CN109540860B - Fluorescent biosensor for detecting kanamycin and preparation method and application thereof - Google Patents
Fluorescent biosensor for detecting kanamycin and preparation method and application thereof Download PDFInfo
- Publication number
- CN109540860B CN109540860B CN201811589823.7A CN201811589823A CN109540860B CN 109540860 B CN109540860 B CN 109540860B CN 201811589823 A CN201811589823 A CN 201811589823A CN 109540860 B CN109540860 B CN 109540860B
- Authority
- CN
- China
- Prior art keywords
- solution
- sequence
- fluorescence
- track
- walker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6402—Atomic fluorescence; Laser induced fluorescence
Abstract
The invention relates to the technical field of biosensors, in particular to a fluorescence biosensor based on amplification of hybridization chain reaction. The method aims to solve the problems of low specificity and sensitivity and high cost of the method for detecting kanamycin in the prior art. The invention realizes the circulation amplification effect by matching the endonuclease IV with the chain hybridization chain reaction, the fluorescence resonance energy transfer of a fluorescent group and a quenching group, and homogeneous reaction mixed liquid. The preparation method comprises the following steps: preparing gold nanoparticles; modifying Walker and Track to the surface of the gold nano-particle; mixing the marked nano-gold solution with the homogeneous reaction solution; performing hybridization chain reaction and fluorescence detection; the specific identification of the nucleic acid Aptamer is utilized, and the high specificity detection of the nucleic acid Aptamer on the target kanamycin is utilized; the signal amplification effect is realized by utilizing the amplification of the hybridization chain reaction.
Description
Technical Field
The invention relates to the technical field of biosensors, in particular to a fluorescence biosensor for detecting kanamycin by a hybridization chain reaction amplification fluorescence method, and also relates to a preparation method and application thereof.
Background
Kanamycin is a broad-spectrum aminoglycoside antibiotic used as a water-soluble sulfate salt and has therapeutic effects on infection by many gram-negative bacteria including gonorrhea, salmonella, and tuberculosis, and is widely used as a second-line antibiotic in human and livestock. Kanamycin excess can cause ototoxicity and nephrotoxicity. Kanamycin can accumulate in animals and be transmitted through the food chain. Kanamycin in animal derived foods is therefore a potential health hazard to humans.
At present, high performance liquid chromatography, capillary electrophoresis, immunoassay, and the like are commonly used in kanamycin analysis methods. The chromatography needs complex instruments and complicated sample pretreatment, and the immunoassay is rapid and sensitive, but has some defects, such as high false positive, unstable performance, easy failure of the used antibody in preservation, and the establishment of a more reliable rapid analysis method is necessary.
An aptamer (aptamer) is a single-stranded oligonucleotide (DNA, RNA, modified RNA) that can specifically bind to various target molecules with high affinity. The binding of Aptamer to various target molecules is based on the diversity of single-stranded nucleic acid structures and spatial conformations, and the Aptamer can be adaptively folded by self through pairing among certain complementary bases in a chain, electrostatic action, hydrogen bond action and the like to form a plurality of stable three-dimensional spatial structures and is bound on the target molecules, so that the Aptamer usually shows very high affinity to the target molecules.
Disclosure of Invention
In order to solve the problems that the method for detecting kanamycin in the prior art is complex in operation, the pretreatment or concentration process of a sample is complex, and an instrument is expensive and difficult to popularize, the invention provides the biosensor for detecting kanamycin by using the hybridization chain reaction amplified fluorescence method, which has the advantages of strong specificity, high affinity, multiple types of combined target substances, small molecular weight and simple and convenient synthesis process, and also provides the preparation method of the biosensor.
A fluorescence biosensor for detecting kanamycin comprises homogeneous reaction liquid, an Aptamer, a nanogold solution, a Walker and a Track DNA sequence;
the homogeneous reaction liquid comprises: sterilized water, a target substance, HAP1, HAP2, 10 multiplied buffer solution, restriction endonuclease IV and a signal probe;
the Aptamer, the signal probe, the HAP1, the HAP2, the Walker and the Track DNA sequences are respectively as follows:
the sequence of Walker is shown in SEQ No. 1;
the Track sequence is shown as SEQ No. 2;
the sequence of HAP1 is shown in SEQ No. 3;
the sequence of HAP2 is shown in SEQ No. 4;
the Aptamer sequence is shown as SEQ No. 5;
the sequence of the signal probe is shown as SEQ No. 6;
the fourth base T of the signal probe is modified with a quenching group Dabcyl, the ninth base T is modified with a fluorescent group FAM, and the 7 th base A is modified with a tetrahydrofuran site.
The 5' end of the Walker and Track DNA sequences is modified with-SH; the 23 rd base sequence of the 5' end of the Track DNA sequence is followed by a tetrahydrofuran site.
The final concentration of the nano gold solution is 0.01 nM.
The final concentration of HAP1 in the homogeneous reaction liquid is 0.1-0.6 nM; the final concentration of the restriction endonuclease IV is 20-140U; the final concentration of the signal probe is 0.2-1.4 mu M; the final concentration of HAP2 was 0.1-0.6 nM.
The concentration of the target in the homogeneous reaction liquid is more than or equal to 5 pM.
The preparation method of the fluorescence biosensor comprises the following steps:
(1) preparing gold nanoparticles;
(2) preparing a modified nano gold solution: modifying the Aptamer, the Walker and the Track to the surface of the gold nano-particle;
(3) hybrid chain reaction: mixing the modified nano-gold solution with the homogeneous reaction solution for reaction;
(4) and (4) detecting fluorescence.
The step (2) comprises the following steps:
s1, hybridizing Walker and Aptamer according to the proportion of 1:1, and uniformly mixing with Track according to the proportion of 1:20 to form a substrate probe;
s2, adding a substrate probe into the nano-gold solution, uniformly mixing, and standing at 4 ℃;
s3 adding 50 μ L PB buffer solution at a speed of 1 μ L/min, stirring uniformly, adding 27 μ L PBS buffer solution at a speed of 1 μ L/min, stirring uniformly, and standing at 4 deg.C for 48 h;
s4 sterile water elutes unlabeled DNA strands.
The concentration ratio of the nanogold to the substrate probe in the S2 is 1: 5000.
the conditions of the hybridization chain reaction in the step (3) are as follows: the temperature was 37 ℃ and the reaction time was 2 h.
The fluorescent biosensor is used for detecting kanamycin in animal-derived food.
In the invention, 6 DNA chains are used in total, and the sequences are respectively as follows:
Walker：5’- SH- TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT CTTAGC CTCAACC ATCATC--3’
Aptamer : 5’- TGG G GG TTG AGG CTA AGC CGA C -3’
Track： 5’ -SH- TTTTTTTTTTCACTTGATGATGGXTG AGA ATA AAG TGT TTA AGT A --3’
HAP1： 5’- AGG AGT GT TTA AGT TGA AGA ATA G TA CTT AAA CAC TTT ATT CT TGA GGA -3’
HAP2： 5’- AGG AGT CTAT TCT TCA ACT TAA AC T AGA ATA AGG TGT TTA AGT TGA GGA-3’
Signal probe： 5’- TCC T（Dabcyl）CA AXT(FAM) CCT
modifying-SH at the 5' end of Walker, and modifying Walker to the surface of the nanogold through an Au-S covalent bond, wherein the italic partial sequence can be complementary with the italic partial sequence of the Aptamer.
The 5' end of Track is modified with-SH, and the Track is modified on the surface of the nanogold through an Au-S covalent bond, wherein the underlined sequence of the Track can be complementary with the underlined sequence of Walker, and the Track contains a tetrahydrofuran site (TAP site) in the middle, and can be cut by endonuclease IV to release an added part (Primer). Primer can open the bold in HAP1 for sequence complementary pairing, the italic part of HAP1 can open the italic part of HAP2 for sequence complementary pairing, and the bold in HAP2 can be sequence complementary pairing with the bold in HAP 1. In this process, the 5 'and 3' ends of HAP1 and HAP2, respectively, are tilted and can be complementarily hybridized and paired with Signal probe, wherein the fourth base T of Signal probe modifies a quencher Dabcyl, the ninth base T modifies a fluorophore FAM, and a tetrahydrofuran site (TAP site) is modified and can be cleaved by endonuclease IV, releasing the fluorophore and the quencher, thereby generating fluorescence.
The kanamycin detection is realized in a homogeneous solution, and signal amplification is realized in a hybridization chain reaction mode, so that the high-sensitivity kanamycin detection is realized, and a lower detection lower limit is obtained.
The reactions that occur in homogeneous phases are mainly: and performing base complementary pairing on the Walker and the Aptamer to form a double-stranded structure. In the presence of kanamycin, Aptamer binds to kanamycin and simultaneously releases Walker. The released Walker can carry out base complementary pairing with a part of the Track, the cleavage is carried out in the presence of the restriction endonuclease IV, the Primer fragment is cleaved from the double strand, meanwhile, the rest part of the Track strand is released, and the Walker can be further combined with another Track to repeat the step. In addition, the generated Primer can open HAP1, HAP1 can open HAP2, HAP2 can open HAP1, and so on. The tilted 5 'and 3' can be subjected to base complementary pairing with the Signal probe to form a double strand, the endonuclease IV can cut a tetrahydrofuran base site (TAP site) in the middle of the Signal probe to break the Signal probe and separate the Signal probe from HAP1 and HAP2 so as to generate a fluorescence Signal, and the separated HAP1 and HAP2 can be subjected to base complementary pairing with other Signal probes again to realize cyclic amplification.
The detection method of the invention is fluorescence detection, and a fluorometer is utilized. Before detection, firstly modifying walker and Track on the surface of a gold nanoparticle through an Au-S bond, mixing a homogeneous reaction solution with a labeled gold nanoparticle, then adding a target bacterium, HAP1, HAP2 and Signal probe into the homogeneous solution, finally adding endonuclease IV, and incubating for 2h at 37 ℃ to complete the amplification process of the hybrid chain reaction. The excitation wavelength was then set to 486nm using a fluorometer and the fluorescence intensity at 518nm was measured.
The Aptamer biosensor is constructed based on the specific recognition of a nucleic acid Aptamer and a target object, the hybridization reaction of Walker on the surface of nano gold, the amplification effect of the hybridization chain reaction of matching of endonuclease IV and the fluorescence resonance energy transfer of a fluorescent group and a quenching group. The sensor has the advantages of high detection speed, low detection limit, high specificity and the like, can make up for the defects of the existing kanamycin detection method, and realizes quick and accurate quantitative detection of kanamycin.
The invention has the beneficial effects that:
1. high specificity detection
The specific identification of the nucleic acid Aptamer is utilized, and the combination of the Aptamer and kanamycin is utilized to realize the high-specificity detection of a target object; the cutting site (AP site) of endonuclease IV is utilized to realize the positioning cutting;
2. ultrasensitive detection
By utilizing the hybridization chain reaction, the fluorescent signal is amplified, the detection sensitivity is improved, and the ultra-sensitivity detection of the target kanamycin is realized;
3. mild reaction, simple operation and suitability for industrialization
The sensor has mild reaction conditions and high reaction speed; because of using the fluorescence method, the detection method is simple and convenient to operate and short in detection period; the main processes of the detection principle are realized in a homogeneous phase, so that the reaction speed is improved, the complexity of operation is reduced, and the rapid, simple and sensitive detection of a target object is realized; the preparation method is simple, stable in performance and good in repeatability of fluorescence detection, and is suitable for food safety, kanamycin detection in water and actual application of biosensor industrialization; meanwhile, the process for manufacturing the biosensor is low in cost and is suitable for the requirement of low price in industrialization.
Drawings
FIG. 1 is a schematic diagram of the experiment;
FIG. 2 is a graph showing the results of detection in example 1;
FIG. 3 is a graph showing the results of detection in example 2;
FIG. 4 is a graph showing the results of detection in example 3;
FIG. 5 is a standard curve of kanamycin detection by the sensor of example 4.
Detailed Description
The present invention is further illustrated by the following specific examples.
Example 1
A preparation method of a fluorescent biosensor for detecting kanamycin comprises the following steps:
(1) preparing gold nanoparticles;
(2) preparing a modified nano gold solution: modifying the Aptamer, the Walker and the Track to the surface of the gold nano-particle;
(3) hybrid chain reaction: mixing the modified nano-gold solution with the homogeneous reaction solution for reaction;
(4) and (4) detecting fluorescence.
In the step (1), the preparation operation steps of the preferable nano gold particles are as follows:
(1) the required instrument was installed and 200mL of ultrapure water was added to the three-necked flask (care was taken not to let dust fall into the three-necked flask).
(2) 500uL (0.04 g/mL) of HAuCl4 was placed in a single-pack centrifuge tube, and 500uL and 200mL of ultrapure water were taken with a pipette, heated with stirring at about 450 rpm, and boiled.
(3) Under the condition of stirring, 3mL of 1% trisodium citrate solution is quickly added into the solution, the color of the solution is changed from light yellow to wine red within a few minutes, after the solution is continuously heated for 15min, a heat source is removed, the solution is slowly cooled to room temperature, and the solution is stored at 4 ℃ for standby.
(4) Taking 60uL gold nanoparticle solution in a micro cuvette, scanning the light absorption spectrum of the gold nanoparticle solution by using a UV-2550 ultraviolet-visible spectrophotometer, and obtaining a molar extinction coefficient of 8.78 multiplied by 10 according to the wavelength at 519nm8M-1cm-1 the concentration of gold nanoparticle solution was calculated to be about 0.3 nM..
The specific operation steps of the step (2) are as follows:
(1) after Walker and Aptamer were hybridized at a 1:1 ratio, they were mixed uniformly with Track at a 1:20 ratio to form substrate probes.
(2) And (3) taking 1 mL of nano gold solution, centrifuging for 10 min in a centrifuge tube, and centrifuging two tubes for later use. Centrifuging until the supernatant is colorless and transparent, removing the supernatant, and adding 300. mu.L of sterilized water to concentrate the nanogold solution to 3nM. The mixture was transferred into a 1 mL glass bottle and sealed with foil paper.
(3) After standing at room temperature for 30 min, 150. mu.L of substrate probe modified with-SH and with the concentration of 30. mu.M (the concentration ratio of the nano-gold to the substrate chain is 1: 5000) is added and mixed uniformly, and then the mixture is placed at 4 ℃ for 24 h.
(4) Adding 50 μ L PB buffer solution slowly for several times, adding magnetons (soaked with aqua regia on the previous day), stirring for 10 min, and adding 27 μ L PBS buffer solution. Taking out magnetons, and standing at 4 ℃ for 48 h.
(5) Transferring the marked nano gold solution into a centrifuge tube, adding sterile water to 1 mL, centrifuging for 10 min, and removing supernatant. An additional 1 mL of sterile water was added and the centrifugation was repeated twice (to elute unlabeled DNA strands).
The reaction process of the step (3) mainly comprises the following steps: sterilized water, a target (4. mu.L), a modified nanogold solution (6. mu.L), HAP1 (2. mu.L), HAP2 (2. mu.L), 10 Xbuffer (4. mu.L), restriction endonuclease IV (3. mu.L) (concentrations of 20U, 40U, 60U, 80U, 100U, 200U, respectively), and a signal probe (6. mu.L) were added to a sterilized EP tube prepared in advance. Shaking for 30s, and incubating in a thermostat at 37 ℃ for 2 h;
the step (2) is to dilute the reacted solution (10. mu.L) to 100. mu.L and detect the fluorescence at 518nm with a fluorometer.
Setting the excitation wavelength of the fluorometer to be 486nm, setting the emission wavelength to be 518nm, setting the detection range to be 490nm-600nm, reading the change of the fluorescence signal and detecting the target object.
The preparation method of the solution used in the above process comprises the following steps:
1. the ultrapure water is required to be sterilized at high temperature. The method comprises the steps of respectively placing ultrapure water in conical flasks, and then sealing the flasks with tinfoil paper and newspaper. Sterilizing in autoclave at 120 deg.C for 20 min.
2. The 10 Xbuffer (buffer) is purchased with the polymerase and can be used as is.
As a result, as shown in FIG. 2, it can be seen that the fluorescence intensity obtained in the experiment was increased with the increase of the amount of endonuclease IV, and the fluorescence intensity was substantially unchanged after the amount of endonuclease IV reached 100U. The amount of endonuclease IV required to demonstrate the enzymatic repair cycle was 100U.
Example 2
A preparation method of a fluorescent biosensor for detecting kanamycin comprises the following steps:
(1) preparing gold nanoparticles;
(2) preparing a modified nano gold solution: modifying the Aptamer, the Walker and the Track to the surface of the gold nano-particle;
(3) hybrid chain reaction: mixing the modified nano-gold solution with the homogeneous reaction solution for reaction;
(4) and (4) detecting fluorescence.
The procedures (1), (2) and (4) are the same as those in example 1.
The reaction process of the step (3) mainly comprises the following steps: sterilized water, the target (4. mu.L), the modified nanogold solution (6. mu.L), HAP1 (2. mu.L) (final concentrations of 0.1nM, 0.2nM, 0.3nM, 0.4nM, 0.5nM, 0.6nM, respectively), 10 Xbuffer (4. mu.L), restriction endonuclease IV (3. mu.L), and a signal probe (6. mu.L) were added to a previously prepared sterilized EP tube. Shake for 30s, incubate in 37 ℃ incubator for 2 h.
Setting the excitation wavelength of the fluorometer to be 486nm, setting the emission wavelength to be 518nm, setting the detection range to be 490nm-600nm, reading the change of the fluorescence signal and detecting the target object.
The results are shown in FIG. 3, from which it can be seen that the fluorescence intensity obtained in the experiment was increased and maintained constant as the amount of HAP1 was increased, and the fluorescence intensity was substantially constant after the amount of HAP1 reached 0.4 nM. The amount of HAP1 required to demonstrate the hybrid chain reaction was 0.4 nM.
Example 3
A preparation method of a fluorescent biosensor for detecting kanamycin comprises the following steps:
(1) preparing gold nanoparticles;
(2) preparing a modified nano gold solution: modifying the Aptamer, the Walker and the Track to the surface of the gold nano-particle;
(3) hybrid chain reaction: mixing the modified nano-gold solution with the homogeneous reaction solution for reaction;
(4) and (4) detecting fluorescence.
The procedures (1), (2) and (4) are the same as those in example 1.
The reaction process of the step (3) mainly comprises the following steps: sterilized water, target (4. mu.L), modified nanogold solution (6. mu.L), HAP1 (2. mu.L), HAP2 (2. mu.L), 10 Xbuffer (3. mu.L), restriction endonuclease IV (3. mu.L), and signal probe (6. mu.L) (final concentrations of 0.2. mu.M, 0.4. mu.M, 0.6. mu.M, 0.8. mu.M, 1.0. mu.M, 1.2. mu.M, and 1.4. mu.M, respectively) were added to a sterilized EP tube prepared in advance. Shake for 30s, incubate in 37 ℃ incubator for 2 h.
Setting the excitation wavelength of the fluorometer to be 486nm, setting the emission wavelength to be 518nm, setting the detection range to be 490nm-600nm, reading the change of the fluorescence signal and detecting the target object.
As shown in FIG. 4, the fluorescence intensity obtained from the experiment was increased and maintained constant as the amount of the signaling probe increased, and was substantially constant after the amount of the signaling probe reached 1. mu.M. The amount of signal probe required to indicate the hybridization chain reaction was 1. mu.M.
Example 4
A preparation method of a fluorescent biosensor for detecting kanamycin comprises the following steps:
(1) preparing gold nanoparticles;
(2) preparing a modified nano gold solution: modifying the Aptamer, the Walker and the Track to the surface of the gold nano-particle;
(3) hybrid chain reaction: mixing the modified nano-gold solution with the homogeneous reaction solution for reaction;
(4) and (4) detecting fluorescence.
The procedures (1), (2) and (4) are the same as those in example 1.
The reaction process of the step (3) mainly comprises the following steps: sterilized water, target (4. mu.L) (final concentrations of 0, 5pM, 10pM, 50pM, 100pM, 500pM, 1nM, 5nM, 10nM, respectively), modified nanogold solution (6. mu.L), HAP1 (2. mu.L), HAP2 (2. mu.L), 10 Xbuffer (3. mu.L), restriction endonuclease IV (2. mu.L), and signal probe (6. mu.L) were added to a sterilized EP tube prepared in advance. Shake for 30s, incubate in 37 ℃ incubator for 2 h.
Setting the excitation wavelength of the fluorometer to be 486nm, setting the emission wavelength to be 518nm, setting the detection range to be 490nm-600nm, reading the change of the fluorescence signal and detecting the target object.
The results are shown in FIG. 5, in which we can see that the fluorescence value increases when the kanamycin concentration is 5pM to 10000 pM, and the reaction proceeds stably. At kanamycin concentrations ranging from 5pM to 10000 pM, the logarithm of kanamycin concentration is in direct proportion to the magnitude of fluorescence intensity value, and a curve is fitted: a = 113.5 log C +226 (A is fluorescence intensity value, C is kanamycin concentration), meanwhile, we continue to detect to lower concentration on the basis of 5pM concentration, and by detecting that when the concentration is lower than 5pM, the relation of fluorescence intensity and concentration just does not accord with the rule of a fitted curve any more, namely, the highest point of an absorption peak in the graph, the lower detection limit of the method can be obtained as 5 pM.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the embodiments, and any other changes, modifications, combinations, substitutions and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents and are included in the scope of the present invention.
Sequence listing
<110> university of Jinan
<120> fluorescent biosensor for detecting kanamycin and preparation method and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 53
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 1
tttttttttt tttttttttt tttttttttt ttttcttagc ctcaaccatc atc 53
<210> 2
<211> 44
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 2
tttttttttt cacttgatga tggtgagaat aaagtgttta agta 44
<210> 4
<211> 49
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 4
aggagtgttt aagttgaaga atagtactta aacactttat tcttgagga 49
<210> 4
<211> 49
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 4
aggagtctat tcttcaactt aaactagaat aaggtgttta agttgagga 49
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 5
tgggggttga ggctaagccg ac 22
<210> 6
<211> 11
<212> DNA
<213> Artificial sequence (artiartiartifical sequence)
<400> 6
tcctcaatcc t 11
Claims (10)
1. A fluorescence biosensor for detecting kanamycin is characterized by comprising homogeneous reaction liquid, Aptamer, nanogold solution, Walker and Track DNA sequences;
the homogeneous reaction liquid comprises: sterilized water, a target substance, HAP1, HAP2, 10 Xbuffer solution, restriction endonuclease IV and a signal probe;
the sequence of the Walker is as follows: 5' -SH-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTTAGC CTCAACC ATCATC--3’；
The sequence of the Track is as follows: 5 '-SH-TTTTTTTTTTCACTTGATGTGGXTG AGA ATA AAG TGT TTA AGT A-3';
the sequence of the HAP1 is as follows: 5' -AGG AGTGT TTA AGT TGA AGA ATA G TA CTT AAA CAC TTT ATT CT TGA GGA -3’；
The sequence of the HAP2 is as follows: 5' - AGG AGT CTAT TCT TCA ACT TAA AC T AGA ATA AGG TGT TTA AGT TGA GGA-3’
The sequence of the Aptamer is as follows: 5' -TGG GGG TTG AGG CTA AGC CGA C -3’
The signal probe sequence is as follows: 5' -TCC T (Dabcyl) CA AXT (FAM) CCT;
the fourth base T of the signal probe is modified with a quenching group Dabcyl, the ninth base T is modified with a fluorescent group FAM, and the 7 th base A is modified with a tetrahydrofuran site.
2. The fluorescence biosensor of claim 1, wherein the 5' end of the Walker and Track DNA sequences is modified by-SH; the 23 rd base sequence of the 5' end of the Track DNA sequence is followed by a tetrahydrofuran site.
3. The fluorescence biosensor of claim 1, wherein the final concentration of the nanogold solution is 0.01 nM.
4. The fluorescence biosensor as claimed in claim 1, wherein the final concentration of HAP1 in the homogeneous reaction solution is 0.1-0.6 nM; the final concentration of the restriction endonuclease IV is 20-140U; the final concentration of the signal probe is 0.2-1.4 mu M; the final concentration of HAP2 was 0.1-0.6 nM.
5. The fluorescence biosensor as claimed in claim 1, wherein the concentration of the target in the homogeneous reaction solution is greater than or equal to 5 pM.
6. A method of making a fluorescent biosensor as claimed in claim 1, comprising the steps of:
(1) preparing gold nanoparticles;
(2) preparing a modified nano gold solution: modifying the Aptamer, the Walker and the Track to the surface of the gold nano-particle;
(3) hybrid chain reaction: mixing the modified nano-gold solution with the homogeneous reaction solution for reaction;
(4) and (4) detecting fluorescence.
7. The method according to claim 6, wherein the step (2) comprises the steps of:
s1, hybridizing Walker and Aptamer according to the proportion of 1:1, and uniformly mixing with Track according to the proportion of 1:20 to form a substrate probe;
s2, adding a substrate probe into the nano-gold solution, uniformly mixing, and standing at 4 ℃;
s3 adding 50 μ L PB buffer solution at a speed of 1 μ L/min, stirring uniformly, adding 27 μ L PBS buffer solution at a speed of 1 μ L/min, stirring uniformly, and standing at 4 deg.C for 48 h;
s4 sterile water elutes unlabeled DNA strands.
8. The method according to claim 7, wherein the concentration ratio of the nanogold to the substrate probe in S2 is 1: 5000.
9. the method according to claim 6, wherein the hybridization chain reaction in step (3) is performed under the following conditions: the temperature was 37 ℃ and the reaction time was 2 h.
10. A method for detecting kanamycin in foods of animal origin using the fluorescent biosensor of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811589823.7A CN109540860B (en) | 2019-02-19 | 2019-02-19 | Fluorescent biosensor for detecting kanamycin and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811589823.7A CN109540860B (en) | 2019-02-19 | 2019-02-19 | Fluorescent biosensor for detecting kanamycin and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109540860A CN109540860A (en) | 2019-03-29 |
| CN109540860B true CN109540860B (en) | 2021-03-02 |
Family
ID=65858073
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811589823.7A Active CN109540860B (en) | 2019-02-19 | 2019-02-19 | Fluorescent biosensor for detecting kanamycin and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109540860B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110441277B (en) * | 2019-08-15 | 2021-08-17 | 济南大学 | Biosensor for detecting ampicillin and preparation method and application thereof |
| CN110672851B (en) * | 2019-08-19 | 2022-12-16 | 上海理工大学 | Kanamycin identification/sensing integrated probe, preparation method and detection method |
| CN111504966B (en) * | 2020-04-24 | 2023-06-13 | 济南大学 | Biosensor for detecting and degrading ampicillin as well as preparation method and application thereof |
| CN111521808B (en) * | 2020-05-26 | 2022-11-25 | 济南大学 | Biosensor for detecting polychlorinated biphenyl and preparation method thereof |
| CN111876412B (en) * | 2020-06-15 | 2021-11-09 | 山东师范大学 | Fluorescent aptamer probe and detection method and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104502585A (en) * | 2014-12-30 | 2015-04-08 | 中山大学 | Nano-sensor for detecting antibiotics and preparation method and application of nano-sensor |
| CN105158320A (en) * | 2015-10-10 | 2015-12-16 | 济南大学 | Electrochemical sensor for detecting kanamycin based on nucleic acid aptamer and preparation method of sensor |
| CN105505975A (en) * | 2016-01-06 | 2016-04-20 | 武汉康复得生物科技股份有限公司 | Bacillus gene traceless knockout/knockin plasmid and method, and kit |
| CN106906277A (en) * | 2017-03-10 | 2017-06-30 | 济南大学 | A kind of biology sensor for detecting kanamycins and preparation method thereof |
| CN108250360A (en) * | 2017-12-06 | 2018-07-06 | 华南师范大学 | There is aptamers-molecular engram fluorescent optical sensor of dual specificity identification and its preparation method and application to kanamycins |
| CN108333239A (en) * | 2018-01-17 | 2018-07-27 | 济南大学 | A kind of biosensor detecting kanamycins based on aptamer |
| CN108548800A (en) * | 2018-03-16 | 2018-09-18 | 华侨大学 | The kit and detection method of yapamicin relict amount in a kind of detection food |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120134975A1 (en) * | 2008-08-13 | 2012-05-31 | Searete Llc, A Limited Liability Corporation Of The State Of Delaware | Biological targeting compositions and methods of using the same |
| KR101796906B1 (en) * | 2009-03-24 | 2017-11-10 | 유니버시티 오브 시카고 | Method for carrying out a reaction |
| CN102653789A (en) * | 2012-03-14 | 2012-09-05 | 河北大学 | Quantitative biomolecule detection method |
-
2019
- 2019-02-19 CN CN201811589823.7A patent/CN109540860B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104502585A (en) * | 2014-12-30 | 2015-04-08 | 中山大学 | Nano-sensor for detecting antibiotics and preparation method and application of nano-sensor |
| CN105158320A (en) * | 2015-10-10 | 2015-12-16 | 济南大学 | Electrochemical sensor for detecting kanamycin based on nucleic acid aptamer and preparation method of sensor |
| CN105505975A (en) * | 2016-01-06 | 2016-04-20 | 武汉康复得生物科技股份有限公司 | Bacillus gene traceless knockout/knockin plasmid and method, and kit |
| CN106906277A (en) * | 2017-03-10 | 2017-06-30 | 济南大学 | A kind of biology sensor for detecting kanamycins and preparation method thereof |
| CN108250360A (en) * | 2017-12-06 | 2018-07-06 | 华南师范大学 | There is aptamers-molecular engram fluorescent optical sensor of dual specificity identification and its preparation method and application to kanamycins |
| CN108333239A (en) * | 2018-01-17 | 2018-07-27 | 济南大学 | A kind of biosensor detecting kanamycins based on aptamer |
| CN108548800A (en) * | 2018-03-16 | 2018-09-18 | 华侨大学 | The kit and detection method of yapamicin relict amount in a kind of detection food |
Non-Patent Citations (3)
| Title |
|---|
| Aptamer-based spectrophotometric detection of kanamycin in milk;Nandi Zhou et al;《Anal. Methods》;20131217;第1569–1574页 * |
| 分子印迹传感器检测卡那霉素;廉文静 等;《济南大学学报（自然科学版）》;20121031;第26卷(第4期);第348-352页 * |
| 纳米金核酸适配体共振瑞利散射光谱检测卡那霉素的研究;陈效兰 等;《分析测试学报》;20140630;第33卷(第6期);第709-713页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109540860A (en) | 2019-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109540860B (en) | Fluorescent biosensor for detecting kanamycin and preparation method and application thereof | |
| Zhang et al. | Visual detection for nucleic acid-based techniques as potential on-site detection methods. A review | |
| Zhu et al. | A novel electrochemical sensing strategy for rapid and ultrasensitive detection of Salmonella by rolling circle amplification and DNA–AuNPs probe | |
| Liu et al. | Magnetic nanoparticles enhanced microarray detection of multiple foodborne pathogens | |
| Bagheri et al. | Triple-helix molecular switch-based aptasensors and DNA sensors | |
| Stoeva et al. | Multiplexed DNA detection with biobarcoded nanoparticle probes | |
| AU2009231582B2 (en) | Amplicon rescue multiplex polymerase chain reaction for amplificaton of multiple targets | |
| Li et al. | Development of a magnetic nanoparticles microarray for simultaneous and simple detection of foodborne pathogens | |
| Ang et al. | Ambient temperature detection of PCR amplicons with a novel sequence-specific nucleic acid lateral flow biosensor | |
| CN110441277B (en) | Biosensor for detecting ampicillin and preparation method and application thereof | |
| US20070154940A1 (en) | Method for detecting target nucleic acid | |
| WO2013119793A1 (en) | Chemiluminescent nanoparticles and uses thereof | |
| KR102458825B1 (en) | A method to detect nucleic acids | |
| CN106755358B (en) | Method for detecting vibrio parahaemolyticus by combining multi-cross amplification with gold nano biosensing | |
| Zhao et al. | Fluorometric determination of the p53 cancer gene using strand displacement amplification on gold nanoparticles | |
| CN106872682B (en) | A kind of colorimetric bio sensor and preparation method thereof detecting mercury ion | |
| Cao et al. | An ultrasensitive biosensor for virulence ompA gene of Cronobacter sakazakii based on boron doped carbon quantum dots-AuNPs nanozyme and exonuclease III-assisted target-recycling strategy | |
| Yu et al. | A turn-on fluorescent aptasensor for ampicillin detection based on gold nanoparticles and CdTe QDs | |
| Fu et al. | Electrochemical biosensing of DENV nucleic acid amplified with triplet nanostructure-mediated dendritic hybridization chain reaction | |
| Zhou et al. | Sensitive fluorescence biosensor for SARS-CoV-2 nucleocapsid protein detection in cold-chain food products based on DNA circuit and g-CNQDs@ Zn-MOF | |
| Wang et al. | Allosteric probe-triggered isothermal amplification to activate CRISPR/Cas12a for sensitive electrochemiluminescence detection of Salmonella | |
| CN111521808B (en) | Biosensor for detecting polychlorinated biphenyl and preparation method thereof | |
| Zhao et al. | Recent advances in peptide nucleic acids for rapid detection of foodborne pathogens | |
| AU2018236835A1 (en) | Compositions and methods for detecting gastrointestinal pathogen nucleic acid | |
| WO2012129821A1 (en) | Detection method of nucleic acid and kit and using thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |