G-quadruplexes, so that the G-quadruplexes cannot be formed in the hairpin state. Part of bases of H1 can be complementarily paired with miR-122, when miR-122 exists, miR-122 and H1 base complementary pairing opens H1 hairpin structure, and then part of bases of H1 can be complementarily paired with H2 base to open hairpin H2, then H2 can continue to open hairpin H1, so that H1 and H2 can be continuously combined together, and hybrid chain amplification (HCR) is realized. Meanwhile, H1 is connected with the 5 'end and the 3' end of H2 end to end, so that the sequence forming the G-tetrad is exposed, and the G-tetrad/heme DNA enzyme is formed in the presence of heme. Cysteine is oxidized into cystine by using the catalytic performance of G-tetrad/heme horseradish peroxidase, and the plasma resonance coupling effect between the cysteine and gold nanoparticles cannot be realized, so that the agglomeration of gold nanoparticles is inhibited, at the moment, single-chain DNA/AgNCs can be adsorbed to the surface of the gold nanoparticles, a fluorescence signal is weakened, and the detection of miR-122 is realized.
The invention has the following advantages:
1. high specificity and short detection period
The synthesized H1 structure is specifically recognized with the target miRNA, and has high specificity; the sensor has mild reaction conditions and high reaction speed; because of using the fluorescence method, the detection method is simple and convenient to operate and short in detection period; the main processes of the detection principle are realized in a homogeneous phase, so that the reaction speed is improved, the complexity of operation is reduced, and the rapid, simple and sensitive detection of the target object is realized.
2. Low cost and wide application range
The process has no participation of enzyme, effectively reduces the process cost of the biosensor, and is suitable for the requirements of low cost in industrialization; the preparation method is simple, stable in performance and good in repeatability of fluorescence detection, and is suitable for detection of various miRNAs and practical application of biosensor industrialization.
Drawings
FIG. 1 is a schematic diagram of the experiment;
FIG. 2 is a graph showing the results of detection in example 3;
FIG. 3 is a graph showing the results of detection in example 4;
FIG. 4 is a graph showing the results of the assay in example 5.
Detailed Description
The present invention is further illustrated by the following specific examples.
Example 1 preparation of nanogold.
(1) Adding 200ml of ultrapure water into a three-neck flask;
(2) 500 μ L of HAuCl with a concentration of 0.04g/mL was taken4Adding 200ml of ultrapure water into a centrifugal tube, stirring and heating until boiling, wherein the stirring speed is 450 rpm;
(3) rapidly adding 3ml of 1% trisodium citrate solution into the solution in the step (2) under stirring
Changing the color of the solution from light yellow to wine red, heating for 15min, removing heat source, cooling slowly to room temperature, and storing at 4 deg.C for use.
The concentration of the nano-gold in the solution is about 0.3nM according to the absorbance value at 530nM by using an ultraviolet spectrophotometer.
Example 2 preparation of DNA/AgNCs.
(1) mu.L of 100. mu.M DNA/AgNCs and 73. mu.L of 20 mM PB buffer (pH 7.0) were added to the EP tube wrapped in tinfoil, followed by 6. mu.L of 1.5 mM AgNO3Solution (ensuring Ag)+Mixing with H3 at a ratio of 6: 1), shaking for 1 min, and standing at 4 deg.C for 30 min;
(2) after 30 min, 6. mu.L of 1.5 mM NaBH was added to the EP tube4Shaking for 1 min, and standing at 4 deg.C in dark for more than 6 hr.
The preparation method of the solution used in the above process comprises the following steps:
the ultrapure water is required to be sterilized at high temperature. The method comprises the steps of respectively placing ultrapure water in conical flasks, and then sealing the flasks with tinfoil paper and newspaper. Sterilizing in autoclave at 120 deg.C for 20 min.
And (4) making a standard curve according to the fluorescence intensity of the concentration of the series of miRNA. The regression equation was calculated to be F =880.42+185.68 × LgC/pM with a correlation coefficient of 0.988.
Example 3 effect of different concentrations of H1 on miRNA detection.
The preparation method of the fluorescence biosensor comprises the following steps:
(1) 1nM miRNA, H1 (2. mu.L, final concentrations 0.4. mu.M, 0.6. mu.M, 0.8. mu.M, 1.0. mu.M, 1.2. mu.M, 1.4. mu.M), H2 (2. mu.L, 20. mu.M), 5 XPBS (3. mu.L) were added to a centrifuge tube, shaken for 30s, and placed in a 37 ℃ water bath for reaction for 30 min.
(2) Taking the reacted solution out of the water bath kettle, adding the nano gold solution (10 mu L), cysteine (2 mu L) and 4 mu L of heme (the final concentration is 1 mu M), and placing the solution into the water bath kettle at 37 ℃ for reaction for 1 h.
(3) Diluting the solution (30 mu L) reacted in the step (2) to 100 mu L, and then carrying out fluorescence detection; the excitation wavelength is set to 565nm, the emission wavelength is 650nm, the detection range is 600nm-800nm, and the change of the fluorescence signal is read.
The results are shown in FIG. 2, from which it can be seen that the fluorescence intensity decreases with increasing concentration of H1, and the fluorescence intensity is substantially constant after the concentration reaches 1. mu.M. The concentration of H1 required for the experiments was 1. mu.M.
Example 4 effect of different concentrations of H2 on miRNA detection.
The preparation method of the fluorescence biosensor comprises the following steps:
(1) 1nM miRNA, H1 (2. mu.L, 20. mu.M), H2 (2. mu.L, final concentrations 0.4. mu.M, 0.6. mu.M, 0.8. mu.M, 1.0. mu.M, 1.2. mu.M, 1.4. mu.M), 5 XPBS (3. mu.L) were added to a centrifuge tube, shaken for 30s, and placed in a 37 ℃ water bath for reaction for 30 min.
(2) Taking the reacted solution out of the water bath kettle, adding the nano gold solution (10 mu L), cysteine (2 mu L) and 4 mu L of heme (the final concentration is 1 mu M), and placing the solution into the water bath kettle at 37 ℃ for reaction for 1 h.
(3) Diluting the solution (30 mu L) reacted in the step (2) to 100 mu L, and then carrying out fluorescence detection; the excitation wavelength is set to 565nm, the emission wavelength is 650nm, the detection range is 600nm-800nm, and the change of the fluorescence signal is read.
The results are shown in FIG. 3, from which it can be seen that the fluorescence intensity decreases with increasing concentration of H2, and the fluorescence intensity is substantially constant after the concentration reaches 1. mu.M. The concentration of H2 required for the experiments was 1. mu.M.
Example 5 variation of fluorescence intensity with miRNA concentration
The preparation method of the fluorescence biosensor comprises the following steps:
1) miRNA with different concentrations (0, 10 aM, 100 aM, 1 fM, 10 fM, 100 fM, 1 pM,10 pM,100 pM), H1 (2 muL, 20 muM), H2 (2 muL, 20 muM), and 5 XPBS (3 muL) are added into a centrifuge tube, shaken for 30s, and placed into a water bath kettle at 37 ℃ for reaction for 30 min.
(2) Taking the reacted solution out of the water bath kettle, adding the nano gold solution (10 mu L), the cysteine (2 mu L) and the 4 mu L of the heme (the final concentration is 1 mu M), and placing the mixture into the water bath kettle at 37 ℃ for reaction for 1 hour.
(3) Diluting the solution (30 mu L) reacted in the step (2) to 100 mu L, and then carrying out fluorescence detection; the excitation wavelength is set to 565nm, the emission wavelength is 650nm, the detection range is 600nm-800nm, and the change of the fluorescence signal is read.
The results are shown in FIG. 4, from which it can be seen that the fluorescence intensity decreases with increasing miRNA concentration.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the embodiments, and any other changes, modifications, combinations, substitutions and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents and are included in the scope of the present invention.
Sequence listing
<110> university of Jinan
<120> biosensor for detecting MicroRNA, preparation method and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> RNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 1
uggaguguga caaugguguu ug 22
<210> 2
<211> 62
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 2
gggcgggtgg gagtgtgact cacggtagcg ggctaccaaa caccattgtc acactccagg 60
ga 62
<210> 3
<211> 62
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 3
tgggccgcta ccgtgagtca ggagtgtgac aatggtgttt ggtagcggcc gggatgggcg 60
gg 62
<210> 4
<211> 39
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 4
cccttaatcc cccgttgact tgtgttgccc taactcccc 39
Claims (1)
1. A fluorescence biosensor for quantitatively detecting miRNA is characterized by comprising homogeneous reaction liquid, target objects miR-122, an H1 chain, an H2 chain, a DNA/AgNCs chain, heme, potassium ions, cysteine and nanogold;
the homogeneous reaction liquid is phosphate buffer PBS and has the following components and concentrations: 20 mM Na2HPO4，20 mM NaH2PO4，140 mM NaCl，1 mM MgCl2The pH value is 7.4;
the base sequence of the miR-122 is shown as SEQ No. 1;
the H1 base sequence is shown as SEQ No. 2;
the H2 base sequence is shown in SEQ No. 3;
the DNA/AgNCs base sequence is shown in SEQ No. 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910753538.2A CN110452810B (en) | 2019-08-15 | 2019-08-15 | Biosensor for detecting MicroRNA (micro ribonucleic acid) and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910753538.2A CN110452810B (en) | 2019-08-15 | 2019-08-15 | Biosensor for detecting MicroRNA (micro ribonucleic acid) and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110452810A CN110452810A (en) | 2019-11-15 |
| CN110452810B true CN110452810B (en) | 2022-05-27 |
Family
ID=68486789
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910753538.2A Active CN110452810B (en) | 2019-08-15 | 2019-08-15 | Biosensor for detecting MicroRNA (micro ribonucleic acid) and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110452810B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111424071B (en) * | 2020-04-09 | 2022-09-23 | 济南大学 | Biosensor for detecting miRNA-141 and preparation method and application thereof |
| CN111855631B (en) * | 2020-07-29 | 2022-12-02 | 西北大学 | Snowflake-shaped DNA crystal/copper nanocluster and application thereof in actin detection |
| CN113151400A (en) * | 2020-08-22 | 2021-07-23 | 农业农村部环境保护科研监测所 | Pb based on DNA tetrahedral nanostructure mediated HCR signal amplification2+Fluorescence sensing method |
| CN112557369A (en) * | 2020-11-30 | 2021-03-26 | 崔艳芳 | Biosensor for detecting microRNA-21 and preparation method and application thereof |
| CN114397256B (en) * | 2021-12-03 | 2024-05-14 | 济南大学 | Biosensor for detecting MicroRNA-17 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102618664A (en) * | 2012-05-03 | 2012-08-01 | 武汉大学 | MiRNA (Micro Ribonucleic Acid) detection probe and method for visually detecting miRNA |
| CN102858997A (en) * | 2009-11-02 | 2013-01-02 | 新加坡科技研究局 | Methods for monitoring cellular states and for immortalizing mesenchymal stem cells |
| CN108103146A (en) * | 2018-01-25 | 2018-06-01 | 济南大学 | A kind of biosensor for detecting salmonella |
| CN108333155A (en) * | 2018-01-12 | 2018-07-27 | 济南大学 | A kind of biosensor of fluoroscopic examination mercury ion |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020197611A1 (en) * | 2001-06-21 | 2002-12-26 | Chagovetz Alexander Michael | Method for real-time detection and quantification of nucleic acid sequences using fluorescent primers |
-
2019
- 2019-08-15 CN CN201910753538.2A patent/CN110452810B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102858997A (en) * | 2009-11-02 | 2013-01-02 | 新加坡科技研究局 | Methods for monitoring cellular states and for immortalizing mesenchymal stem cells |
| CN102618664A (en) * | 2012-05-03 | 2012-08-01 | 武汉大学 | MiRNA (Micro Ribonucleic Acid) detection probe and method for visually detecting miRNA |
| CN108333155A (en) * | 2018-01-12 | 2018-07-27 | 济南大学 | A kind of biosensor of fluoroscopic examination mercury ion |
| CN108103146A (en) * | 2018-01-25 | 2018-06-01 | 济南大学 | A kind of biosensor for detecting salmonella |
Non-Patent Citations (1)
| Title |
|---|
| 《Hybridization chain reaction modulated DNA-hosted silver nanoclusters for fluorescent identification of single nucleotide polymorphisms in the let-7 miRNA family》;XueQiu et.al.;《Biosensors andBioelectronics》;20140430;第60卷;第351-357页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110452810A (en) | 2019-11-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110452810B (en) | Biosensor for detecting MicroRNA (micro ribonucleic acid) and preparation method and application thereof | |
| Ding et al. | Label-free detection of microRNA based on the fluorescence quenching of silicon nanoparticles induced by catalyzed hairpin assembly coupled with hybridization chain reaction | |
| Jin et al. | A Rapid, Amplification‐Free, and Sensitive Diagnostic Assay for Single‐Step Multiplexed Fluorescence Detection of MicroRNA | |
| Wu et al. | Fabrication of a LRET-based upconverting hybrid nanocomposite for turn-on sensing of H 2 O 2 and glucose | |
| CN108342459B (en) | Quantitative PCR detection method based on gold nanoparticles | |
| CN109540860B (en) | Fluorescent biosensor for detecting kanamycin and preparation method and application thereof | |
| Zhu et al. | Selective and sensitive detection of MiRNA-21 based on gold-nanorod functionalized polydiacetylene microtube waveguide | |
| JP2008518633A (en) | Nucleic acid enzyme light-up sensor using invasive DNA | |
| CN106770143B (en) | Biosensor for detecting MiRNA and preparation method thereof | |
| Hwu et al. | An analytical method to control the surface density and stability of DNA-gold nanoparticles for an optimized biosensor | |
| Park et al. | QCM sensing of miR-21 by formation of microRNA–DNA hybrid duplexes and intercalation on surface-functionalized pyrene | |
| Huang et al. | Toehold-mediated nonenzymatic amplification circuit on graphene oxide fluorescence switching platform for sensitive and homogeneous microRNA detection | |
| CN113201581A (en) | Entropy-driven visible miRNA biosensor and application thereof | |
| Shao et al. | Three dimensional DNA nanotracks: a novel method for ultrasensitive and visible mercury (II) detection | |
| Wei et al. | A highly sensitive SPRi biosensing strategy for simultaneous detection of multiplex miRNAs based on strand displacement amplification and AuNP signal enhancement | |
| Wei et al. | A label-free Exonuclease I-assisted fluorescence aptasensor for highly selective and sensitive detection of silver ions | |
| Chen et al. | A cancer cell membrane vesicle-packaged DNA nanomachine for intracellular microRNA imaging | |
| CN111157512B (en) | SERS substrate for detecting tyrosinase activity and method for detecting tyrosinase activity by using same | |
| CN106884047B (en) | Method for detecting miRNA-155 based on aptamer | |
| US9512468B2 (en) | Detection method uses magnetic and detectable nanoparticles with oligonucleotides attached thereto | |
| Jiang et al. | Construction of a gold nanoparticle-based single-molecule biosensor for simple and sensitive detection of Argonaute 2 activity | |
| Wang et al. | A simple lateral flow biosensor for the rapid detection of copper (II) ions based on click chemistry | |
| CN114252602B (en) | Microfluidic chip, detection system based on microfluidic chip and detection method of bacteria | |
| Xu et al. | Toehold-mediated strand displacement coupled with single nanoparticle dark-field microscopy imaging for ultrasensitive biosensing | |
| Miao et al. | Fluorescence recognition of double-stranded DNA based on the quenching of gold nanoparticles to a fluorophore labeled DNA probe |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |