CN106770143B - Biosensor for detecting MiRNA and preparation method thereof - Google Patents
Biosensor for detecting MiRNA and preparation method thereof Download PDFInfo
- Publication number
- CN106770143B CN106770143B CN201710112746.5A CN201710112746A CN106770143B CN 106770143 B CN106770143 B CN 106770143B CN 201710112746 A CN201710112746 A CN 201710112746A CN 106770143 B CN106770143 B CN 106770143B
- Authority
- CN
- China
- Prior art keywords
- hairpin
- mirna
- template
- trigger
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Physics & Mathematics (AREA)
- Chemical & Material Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The invention relates to the technical field of biosensors, in particular to a biosensor for detecting MiRNA. The invention combines silver cluster fluorescence enhancement and strand displacement cyclic amplification, and is prepared by a homogeneous reaction mixed solution method. The preparation method comprises the following steps: synthesizing silver clusters using hairpin 2; binding of the target mirnas to the Template strand Template is performed in homogeneous solution resulting in strand displacement of Trigger and subsequent opening of hairpin 1 and opening of hairpin 2, hairpin 1 enhancing silver cluster fluorescence of hairpin 2. The combination of the target and the Template strand Template is utilized to generate Trigger and the subsequent circulation amplification of the Trigger is utilized to carry out high specificity detection on the MiRNA of the target; by using strand displacement, the cyclic utilization of Trigger is realized, and the signal amplification effect is achieved. The method solves the problems of low specificity and sensitivity and high cost of the method in the prior art.
Description
Technical Field
The invention relates to the technical field of biosensors, in particular to a biosensor for detecting miRNA based on G-rich sequence and capable of enhancing silver cluster fluorescence, and also relates to a silver cluster preparation method.
Background
MicroRNAs (miRNAs) are endogenous non-coding RNAs with a regulation function, and the size of the RNAs is about 20-25 nucleotides. There is increasing evidence that miRNA expression is associated with a variety of cancers, with about 50% of the annotated miRNAs being located at fragile sites (tumor sites) associated with tumors on the genome, and that changes in the level of miRNA expression, including both, up-and down-regulation, are associated with the type and stage of the associated cancer. Up-regulated mirnas cause carcinogenesis by inhibiting cancer suppressor genes, and are considered oncogenic mirnas; the down-regulated miRNA, which usually prevents the development of cancer, is known as a tumor suppressor miRNA by suppressing the expression level of a protooncogene. Thus, mirnas have become biomarkers for the prognosis, diagnosis and treatment of cancer. miR-122 is a miRNA that was discovered earlier and studied in a comprehensive manner by scientists. miRNA-122 is highly expressed in liver, and the reduction of miRNA-122 level is related to liver cancer cells and plays an important role in regulating the replication of hepatitis C virus.
The currently reported detection methods of MiRNA mainly comprise quantitative reverse transcription-polymerase chain reaction (qRT-PCR), Northern blotting method, clone sequencing method and the like, but the PCR has high requirements on temperature and instruments, the Northern blotting method is time-consuming, complex in process and low in sensitivity, and the clone sequencing method is time-consuming and labor-consuming. Therefore, it is urgently needed to establish a rapid, accurate, sensitive and high-specificity detection method for detecting miRNA-122.
Disclosure of Invention
In order to solve the problems of low specificity and sensitivity, high cost and long detection period in the method for detecting miRNA-122 in the prior art, the invention provides a biosensor which has high specificity and sensitivity, low cost and high detection speed and is based on a strand displacement and has a G-rich sequence and can enhance the fluorescence of a silver cluster, and a preparation method of the silver cluster.
The invention also provides a preparation method of the biosensor which enhances the fluorescence of the silver cluster by the G-rich sequence based on strand displacement.
The invention is obtained by the following steps:
in the invention, 4 DNA chains are used in total, and the sequences are respectively as follows:
MiRNA-122
5’-UGGAGUGUGACAAUGGUGUUUG-3’（SEQ ID NO:1）；
template DNA strand Template
5’- CCT TCT CGT CGC ACT GTC GCA CTC AG C TCT GAT C CA AAC ACC ATT GTCACA CTC CACTCTGATC CAAACACCATTGTCACACTCCA --3’ （SEQ ID NO:2）；
Hair clip 1: 5 '-TGG GGT GGG TGG GTG GGG TTT TTT GCG ACA GTG CAC ATT CATATT TCA CCC TTC TCG TCG CAC TGT CGC ACT CAG-3' (SEQ ID NO: 3);
the hair clip 2:
5’—CGA CAG TGC GAC GAG AAG GGT GAA ATA TGA ATG TGC ACT GTC GCT TTTTTC CCC CTA ATT CCC--3’ （SEQ ID NO:4）。
wherein the MiRNA strand is complementarily paired with the black font in the Template strand Template, the 2 sections of black font parts in the Template strand Template are the same and respectively consist of the recognition sequence of the italic restriction endonuclease Nt. AlWI and the complementary sequence of miRNA, the 2 sections of black font in the hairpin 1 is the complementary paired sequence of the hairpin 1, and the 2 sections of black font in the hairpin 2 is the complementary paired sequence of the hairpin 2. MiRNA is extended with Template strand of Template strand under the action of phi29 polymerase and dNTPs, and is cut under the action of Nt.AlWI enzyme to generate Trigger (see schematic diagram, which is complementarily paired with brown filling part of Template strand Template), the Trigger can be complementarily paired with hairpin 1 and opens hairpin 1, blue font sequence at 3 'end of hairpin 2 can form silver cluster (AgNCs), 5' end of hairpin 1 is rich in G sequence, because partial sequences of hairpin 1 and hairpin 2 are perfectly complementarily paired, hairpin 1 which is opened can open hairpin 2 through complementary pairing with hairpin 2 after Trigger opens hairpin 1, at the moment, G-rich sequence of hairpin 1 is close to silver cluster synthesized by using hairpin 2, and hairpin 1 can enhance fluorescence intensity of silver cluster of hairpin 2. The miRNA detection is realized in a homogeneous solution, and the amplification of signals is realized in a strand displacement mode, so that the high-sensitivity detection of the miRNA is realized, and a lower detection lower limit is obtained.
The reactions that occur in homogeneous phases are mainly: the miRNA and the Template DNA strand Template are complementarily paired, and under the action of phi29 polymerase and dNTPs, the miRNA is subjected to complementary pairing along the extension of the Template strand Template, and the complementary pairing is a DNA strand, because the Template strand Template has 2 identical sequences (recognition sequence of Nt. AlWI enzyme + complementary sequence of miRNA), and then the Nt. AlWI enzyme is added to cut the complementary strand of the Template strand Template, so that 1 DNA sequence for changing U in the miRNA into T, a structure of the miRNA in complementary pairing with the Template strand and a Trigger sequence in complete complementary pairing with the upper part of the Template strand are released (see a schematic diagram). Adding the hairpin 1, wherein the partial sequence of the hairpin 1 is completely identical to the partial sequence of the Template strand Template, the generated Trigger sequence is complementary and paired with the partial sequence of the hairpin 1, so that the hairpin 1 can be opened, the Trigger is complementary with the hairpin 1 to form a double strand, at the moment, a hairpin 2 sequence with a silver cluster (synthesized for later use) at the tail 3 'end is added, and because the partial sequences of the hairpin 1 and the hairpin 2 are completely complementary and paired, after the hairpin 2 is added, the hairpin 2 is opened to form a straight chain with the silver cluster at the tail 3' end, and the Trigger chain is replaced, so that the signal amplification is realized. At this time, the silver cluster at the 3 'end of hairpin 2 is close to the G-rich sequence at the 5' end of hairpin 1, so that the fluorescence of the silver cluster is enhanced.
In the homogeneous reaction, the reaction conditions were 37 ℃.
The preparation method of the biosensor comprises the following steps:
(1) preparing silver nanoclusters AgNCs;
(2) combining a target MiRNA with a Template strand Template to generate Trigger, opening a hairpin 1 by the Trigger, hybridizing to form a double strand, adding a hairpin 2 with a synthesized silver cluster, combining the hairpin 2 to replace the Trigger, and realizing signal amplification, wherein the hairpin 1 is rich in a G sequence to enhance the fluorescence of the silver cluster of the hairpin 2;
(3) the system is mixed and reacted in homogeneous reaction solution.
According to the preparation method, the preparation operation steps of the AgNCs silver cluster are as follows:
1. preparing a PB buffer solution (the concentration is 20 mM), wherein the PB buffer solution is composed of disodium hydrogen phosphate and sodium dihydrogen phosphate, 0.7163g of disodium hydrogen phosphate and 0.3120g of sodium dihydrogen phosphate are respectively weighed to prepare 100ml of solutions, then, a part of disodium hydrogen phosphate and a part of sodium dihydrogen phosphate are mixed, and the pH value of the mixed solution is adjusted to 6.5 for later use.
2. Preparation of AgNO3Concentration of 2mM, volume of 1mL, AgNO3Is easy to decompose when exposed to light, and is prepared on site3The centrifuge tube is wrapped with tinfoil paper.
3. A1 ml centrifuge tube was added 76. mu.l PB (20 mM), 15. mu.l hairpin 2 (100. mu.M), and 4.5. mu.l AgNO3（2mM），Shaking for 1min, and placing in refrigerator at 4 deg.C for 15-30 min. During which NaBH is formulated4，NaBH at a concentration of 2mM in a volume of 1mL4It is prepared on site, and is easily decomposed by heating, and is prepared by using ice water of 0 deg.C.
4. After removal from the freezer, 4.5. mu.l NaBH was added4(2 mM) in the reaction system, shaking for 1min, and placing in a refrigerator at 4 ℃ for more than 4 h.
5. 30ul of prepared AgNCs are put into a centrifuge tube, 120ul of ultrapure water is added into the centrifuge tube and mixed evenly, 150ul of solution is taken into a micro cuvette by a pipette, the micro cuvette is scanned by a fluorescence analyzer, and the emission peak is measured to be 640nm by using exciting light 560nm, thereby proving that the AgNCs are synthesized successfully.
The detection mode of the invention is to design a Template strand containing 2 sections of complementary sequences of MiRNA, the MiRNA will be complementarily paired along the Template strand under the action of polymerase, 2 recognition sites of the shear enzymes are arranged on the Template strand, 1 DNA sequence for changing U into T, a structure for complementarily pairing miRNA and the Template strand and a Trigger sequence which is completely complementarily paired with a brown bold italic part on the Template strand are generated, and the cyclic amplification of the target is realized. In addition, 2 hairpins are designed, and 2 hairpins have base complementary sequences, so when the hairpin 2 is added after the hairpin 1 is opened into a straight chain, and the hairpin 2 and the hairpin 1 are complementarily paired, the hairpin 2 is also opened, so that a silver cluster of the hairpin 2 can be close to a G-rich sequence on the hairpin 1, and the fluorescence of the silver cluster is obviously enhanced. Before detection, hairpin 2 is synthesized into silver clusters in advance, and then fluorescence is measured, wherein the fluorescence intensity is 295 nm. Adding a target substance to react with the template chain and the Nt. AlWI enzyme, then adding the hairpin 1, adding the hairpin 2 with the silver cluster at the tail end after the reaction, and measuring the fluorescence intensity of the homogeneous solution to be 980 nm.
The invention can form silver clusters based on C-rich sequences and G-rich sequences to enhance silver cluster luminescence, and meanwhile, the template strand contains 2 identical target MiRNA complementary sequences, so that Nt. AlWI enzyme cleavage can generate 1 DNA sequence for changing U in miRNA into T, a Trigger and a structure of complementary pairing of the target and the template strand, the structure can continuously generate the target and the Trigger under the action of phi29 and dNTPs, which is equivalent to target amplification, the target performs next cycle reaction, which is equivalent to Trigger amplification, the amount of Trigger is increased, and the first amplification is realized. In addition, in the subsequent reaction, after the trigger is combined with the hairpin 1, the hairpin 1 is opened, and then the hairpin 2 is added, so that the hairpin 2 can be complementarily paired with the hairpin 1 to replace the trigger, and the cyclic amplification of the trigger is realized, which is the second amplification. Therefore, the process realizes double signal amplification, the first replay amplifier can amplify both the target object and trigger, and the second replay amplifier amplifies trigger. The sensor has the advantages of low detection limit, high sensitivity, less types of required enzymes, simple operation, capability of realizing dual signal amplification and the like, can make up for the defects and shortcomings of the existing detection method of MiRNA, and realizes quick and accurate quantitative detection of the MiRNA.
The invention has the beneficial effects that:
1. by using the ingenious design of a template chain (2 sections of the same sequences complementary with the target MiRNA on the template chain) and the double-cycle amplification function of chain replacement, the cyclic utilization of the Trigger is realized, the detection signal is amplified, the detection sensitivity is improved, and the ultra-sensitivity detection of the target MiRNA is realized;
2. the sensor has mild reaction conditions and high reaction speed;
3. the fluorescence of the silver clusters is enhanced due to the G-rich sequence, and the detection method is simple and convenient to operate, obvious in result, short in detection period and sensitive in detection;
4. the main processes of the detection principle are realized in a homogeneous phase, so that the reaction speed is improved, the complexity of operation is reduced, and the rapid, simple and sensitive detection of a target object is realized;
5. the preparation method is simple, the performance is stable, the repeatability of the silver cluster luminescence enhancement is good, and the method is suitable for the detection of a tumor marker MiRNA in the field of medical health, lays a foundation for the treatment of subsequent tumors and the practical application of biosensor industrialization;
the process for manufacturing the biosensor has low cost and is suitable for the requirement of low price in industrialization.
Drawings
FIG. 1 is a schematic diagram of the experiment;
FIG. 2 is a graph showing the results of the concentration-optimized detection of HAP1 in example 1;
FIG. 3 is a graph showing the results of the optimized detection of Template concentration in example 2;
FIG. 4 is a graph showing the results of the concentration-optimized detection of HAP2 in example 3;
FIG. 5 is a calibration curve of the sensor of example 4.
Detailed Description
The present invention is further illustrated by the following specific examples.
The preparation method of the biosensor comprises the following steps:
(1) preparing silver nanoclusters AgNCs by using the hairpin 2;
(2) combining a target MiRNA with a Template strand Template to generate Trigger, opening the hairpin 1 by the Trigger, hybridizing into a double strand, combining the hairpin 2 to replace the Trigger, and realizing signal amplification, wherein the hairpin 1 has a G-rich sequence which can enhance the fluorescence of the silver cluster of the hairpin 2;
(3) the system is mixed and reacted in homogeneous reaction solution.
According to the preparation method, the preparation operation steps of the AgNCs silver cluster are as follows:
1. preparing a PB buffer solution (the concentration is 20 mM), wherein the PB buffer solution is composed of disodium hydrogen phosphate and sodium dihydrogen phosphate, 0.7163g of disodium hydrogen phosphate and 0.3120g of sodium dihydrogen phosphate are respectively weighed to prepare 100ml of solutions, then, a part of disodium hydrogen phosphate and a part of sodium dihydrogen phosphate are mixed, and the pH value of the mixed solution is adjusted to 6.5 for later use.
2. Preparation of AgNO3Concentration of 2mM, volume of 1mL, AgNO3Is easy to decompose when exposed to light, and is prepared on site3The centrifuge tube is wrapped with tinfoil paper.
3. A1 ml centrifuge tube was added 76. mu.l PB (20 mM), 15. mu.l hairpin 2 (100. mu.M), and 4.5. mu.l AgNO3(2 mM), shake for 1min, and place in a refrigerator at 4 deg.C for 15-30 min. During which NaBH is formulated4，NaBH at a concentration of 2mM in a volume of 1mL4It is prepared on site, and is easily decomposed by heating, and is prepared by using ice water of 0 deg.C.
4. After removal from the freezer, 4.5. mu.l NaBH was added4(2 mM) in the reaction system, shaking for 1min, and placing in a refrigerator at 4 ℃ for more than 4 h.
5. 30ul of prepared AgNCs are put into a centrifuge tube, 120ul of ultrapure water is added into the centrifuge tube and mixed evenly, 150ul of solution is taken into a micro cuvette by a pipette, the micro cuvette is scanned by a fluorescence analyzer, and the emission peak is measured to be 650nm by using exciting light of 560nm, thereby proving that the AgNCs are synthesized successfully.
The detection mode of the invention is to design a template chain to contain 2 sections of complementary sequences of MiRNA, the MiRNA can be complementarily paired along the template chain under the action of polymerase and dNTPs, 2 recognition sites of cutting enzyme are arranged on the template chain, 1 DNA sequence for changing U in miRNA into T, a Trigger and a structure for complementarily pairing the target miRNA and the template chain are generated, the structure can continuously generate the target and the Trigger under the action of phi29 polymerase, dNTP and Nt. In addition, 2 hairpins are designed, and 2 hairpins have base complementary sequences, so when the hairpins 2 and 1 are complementarily paired after the hairpins 1 are opened into a straight chain, the hairpins 2 are also opened, so that silver clusters of the hairpins 2 can be close to G-rich sequences on the hairpins 1, and the fluorescence of the silver clusters is obviously enhanced. Before detection, hairpin 2 is synthesized into silver clusters in advance, and then fluorescence is measured, wherein the fluorescence intensity is 100. Adding a template chain, phi29 polymerase, Nt.AlWI enzyme, a hairpin 1 and a hairpin 2 with a silver cluster at the end into a system, when a target MiRNA exists, hybridizing the target MiRNA with the template chain, extending under the action of phi29 polymerase, generating Trigger under the action of Nt.AlWI enzyme, opening the hairpin 1 by the Trigger, complementarily pairing the hairpin 2 with the hairpin 1 after the hairpin 1 is opened, enabling a homogeneous G-rich sequence of the hairpin 1 to approach the silver cluster of the hairpin 2, and measuring the fluorescence intensity of the solution to be 940.
The invention can form silver clusters based on C-rich sequences and G-rich sequences to enhance silver cluster luminescence, and meanwhile, the template strand contains 2 identical target MiRNA complementary sequences, so that Nt. AlWI enzyme cleavage can generate 1 DNA sequence for changing U in miRNA into T, a Trigger and a structure of complementary pairing of the target and the template strand, the structure can continuously generate the target and the Trigger under the action of phi29 and dNTPs, which is equivalent to target amplification, the target performs next cycle reaction, which is equivalent to Trigger amplification, the amount of Trigger is increased, and the first amplification is realized. In addition, in the subsequent reaction, after the trigger is combined with the hairpin 1, the hairpin 2 can be complementarily paired with the hairpin 1 after the hairpin 1 is opened so as to replace the trigger, so that the cyclic amplification of the trigger is realized, and the second amplification is realized. Therefore, the process realizes double signal amplification, the first replay amplifier can amplify both the target object and trigger, and the second replay amplifier amplifies trigger. The sensor has the advantages of low detection limit, high sensitivity, less types of required enzymes, simple operation, capability of realizing dual signal amplification and the like, can make up for the defects and shortcomings of the existing detection method of MiRNA, and realizes quick and accurate quantitative detection of the MiRNA. The schematic diagram is shown in fig. 1.
Example 1
The main steps of the reaction process in the homogeneous solution are as follows:
the reaction was divided into A, B two systems, system A containing 2. mu.L of MiRNA, 2. mu.L of 10nM Template strand Template, 2. mu.L of 10 XPhi 29 buffer, 2. mu.L of 1000mM potassium chloride, and 12. mu.L of DEPC water, totaling 20. mu.L. The B system contained 2. mu.L of 40U/. mu.L RNase inhibitor, 1. mu.L of 250. mu.M dNTPs, 1. mu.L of Nt. AlWI, 2. mu.L of 0.4U/. mu.L phi29, and different concentrations of hairpin 1(HAP1) (final concentrations of 0.4. mu.M, 0.6. mu.M, 0.8. mu.M, 1.0. mu.M, 1.2. mu.M, 1.4. mu.M, respectively) were added to the B system, followed by 2. mu.L of 15. mu.M of hairpin 2 with silver clusters already synthesized, giving a total of 10. mu.L of B system. The A solution was incubated at 90 ℃ for 10min and then gradually cooled from 90 ℃ to 37 ℃. Next, part A and part B were mixed and incubated for 1h in a 37 ℃ water bath. The total volume of the A system and the B system is 30 mu L, then 120 mu L of water is added for mixing, and the fluorescence is detected by a fluorescence instrument.
It was determined that the intensity of the detected fluorescence signal increases with increasing concentration of hairpin 1 in the interval of 0.4-1.4. mu.M, and that the fluorescence intensity starts to decrease gradually when the concentration exceeds 1.0. mu.M, as shown in FIG. 2. Therefore, the optimal final concentration of hairpin 1 is 1.0. mu.M.
Example 2
The reaction was split into A, B two systems, system A containing 2. mu.L of MiRNA, 2. mu.L of 10 XPhi 29 buffer, 2. mu.L of 1000mM potassium chloride, 12. mu.L of DEPC water, and 2. mu.L of Template strand Template (final concentrations of 0.4nM,0.6nM,0.8nM,1nM,1.2nM,1.4 nM) added to system A for a total of 20. mu.L. The B system contained 2. mu.L of 40U/. mu.L RNase inhibitor, 1. mu.L of 250. mu.M dNTPs, 1. mu.L of Nt. AlWI, 2. mu.L of 0.4U/. mu.L phi29, 2. mu.L of 15. mu.M hairpin 1 and 2. mu.L of 15. mu.M hairpin 2 which has been synthesized into silver clusters, for a total of 10. mu.L. The A solution was incubated at 90 ℃ for 10min and then gradually cooled from 90 ℃ to 37 ℃. Next, part A and part B were mixed and incubated for 1h in a 37 ℃ water bath. The total volume of the A system and the B system is 30 mu L, then 120 mu L of water is added for mixing, and the fluorescence is detected by a fluorescence instrument.
The detected fluorescence signal intensity increases with the increase of Template strand Template concentration in the interval of 0.4-1.4 nM, and the fluorescence intensity begins to decrease gradually when the concentration exceeds 1.0nM, as shown in FIG. 3. The optimal final concentration of template strand is therefore 1.0 nM.
Example 3
The main steps of the reaction process in the homogeneous solution are as follows:
the reaction was split into A, B two systems, system A containing 2. mu.L of MiRNA, 2. mu.L of 10nM template strand, 2. mu.L of 10 XPhi 29 buffer, 2. mu.L of 1000mM potassium chloride, 12. mu.L of DEPC water, for a total of 20. mu.L. The B system comprises 2. mu.L of 40U/. mu.L RNase inhibitor, 1. mu.L of 250. mu.M dNTPs, 1. mu.L of Nt. AlWI, 2. mu.L of 0.4U/. mu.L phi29, 2. mu.L of 15. mu.M hairpin 1 and 2. mu.L of hairpin 2 with synthesized silver clusters in different concentrations (final concentrations of 0.4. mu.M, 0.6. mu.M, 0.8. mu.M, 1.0. mu.M, 1.2. mu.M and 1.4. mu.M, respectively), and the B system is 10. mu.L. The A solution was incubated at 90 ℃ for 10min and then gradually cooled from 90 ℃ to 37 ℃. Next, part A and part B were mixed and incubated for 1h in a 37 ℃ water bath. The total volume of the A system and the B system is 30 mu L, then 120 mu L of water is added for mixing, and the fluorescence is detected by a fluorescence instrument.
It was examined that the intensity of the detected fluorescence signal increased as the concentration of hairpin 2(HAP2) having synthesized silver clusters increased in the interval of 0.4-1.4. mu.M, and the fluorescence intensity began to gradually decrease when the concentration exceeded 1.0. mu.M, as shown in FIG. 4. Therefore, the optimal final concentration of hairpin 2, which has synthesized silver clusters, is 1.0. mu.M.
Example 4
The invention relates to a preparation method of a biosensor for detecting miRNA based on that a G-rich sequence can enhance silver cluster fluorescence:
the main steps of the reaction process in the homogeneous solution are as follows:
the reaction was split into A, B two systems, the A system containing 2. mu.L of MiRNA at different concentrations (final concentrations 0pM, 10pM, 50 pM, 100pM, 1nM, 5 nM), 2. mu.L of 10nM Template strand Template, 2. mu.L of 10 XPhi 29 buffer, 2. mu.L of 1000mM potassium chloride, 12. mu.L of DEPC water, for a total of 20. mu.L. The B system contained 2. mu.L of 40U/. mu.L RNase inhibitor, 1. mu.L of 250. mu.M dNTPs, 1. mu.L of AlWI, 2. mu.L of 0.4U/. mu.L phi29, 2. mu.L of 15. mu.M hairpin 1 was added to the B system, followed by 2. mu.L of 15. mu.M hairpin 2 with synthesized silver clusters, resulting in a total of 10. mu.L B system. The A solution was incubated at 90 ℃ for 10min and then gradually cooled from 90 ℃ to 37 ℃. Next, part A and part B were mixed and incubated for 1h in a 37 ℃ water bath. The total volume of the A system and the B system is 30 mu L, then 120 mu L of water is added for mixing, and the fluorescence is detected by a fluorescence instrument.
The results are shown in FIG. 5, where we can see that the fluorescence intensity is gradually increased when the concentration of MiRNA is 10pM to 5nM, and the reaction is steadily proceeding.
<110> university of Jinan
<120> biosensor for detecting MiRNA and preparation method thereof
<160>2
<210>1
<211>22
<212>DNA
<213>miRNA-122
<220>
<221>misc_feature
<222>(1)..(22)
<400>1
UGG AGU GUG ACA AUG GUG UUU G 22
<210>2
<211>86
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(1)..(86)
<400>2
CCT TCT CGT CGC ACT GTC GCA CTC AGC TCT 30
GAT CCA AAC ACC ATT GTC ACA CTC CAC TCT 60
GAT CCA AAC ACC ATT GTC ACA CTC CA 86
<210>3
<211>75
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(1)..(75)
<400>3
TGG GGT GGG TGG GTG GGG TTT TTT GCG ACA 30
GTG CAC ATT CAT ATT TCA CCC TTC TCG TCG 60
CAC TGT CGC ACT CAG 75
<210>4
<211>63
<212>DNA
<213> Artificial sequence
<220>
<221>misc_feature
<222>(1)..(63)
<400>4
CGA CAG TGC GAC GAG AAG GGT GAA ATA TGA 30
ATG TGC ACT GTC GCT TTT TTC CCC CTA ATT 60
CCC 63
Claims (1)
1. A preparation method of a biosensor for detecting MiRNA is characterized by comprising the following steps:
(1) preparing silver nanoclusters AgNCs by using the hairpin 2;
(2) the system is mixed and reacted in homogeneous reaction solution;
the sequence of the hairpin 2 is shown as SEQ ID NO. 4;
the preparation operation steps of the silver nanoclusters AgNCs are as follows:
1) preparing a PB buffer solution with the concentration of 20 mM;
2) 1mL of 2mM AgNO was prepared3；
3) A1 ml centrifuge tube was added 20mM 76. mu.l PB, 15. mu.l 100. mu.M hairpin 2, and 4.5. mu.l 2mM AGNO3，Shaking for 1min, and placing in refrigerator at 4 deg.C for 15-30 min;
4) preparation of NaBH with ice water at 0 ℃ during the reaction in step 3)4A solution at a concentration of 2mM in a volume of 1 mL;
5) after removing the solution of step 3) from the refrigerator, 2mM 4.5. mu.l NaBH was added4Shaking for 1min, and placing in a refrigerator at 4 deg.C for more than 4 h;
6) taking 30ul of prepared AgNCs into a centrifuge tube, adding 120ul of ultrapure water, uniformly mixing, taking 150ul of solution into a micro cuvette by using a pipette, scanning the micro cuvette by using a fluorescence analyzer, measuring an emission peak at 650nm by using exciting light at 560nm, and proving that the AgNCs are successfully synthesized;
the main steps of the reaction process in the homogeneous solution are as follows:
the reaction is divided into A, B two systems,
a system comprises
2 μ L of MiRNA;
2 μ L of 10nM Template strand Template;
2 μ L of buffer 10 × phi 29;
2 μ L1000mM potassium chloride;
12 μ L of DEPC water;
20 mu L in total;
b system comprises
2 μ L of 40U/. mu.L RNase inhibitor;
1 μ L of 250 μ M dNTPs;
1μL Nt.AlWI；
2 μ L of 0.4U/. mu.L phi 29;
adding 2 mu L of hairpin 1 with 15 mu M into the B system, and then adding 2 mu L of hairpin 2 with 15 mu M synthesized silver clusters, so that the B system is 10 mu L; incubating the A system at 90 ℃ for 10min, and then gradually cooling from 90 ℃ to 37 ℃; thereafter, part A and part B were mixed and incubated for 1h in a 37 ℃ water bath; the total volume of the A system and the B system is 30 mu L, then 120 mu L of water is added and mixed evenly, and fluorescence is detected by a fluorescence instrument;
the sequence of the MiRNA is shown as SEQ ID NO: 1;
the Template sequence is shown as SEQ ID NO. 2;
the hairpin 1 sequence is shown in SEQ ID NO. 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710112746.5A CN106770143B (en) | 2017-02-28 | 2017-02-28 | Biosensor for detecting MiRNA and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710112746.5A CN106770143B (en) | 2017-02-28 | 2017-02-28 | Biosensor for detecting MiRNA and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106770143A CN106770143A (en) | 2017-05-31 |
| CN106770143B true CN106770143B (en) | 2020-03-13 |
Family
ID=58959800
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710112746.5A Expired - Fee Related CN106770143B (en) | 2017-02-28 | 2017-02-28 | Biosensor for detecting MiRNA and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106770143B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107727621B (en) * | 2017-09-29 | 2020-04-17 | 济南大学 | Method for detecting miRNA (micro ribonucleic acid) by using enzyme-labeled DNA (deoxyribonucleic acid) logic system |
| CN108663354B (en) * | 2018-03-19 | 2021-05-14 | 安徽师范大学 | Electrogenerated chemiluminescence sensor constructed based on DNA-silver nanoclusters, and preparation and application thereof |
| CN108535236B (en) * | 2018-03-30 | 2020-06-30 | 华南师范大学 | Method for ultrasensitively detecting miRNA based on dual-amplification SERS signal system |
| CN111424071B (en) * | 2020-04-09 | 2022-09-23 | 济南大学 | Biosensor for detecting miRNA-141 and preparation method and application thereof |
| CN112359094B (en) * | 2020-07-27 | 2024-05-10 | 江苏科技大学 | DNA/Fe3O4Nucleic acid detection method combining reticular structure with magnetic three-phase extraction method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013063454A1 (en) * | 2011-10-27 | 2013-05-02 | Nesher Technologies, Inc. | Methods and compositions for multiplexed and ultrasensitive microrna detection |
| CN104764782A (en) * | 2015-04-10 | 2015-07-08 | 大连理工大学 | Preparation of boron-doped graphene quantum dot electrochemiluminescence sensor for detecting miRNA-20a and application of sensor |
| CN106018372A (en) * | 2016-07-19 | 2016-10-12 | 济南大学 | Fluorescent/colorimetric dual-mode MiRNA sensor constructed through dual-mode complex probe |
-
2017
- 2017-02-28 CN CN201710112746.5A patent/CN106770143B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013063454A1 (en) * | 2011-10-27 | 2013-05-02 | Nesher Technologies, Inc. | Methods and compositions for multiplexed and ultrasensitive microrna detection |
| CN104764782A (en) * | 2015-04-10 | 2015-07-08 | 大连理工大学 | Preparation of boron-doped graphene quantum dot electrochemiluminescence sensor for detecting miRNA-20a and application of sensor |
| CN106018372A (en) * | 2016-07-19 | 2016-10-12 | 济南大学 | Fluorescent/colorimetric dual-mode MiRNA sensor constructed through dual-mode complex probe |
Non-Patent Citations (3)
| Title |
|---|
| Hairpin DNA-Templated Silver Nanoclusters as Novel Beacons in Strand Displacement Amplification for MicroRNA Detection;Jingpu Zhang et al;《Anal. Chem》;20151217;第88卷;第1294-1302 * |
| Hybridization chain reaction modulated DNA-hosted silver nanoclusters for fluorescent identification of single nucleotide polymorphisms in the let-7 miRNA family;Xue Qiu et al;《Biosensors and Bioelectronics》;20140430;第60卷;摘要，第352页左栏第2段、右栏第2.5、3.1节 * |
| MicroＲNA 的超灵敏检测研究进展;王子月 等;《高等学校化学学报》;20170131;第1-11页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106770143A (en) | 2017-05-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106770143B (en) | Biosensor for detecting MiRNA and preparation method thereof | |
| Liao et al. | Target-triggered enzyme-free amplification strategy for sensitive detection of microRNA in tumor cells and tissues | |
| Huang et al. | Colorimetric and fluorescent dual-mode detection of microRNA based on duplex-specific nuclease assisted gold nanoparticle amplification | |
| Zhang et al. | Multiplexed detection of microRNAs by tuning DNA-scaffolded silver nanoclusters | |
| Hao et al. | A highly sensitive ratiometric electrochemiluminescent biosensor for microRNA detection based on cyclic enzyme amplification and resonance energy transfer | |
| Liu et al. | A Graphene-enhanced imaging of microRNA with enzyme-free signal amplification of catalyzed hairpin assembly in living cells | |
| Zhang et al. | Streptavidin-enhanced surface plasmon resonance biosensor for highly sensitive and specific detection of microRNA | |
| Guo et al. | Amplified fluorescence sensing of miRNA by combination of graphene oxide with duplex-specific nuclease | |
| Gu et al. | Enzyme-free amplified detection of miRNA based on target-catalyzed hairpin assembly and DNA-stabilized fluorescent silver nanoclusters | |
| Wang et al. | A copper-free and enzyme-free click chemistry-mediated single quantum dot nanosensor for accurate detection of microRNAs in cancer cells and tissues | |
| Wang et al. | Target-assisted FRET signal amplification for ultrasensitive detection of microRNA | |
| Kim et al. | Electrochemical detection of zeptomolar miRNA using an RNA-triggered Cu2+ reduction method | |
| Yan et al. | A novel and versatile nanomachine for ultrasensitive and specific detection of microRNAs based on molecular beacon initiated strand displacement amplification coupled with catalytic hairpin assembly with DNAzyme formation | |
| Li et al. | Catalytic hairpin assembly induced dual signal enhancement for rapid detection of miRNA using fluorescence light-up silver nanocluster | |
| CN105018603A (en) | Constant temperature index amplification technology based on triple amplification reaction connection in series and application of constant temperature index amplification technology in microRNA detection | |
| CN107130024B (en) | Method for detecting microRNA based on helicase-dependent DNA isothermal amplification technology | |
| CN106967794B (en) | Kit and method for detecting miRNA (micro ribonucleic acid) by bidirectional signal amplification | |
| Oishi | Enzyme-free and isothermal detection of microRNA based on click-chemical ligation-assisted hybridization coupled with hybridization chain reaction signal amplification | |
| Wei et al. | An enzyme-free surface plasmon resonance imaging biosensing method for highly sensitive detection of microRNA based on catalytic hairpin assembly and spherical nucleic acid | |
| Zhang et al. | NEase-based amplification for detection of miRNA, multiple miRNAs and circRNA | |
| Chen et al. | Intracellular self-enhanced rolling circle amplification to image specific miRNAs within tumor cells | |
| Qu et al. | A fluorescence strategy for circRNA quantification in tumor cells based on T7 nuclease-assisted cycling enzymatic amplification | |
| Zhu et al. | Engineering entropy-driven based multiple signal amplification strategy for visualized assay of miRNA by naked eye | |
| Chen et al. | A cancer cell membrane vesicle-packaged DNA nanomachine for intracellular microRNA imaging | |
| CN111549104B (en) | Non-diagnosis-purpose circRNA detection method based on long-chain DNA scaffold DNA nanobelt |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200313 Termination date: 20210228 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |