CN110452810A - A kind of biosensor and its preparation method and application detecting MicroRNA - Google Patents
A kind of biosensor and its preparation method and application detecting MicroRNA Download PDFInfo
- Publication number
- CN110452810A CN110452810A CN201910753538.2A CN201910753538A CN110452810A CN 110452810 A CN110452810 A CN 110452810A CN 201910753538 A CN201910753538 A CN 201910753538A CN 110452810 A CN110452810 A CN 110452810A
- Authority
- CN
- China
- Prior art keywords
- dna
- added
- tetrad
- preparation
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
Abstract
The present invention relates to biosensor technology fields, it is proposed that a kind of shine based on G- tetrad DNAzyme technical regulation AuNPs coagulation quenching DNA/AgNCs detects MicroRNA biosensor, skilfully use G- tetrad DNAzyme, it realizes the sequence when G- tetrad to be exposed, forms G- tetrad/ferroheme DNA enzymatic when there are ferroheme.Cysteine is oxidized to cystine with G- tetrad/ferroheme class horseradish peroxidase catalytic performance, inhibit the plasma resonance coupling between cysteine and gold nanoparticle, to inhibit the reunion of Gold nanoparticle, DNA/AgNCs single-stranded at this time can be adsorbed to a nanometer gold surface, fluorescence signal weakens, to realize the detection to miR-122, solve the problems, such as that the method specificity for detecting MicroRNA in the prior art and sensitivity are all relatively low, at high cost.
Description
Technical field
The present invention relates to biosensor technology fields, in particular to are based on G- tetrad DNAzyme technical regulation AuNPs
Coagulation quenches the luminous detection MicroRNA biosensor of DNA/AgNCs, further relates to preparation method and application.
Background technique
MicroRNA(miRNA) it is non-coding RNA that a kind of length is 17-25 nucleotide, in RNA silencing and gene
It works in transcriptional regulatory, they play crucial regulatory function in many bioprocess, if tumour occurs, transfer, in advance
Afterwards, cell differentiation, Apoptosis and protein synthesis.Abnormal miRNA, which is expressed, can induce a variety of diseases, such as cancer, diabetes,
Cardiovascular disease and neurological.Therefore, miRNA has become the biology mark of diagnosis and the treatment of a variety of diseases such as cancer
Will object.
In recent decades, many analysis strategies include Northern blotting, real-time polymerase chain reaction (RT-PCR)
And microarray, it has developed for identifying and quantifying miRNA.However, Northern trace time-consuming, complex process, sensitivity are low.
As for PCR, contaminated fragility is needed in professional technician and treatment process to greatly limit its low sensitive
Degree, specificity and poor repeatability.Therefore, hypersensitivity and the specific requirements for improving miRNA detection are extremely urgent.
Summary of the invention
In order to solve, the above method specificity and sensitivity for detecting miRNA concentration in the prior art is all relatively low, detects
Period long problem, the present invention provides a species specificity and high sensitivity, detection is fireballing is based on G- tetrad DNAzyme
Technical regulation AuNPs coagulation quenches the biosensor of the luminous negative signal detection MicroRNA of DNA/AgNCs.
A kind of biological sensor of quantitative detection miRNA, including homogeneous reaction liquid, object miR-122, H1 chain,
H2 chain, DNA/AgNCs chain, ferroheme, potassium ion, cysteine, nanogold；
The homogeneous reaction liquid is phosphate buffer PBS, is formed as follows with concentration: 20 mM Na2HPO4, 20 mM
NaH2PO4, 140 mM NaCl, 1 mM MgCl2, pH value 7.4；
The miR-122 base sequence is as shown in SEQ No.1；
The H1 base sequence is as shown in SEQ No.2；
The H2 base sequence is as shown in SEQ No.3；
The DNA/AgNCs base sequence is as shown in SEQ No.4.
The preparation method of above-mentioned biological sensor, comprising the following steps:
(1) by object miR-122 and H1, H2,5 × PBS phosphate buffer, 37 DEG C of isothermal reactions after mixing；
(2) after mixing by DNA/AgNCs chain and phosphate buffer, AgNO is added3Solution stands one section after mixing
Sodium borohydride is added after time in mixed liquor, stand for standby use at dark after fast vibration；
(3) nanogold, cysteine, ferroheme is added to step (1) and step (2) acquired solution, 37 DEG C of constant temperature are anti-after mixing
It answers；
(4) reaction solution of step (3) is subjected to fluorescence intensity detection, it is 560 nm, launch wavelength that excitation wavelength, which is arranged, in luminoscope
For 615 nm, 540 nm-660 nm of detection range.
It is 2h when the reaction of the step (1).
The AgNO that the step (2) is added3The molar ratio of silver ion and DNA are 6:1 in solution, and AgNO is added3Solution
Reaction temperature after mixing is 4 DEG C, time 15min；After sodium borohydride is added, fast vibration 1 minute, reaction condition was
Temperature is 4 DEG C, time 6h.
The reaction time of the step (3) is 2h.
Application of the above-mentioned biological sensor on detection miRNA.
Application of the above-mentioned biological sensor on quantitative detection miRNA.
4 chains are used altogether in the present invention, sequence is respectively:
miR-122: UGGAGUGUGACAAUGGUGUUUG
H1:GGGCGGGTGGGAGTGTGACTCACGGTAGCGGGCTACCAAACACCATTGTCACACTCCAGGGA
H2:TGGGCCGCTACCGTGAGTCAGGAGTGTGACAATGGTGTTTGGTAGCGGCCGGGATGGGCGGG
DNA/AgNCs: CCCTTAATCCCCCGTTGACTTGTGTTGCCCTAACTCCCC
The working principle of this biosensor is as follows:
H1 and H2 has the base that can be formed hairpin structure and form G- tetrad, since H1 and H2 itself formation hairpin structure will
The base that part forms G- tetrad is closed, so that can not form G- tetrad under hairpin state.The number of base energy of H1
Enough and miR-122 complementary pairing, in the presence of miR-122, miR-122 and H1 base pair complementarity open H1 hair clip
Structure, and then the number of base of H1 can open hair clip H2 with H2 base pair complementarity, then H2 can continue to open hair clip again
H1 can be combined constantly with this H1, H2, realize hybridization chain type amplification (HCR).5 ' the ends and 3 ' of H1 and H2 simultaneously
End joins end to end, so that the sequence for forming G- tetrad is exposed, G- tetrad/ferroheme is formed when there are ferroheme
DNA enzymatic.Cysteine is oxidized to cystine with G- tetrad/ferroheme class horseradish peroxidase catalytic performance,
It cannot achieve the plasma resonance coupling between cysteine and gold nanoparticle, to inhibit the group of Gold nanoparticle
Poly-, DNA/AgNCs single-stranded at this time can be adsorbed to a nanometer gold surface, and fluorescence signal weakens, to realize to miR-122's
Detection.
The invention has the following advantages that
1, high specific and detection cycle are short
Synthetic H1 structure and object miRNA specific recognition, has high specific；The reaction condition temperature of the sensor
With reaction speed is fast；Due to using fluorescence method, detection method is easy to operate, detection cycle is short；The main process of testing principle
It is to improve reaction speed in homogeneous middle realization, reduce the complexity of operation, realize the quick of object, letter
It is single, it is sensitive to detect.
2, at low cost, have a wide range of application
The process does not have the participation of enzyme, effectively reduces the process costs of biosensor, inexpensive suitable for industrialization
Requirement；Preparation method is simple, performance stablize, fluorescence detection it is reproducible, suitable for a variety of miRNA detection and biology
The practical application of sensor industrialization.
Detailed description of the invention
Fig. 1 is the schematic diagram of the experiment；
Fig. 2 is 3 testing result figure of embodiment；
Fig. 3 is 4 testing result figure of embodiment；
Fig. 4 is 5 testing result figure of embodiment.
Specific embodiment
Invention is further explained combined with specific embodiments below.
The preparation of 1 nanogold of embodiment.
(1) 200ml ultrapure water is added into three-necked flask；
(2) taking 500 μ L concentration is the HAuCl of 0.04g/mL4In centrifuge tube, add 200ml ultrapure water, be heated with stirring to boiling,
Mixing speed 450rpm；
(3) under stirring conditions, taking 3ml concentration is that 1% citric acid three sodium solution rapidly joins in the solution of step (2), molten
Liquid color becomes claret from light yellow, continues after heating 15min, removes heat source, be slowly cooled to room temperature, as 4 DEG C
It saves backup.
Using ultraviolet specrophotometer, according to light absorption value at 530nm, the concentration of nanogold is about 0.3nM in above-mentioned solution.
The preparation of 2 DNA/AgNCs of embodiment.
(1) the 20 mM PB buffers (pH 7.0) of 100 μM of DNA/AgNCs of 15 μ L and 73 μ L are added to and use tin
In the EP pipe of foil paper package, the AgNO of 1.5 mM of 6 μ L is then added3Solution (ensures Ag+Ratio with H3 is 6:1),
1 min is shaken, 30 min are placed at 4 DEG C；
After (2) 30 min, continue the NaBH that 1.5 mM of 6 μ L are added into EP pipe4, 1 min is shaken, it is dark at 4 DEG C
It is spare to place 6 h or more.
The preparation method for the solution used in the above process:
Ultrapure water is both needed to carry out high-temperature sterilization processing.Specific method is that ultrapure water is individually positioned in conical flask, then uses tin
Foil paper and newspaper are sealed.In high-pressure sterilizing pot 120 DEG C at a temperature of sterilize 20 min.
According to the fluorescence intensity of the concentration of serial miRNA, make standard curve.Calculating regression equation is F=880.42+
185.68 × LgC/pM, related coefficient 0.988.
The influence that the concentration of 3 difference H1 of embodiment detects miRNA.
The preparation method of the biological sensor, comprising the following steps:
(1) by 1nM miRNA, H1(2 μ L, final concentration is respectively 0.4 μM, and 0.6 μM, 0.8 μM, 1.0 μM, 1.2 μM,
1.4 μM), H2(2 μ L, 20 μM), 5 × PBS(3 μ L) and, it is added in centrifuge tube, shakes 30s, be put into 37 DEG C of water-bath
React 30 min.
(2) completely reacted solution is taken out from water-bath, adds nano-Au solution (10 μ L), cysteine (2 μ
L) and 4 μ L ferrohemes (final concentration of 1 μM), it is put into 37 DEG C of water-bath and reacts 1 h.
(3) solution (30 μ L) after step (2) reaction is diluted to 100 μ L, will then carries out fluorescence detection；Excitation wave
It is long to be set as 565nm, launch wavelength 650nm, detection range 600nm-800nm, read fluorescence signal variation.
As a result Fig. 2 is seen, it can be seen from the figure that fluorescence intensity constantly weakens with the increase of H1 concentration, when concentration reaches
After 1 μM, fluorescence intensity is basically unchanged.Illustrate that testing required H1 concentration is 1 μM.
The influence that the concentration of 4 difference H2 of embodiment detects miRNA.
The preparation method of the biological sensor, comprising the following steps:
(1) by 1nM miRNA, H1(2 μ L, 20 μM), H2(2 μ L, final concentration is respectively 0.4 μM, and 0.6 μM, 0.8 μM,
1.0 μM, 1.2 μM, 1.4 μM), 5 × PBS(3 μ L), it is added in centrifuge tube, shakes 30s, is put into 37 DEG C of water-bath anti-
Answer 30 min.
(2) completely reacted solution is taken out from water-bath, adds nano-Au solution (10 μ L), cysteine (2 μ
L) and 4 μ L ferrohemes (final concentration of 1 μM), it is put into 37 DEG C of water-bath and reacts 1 h.
(3) solution (30 μ L) after step (2) reaction is diluted to 100 μ L, will then carries out fluorescence detection；Excitation wave
It is long to be set as 565nm, launch wavelength 650nm, detection range 600nm-800nm, read fluorescence signal variation.
As a result Fig. 3 is seen, it can be seen from the figure that fluorescence intensity constantly weakens with the increase of H2 concentration, when concentration reaches
After 1 μM, fluorescence intensity is basically unchanged.Illustrate that testing required H2 concentration is 1 μM.
5 fluorescence intensity of embodiment with miRNA concentration variation
The preparation method of the biological sensor, comprising the following steps:
1) by various concentration (0,10 aM, 100 aM, 1 fM, 10 fM, 100 fM, 1 pM, 10 pM, 100 pM)
MiRNA, H1(2 μ L, 20 μM), H2(2 μ L, 20 μM), 5 × PBS(3 μ L) and, it is added in centrifuge tube, shakes 30s, be put into
30 min are reacted in 37 DEG C of water-bath.
(2) completely reacted solution is taken out from water-bath, adds nano-Au solution (10 μ L), cysteine (2 μ
L) and 4 μ L ferrohemes (final concentration of 1 μM), it is put into 37 DEG C of water-bath and reacts 1 h.
(3) solution (30 μ L) after step (2) reaction is diluted to 100 μ L, will then carries out fluorescence detection；Excitation wave
It is long to be set as 565nm, launch wavelength 650nm, detection range 600nm-800nm, read fluorescence signal variation.
As a result Fig. 4 is seen, it can be seen from the figure that with the increase of miRNA concentration, fluorescence intensity constantly weakens.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by the limit of embodiment
System, other any changes made without departing from the spirit and principles of the present invention, modification, combination, substitution, simplification should be
Equivalence replacement mode, is included within the scope of the present invention.
Sequence table
<110>University Of Ji'nan
<120>a kind of biosensor and its preparation method and application for detecting MicroRNA
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> RNA
<213>artificial sequence (artiartificial sequence)
<400> 1
uggaguguga caaugguguu ug 22
<210> 2
<211> 62
<212> DNA
<213>artificial sequence (artiartificial sequence)
<400> 2
gggcgggtgg gagtgtgact cacggtagcg ggctaccaaa caccattgtc acactccagg 60
ga 62
<210> 3
<211> 62
<212> DNA
<213>artificial sequence (artiartificial sequence)
<400> 3
tgggccgcta ccgtgagtca ggagtgtgac aatggtgttt ggtagcggcc gggatgggcg 60
gg 62
<210> 4
<211> 39
<212> DNA
<213>artificial sequence (artiartificial sequence)
<400> 4
cccttaatcc cccgttgact tgtgttgccc taactcccc 39
Claims (7)
1. a kind of biological sensor of quantitative detection miRNA, which is characterized in that including homogeneous reaction liquid, object miR-
122, H1 chain, H2 chain, DNA/AgNCs chain, ferroheme, potassium ion, cysteine, nanogold；
The homogeneous reaction liquid is phosphate buffer PBS, is formed as follows with concentration: 20 mM Na2HPO4, 20 mM NaH2PO4,
140 mM NaCl, 1 mM MgCl2, pH value 7.4；
The miR-122 base sequence is as shown in SEQ No.1；
The H1 base sequence is as shown in SEQ No.2；
The H2 base sequence is as shown in SEQ No.3；
The DNA/AgNCs base sequence is as shown in SEQ No.4.
2. the preparation method of biological sensor described in claim 1, which comprises the following steps:
(1) by object miR-122 and H1, H2,5 × PBS phosphate buffer, 37 DEG C of isothermal reactions after mixing；
(2) after mixing by DNA/AgNCs chain and phosphate buffer, AgNO is added3Solution stands one section after mixing
Sodium borohydride is added after time in mixed liquor, stand for standby use at dark after fast vibration；
(3) nanogold, cysteine, ferroheme is added to step (1) and step (2) acquired solution, 37 DEG C of constant temperature are anti-after mixing
It answers；
(4) reaction solution of step (3) is subjected to fluorescence intensity detection, it is 560 nm, launch wavelength that excitation wavelength, which is arranged, in luminoscope
For 615 nm, 540 nm-660 nm of detection range.
3. preparation method according to claim 2, which is characterized in that be 2h when the reaction of the step (1).
4. preparation method according to claim 2, which is characterized in that the AgNO that the step (2) is added3It is silver-colored in solution
The molar ratio of ion and DNA are 6:1, and AgNO is added3The reaction temperature of solution after mixing is 4 DEG C, time 15min；
After sodium borohydride is added, fast vibration 1 minute, reaction condition was that temperature is 4 DEG C, time 6h.
5. preparation method according to claim 2, which is characterized in that the reaction time of the step (3) is 2h.
6. application of the biological sensor described in claim 1 on detection miRNA.
7. application of the biological sensor described in claim 1 on quantitative detection miRNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910753538.2A CN110452810B (en) | 2019-08-15 | 2019-08-15 | Biosensor for detecting MicroRNA (micro ribonucleic acid) and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910753538.2A CN110452810B (en) | 2019-08-15 | 2019-08-15 | Biosensor for detecting MicroRNA (micro ribonucleic acid) and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110452810A true CN110452810A (en) | 2019-11-15 |
| CN110452810B CN110452810B (en) | 2022-05-27 |
Family
ID=68486789
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910753538.2A Active CN110452810B (en) | 2019-08-15 | 2019-08-15 | Biosensor for detecting MicroRNA (micro ribonucleic acid) and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110452810B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111424071A (en) * | 2020-04-09 | 2020-07-17 | 济南大学 | Biosensor for detecting miRNA-141 and preparation method and application thereof |
| CN111855631A (en) * | 2020-07-29 | 2020-10-30 | 西北大学 | Snowflake-shaped DNA crystal/copper nanocluster and application thereof in actin detection |
| CN112557369A (en) * | 2020-11-30 | 2021-03-26 | 崔艳芳 | Biosensor for detecting microRNA-21 and preparation method and application thereof |
| CN113151400A (en) * | 2020-08-22 | 2021-07-23 | 农业农村部环境保护科研监测所 | Pb based on DNA tetrahedral nanostructure mediated HCR signal amplification2+Fluorescence sensing method |
| CN114397256A (en) * | 2021-12-03 | 2022-04-26 | 济南大学 | Biosensor for detecting MicroRNA-17 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020197611A1 (en) * | 2001-06-21 | 2002-12-26 | Chagovetz Alexander Michael | Method for real-time detection and quantification of nucleic acid sequences using fluorescent primers |
| CN102618664A (en) * | 2012-05-03 | 2012-08-01 | 武汉大学 | MiRNA (Micro Ribonucleic Acid) detection probe and method for visually detecting miRNA |
| CN102858997A (en) * | 2009-11-02 | 2013-01-02 | 新加坡科技研究局 | Methods for monitoring cellular states and for immortalizing mesenchymal stem cells |
| CN108103146A (en) * | 2018-01-25 | 2018-06-01 | 济南大学 | A kind of biosensor for detecting salmonella |
| CN108333155A (en) * | 2018-01-12 | 2018-07-27 | 济南大学 | A kind of biosensor of fluoroscopic examination mercury ion |
-
2019
- 2019-08-15 CN CN201910753538.2A patent/CN110452810B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020197611A1 (en) * | 2001-06-21 | 2002-12-26 | Chagovetz Alexander Michael | Method for real-time detection and quantification of nucleic acid sequences using fluorescent primers |
| CN102858997A (en) * | 2009-11-02 | 2013-01-02 | 新加坡科技研究局 | Methods for monitoring cellular states and for immortalizing mesenchymal stem cells |
| CN102618664A (en) * | 2012-05-03 | 2012-08-01 | 武汉大学 | MiRNA (Micro Ribonucleic Acid) detection probe and method for visually detecting miRNA |
| CN108333155A (en) * | 2018-01-12 | 2018-07-27 | 济南大学 | A kind of biosensor of fluoroscopic examination mercury ion |
| CN108103146A (en) * | 2018-01-25 | 2018-06-01 | 济南大学 | A kind of biosensor for detecting salmonella |
Non-Patent Citations (1)
| Title |
|---|
| XUEQIU ET.AL.: "《Hybridization chain reaction modulated DNA-hosted silver nanoclusters for fluorescent identification of single nucleotide polymorphisms in the let-7 miRNA family》", 《BIOSENSORS ANDBIOELECTRONICS》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111424071A (en) * | 2020-04-09 | 2020-07-17 | 济南大学 | Biosensor for detecting miRNA-141 and preparation method and application thereof |
| CN111424071B (en) * | 2020-04-09 | 2022-09-23 | 济南大学 | Biosensor for detecting miRNA-141 and preparation method and application thereof |
| CN111855631A (en) * | 2020-07-29 | 2020-10-30 | 西北大学 | Snowflake-shaped DNA crystal/copper nanocluster and application thereof in actin detection |
| CN111855631B (en) * | 2020-07-29 | 2022-12-02 | 西北大学 | Snowflake-shaped DNA crystal/copper nanocluster and application thereof in actin detection |
| CN113151400A (en) * | 2020-08-22 | 2021-07-23 | 农业农村部环境保护科研监测所 | Pb based on DNA tetrahedral nanostructure mediated HCR signal amplification2+Fluorescence sensing method |
| CN112557369A (en) * | 2020-11-30 | 2021-03-26 | 崔艳芳 | Biosensor for detecting microRNA-21 and preparation method and application thereof |
| CN114397256A (en) * | 2021-12-03 | 2022-04-26 | 济南大学 | Biosensor for detecting MicroRNA-17 |
| CN114397256B (en) * | 2021-12-03 | 2024-05-14 | 济南大学 | Biosensor for detecting MicroRNA-17 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110452810B (en) | 2022-05-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110452810A (en) | A kind of biosensor and its preparation method and application detecting MicroRNA | |
| CN109596592B (en) | Biosensor for detecting salmonella based on aptamer and detection method thereof | |
| CN109517880B (en) | Method for detecting telomerase activity based on strand displacement reaction and DNA modified gold nanoparticles | |
| CN103881708B (en) | One step solvent-thermal method prepares method and the application thereof of boron doping carbon quantum dot | |
| CN106970229B (en) | A kind of transcription factor detection method based on DNA- silver nanoclusters molecular beacon and the amplification of exonuclease III cycle signal | |
| Han et al. | Multifunctional G-quadruplex-based fluorescence probe coupled with DNA-templated AgNCs for simultaneous detection of multiple DNAs and MicroRNAs | |
| CN109001167B (en) | Method and kit for detecting Adenosine Triphosphate (ATP) by using strand displacement signal amplification fluorescent sensor based on aptamer and carbon dot | |
| Zhu et al. | Aptamer-based and DNAzyme-linked colorimetric detection of cancer cells | |
| CN109540860B (en) | Fluorescent biosensor for detecting kanamycin and preparation method and application thereof | |
| CN108918509A (en) | A kind of development and its application based on CdSe quantum dot Electrochemiluminescsensor sensor | |
| CN106591423B (en) | Telomerase activity colorimetric detection method based on silver nanoprobe | |
| Mohammadi et al. | Saliva Lab-on-a-chip biosensors: Recent novel ideas and applications in disease detection | |
| Wang et al. | Target-assisted FRET signal amplification for ultrasensitive detection of microRNA | |
| US20140357515A1 (en) | Method and Kit for Identification and Quantification of Single-Strand Target Nucleic Acid | |
| Huang et al. | Toehold-mediated nonenzymatic amplification circuit on graphene oxide fluorescence switching platform for sensitive and homogeneous microRNA detection | |
| CN109486921A (en) | A method of increasing multiple PCR primer compatibility | |
| CN106957908A (en) | MiRNA and/or target molecules with aptamer detection method and detection probe | |
| CN110607351B (en) | Chemiluminescence biosensor for detecting uracil glycosylase, and preparation method and application thereof | |
| Li et al. | Highly sensitive and label-free detection of DILI microRNA biomarker via target recycling and primer exchange reaction amplifications | |
| CN108103146A (en) | A kind of biosensor for detecting salmonella | |
| CN114107510B (en) | Ultrasensitive circulating nucleic acid detection system, kit and method for constructing multidimensional DNase matrix based on DNA three-chain mediation | |
| CN112501257B (en) | Visualization sensor based on nucleic acid self-assembly enzyme-catalysis-free circRNA living cell imaging | |
| Chen et al. | A cancer cell membrane vesicle-packaged DNA nanomachine for intracellular microRNA imaging | |
| CN106884047B (en) | Method for detecting miRNA-155 based on aptamer | |
| Yang et al. | A target-initiated autocatalytic 3D DNA nanomachine for high-efficiency amplified detection of MicroRNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |