CN110438135A - Disease-resistant gene PdGsSRK, expression albumen, cloning primer pair and its application of eastern cottonwood leaf rust resistance - Google Patents
Disease-resistant gene PdGsSRK, expression albumen, cloning primer pair and its application of eastern cottonwood leaf rust resistance Download PDFInfo
- Publication number
- CN110438135A CN110438135A CN201910858818.XA CN201910858818A CN110438135A CN 110438135 A CN110438135 A CN 110438135A CN 201910858818 A CN201910858818 A CN 201910858818A CN 110438135 A CN110438135 A CN 110438135A
- Authority
- CN
- China
- Prior art keywords
- leaf rust
- gene
- pdgssrk
- eastern cottonwood
- rust resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of gene PdGsSRK of eastern cottonwood leaf rust resistance, and disclose it and express albumen, cloning primer pair and its application.The gene is serine/threonine kinase (STK) class R gene, is played an important role during leaf rust resistance.By being parsed to eastern cottonwood leaf rust resistance gene site, is analyzed in conjunction with gene Expression, determine that PdGsSRK gene is the key gene for regulating and controlling eastern cottonwood brown leaf rust-resistance.PdGsSRK gene provides important genetic resources to cultivate the eastern cottonwood new varieties of Resistant Gene To Rust.
Description
Technical field
The invention belongs to field of plant genetic project technology, and in particular to the disease-resistant gene of eastern cottonwood leaf rust resistance
PdGsSRK, expression albumen, cloning primer pair and its application.
Background technique
Eastern cottonwood is the fast-growing that 1970s start in China's introducing and planting, and are widely applied in south China
Poplar.Since the nineties in last century, poplar rust disease starts to fall ill in China eastern cottonwood artificial forest, and incidence is got over
Come more serious, it has also become seriously affect the Major Diseases of eastern cottonwood artificial forest yield.Researcher is to picking up from eastern cottonwood people
Poplar leaf rust in work woods, is observed by scanning electron microscope morphological feature, and binding molecule marks fingerprint analysis, it is determined that endangers me
The rest fungus of state eastern cottonwood artificial forest is larch poplar grid rest fungus (Melampsora larici-populina).The rest fungus has
In the complicated heteroecism period, there are 5 kinds of different spore shapes.Leaf rust will lead to poplar and fall leaves in advance, photosynthesis
Reduced capability causes timber yield to be remarkably decreased.The eastern cottonwood breeding of breeding at present and popularization is susceptible serious, clones America
Black poplar Rust resistance gene is the basis for accelerating disease-resistant prevalent variety cultivation.
Eastern cottonwood Inheritance of Resistance To Rust site is positioned in No. 19 end of chromosome of poplar.Exist in poplar genome
A disease-resistant gene more than 400, the gene cluster that moderate resistance rust disease site target interval is made of there are one 43 disease-resistant genes.Due to
The specificity of disease-resistant gene and pathogen being mutually distinguishable there are height identifies anti-in the R gene cluster of a large amount of close linkages
The special disease-resistant gene of M.larici-populina pathogen is a yet unresolved issue so far.
Summary of the invention
Goal of the invention: the present invention provides a kind of eastern cottonwood STK class disease-resistant gene PdGsSRK, is that eastern cottonwood is anti-
The key gene of M.larici-populina dip dyeing.It is black in America that it is a further object of the present invention to provide a kind of PdGsSRK genes
Application in poplar genetic engineering breeding provides useful genetic resources to cultivate the eastern cottonwood new varieties of Resistant Gene To Rust.
Technical solution: to solve the above-mentioned problems, the present invention provides following technical schemes:
A kind of disease-resistant gene PdGsSRK of eastern cottonwood leaf rust resistance, nucleotide sequence is as shown in SEQ ID NO.1.
The expression albumen of the disease-resistant gene PdGsSRK of the eastern cottonwood leaf rust resistance, amino acid sequence such as SEQ
Shown in ID NO.2.
The cloning primer pair of the disease-resistant gene PdGsSRK of above-mentioned eastern cottonwood leaf rust resistance, nucleotide sequence such as SEQ
Shown in ID NO.3 and SEQ IDNO.4.
The disease-resistant gene PdGsSRK of above-mentioned eastern cottonwood leaf rust resistance answering in eastern cottonwood leaf rust resistance breeding
With.
The disease-resistant gene PdGsSRK of above-mentioned eastern cottonwood leaf rust resistance is in improving eastern cottonwood leaf rust resistance ability
Using.
The identification method of the disease-resistant gene PdGsSRK of above-mentioned eastern cottonwood leaf rust resistance, comprising the following steps:
(1) eastern cottonwood genome Resistant Gene To Rust target interval sequence is obtained；
(2) respectively choose eastern cottonwood leaf rust resistance, feel leaf rust kind material, carry out rest fungus inoculation experiments, to turn
The Expression of record group is analyzed；
(3) eastern cottonwood leaf rust resistance target interval and transcript profile data authentication is combined to obtain disease-resistant gene PdGsSRK.
Preferably, the specific steps Expression of transcript profile analyzed in step (2) are as follows: it is black to extract America respectively
Poplar leaf rust resistance, sense leaf rust kind are enriched with out mRNA, reverse transcription simultaneously synthesizes in the total serum IgE of the blade at different vaccination time point
Double-strand cDNA after purified, carry out end reparation plus A to cDNA and connects sequence measuring joints, construction cDNA library respectively corresponds
The sample that genotype is acquired 8 different vaccination time points is compared in two kinds, carries out transcript profile sequencing；
It compares software HISAT2 using RNA-seq to snap to clean reads with reference on genome, with comparison
Original count of the reads number as each gene, and it is normalized to FPKM value, to eastern cottonwood leaf rust resistance, sense leaf rust product
Transcript profile data of the kind genotype 8 different vaccination periods are compared two-by-two, using EBseq R packet to each relatively centering
Difference expression gene identified.
Preferably, eastern cottonwood leaf rust resistance target interval and transcript profile data authentication disease-resistant gene are combined in step (3)
PdGsSRK specifically: the differential expression base that eastern cottonwood leaf rust resistance, sense leaf rust genotype are obtained in resistance target interval
Cause analyzes it in the expression pattern at different vaccination time point, obtains an induction type R gene PdGsSRK, encode G type agglutinin S
Receptor serine/threonine kinase is not examined in eastern cottonwood leaf rust resistance of the gene before inoculation, sense leaf rust genotype
Expression quantity is measured, 24,48 and 72 hours after inoculation, which generated inducible expression in leaf rust resistance gene type poplar,
And show that PdGsSRK gene is the specific gene for defending rest fungus dip dyeing without generating expression in sense leaf rust genotype poplar
In the invention patent, we are with the disease-resistant and susceptible genotype filtered out from eastern cottonwood germplasm resource bank
Material has carried out gene expression dynamic analysis to the host after pathogen infection using RNA-seq sequencing technologies；Meanwhile we
Eastern cottonwood genome is sequenced, and sequence assembling has been carried out to Resistant Gene To Rust genetic locus section, obtains target area
Between DNA sequence dna；Combining target section gene is inoculated into pathogenic process in rust, and each gene is in resistant, susceptible genotype
The variation of express spectra has identified the special disease-resistant gene PdGsSRK of response M.larici-populina Pathogen Infection.Benefit
With Real-time quantitative PCR, we demonstrate the Resistant reaction of PdGsSRK gene pairs larch poplar grid rest fungus dip dyeing.The present invention is
It cultivates Resistant Gene To Rust eastern cottonwood new varieties and provides useful gene.
The utility model has the advantages that compared with the prior art, advantages of the present invention are as follows:
The present invention obtains eastern cottonwood leaf rust resistance gene PdGsSRK using eastern cottonwood as material for the first time, which is
STK class R gene, plays an important role in eastern cottonwood resistance mechanism.It is planted by PdGsSRK gene in resistant, susceptible poplar
The repeated authentication expressed in strain, determines that PdGsSRK gene is the key gene of the anti-larch poplar grid rest fungus of eastern cottonwood.
The clone of PdGsSRK gene has significant application value in the eastern cottonwood new varieties for cultivating Resistant Gene To Rust using genetic engineering.
Detailed description of the invention
After Fig. 1 is poplar Resistant Gene To Rust clone " T-120 " and susceptible clone " D-896 " inoculation larch poplar grid rest fungus
Contrast effect figure.
Fig. 2 is the R gene in eastern cottonwood Resistant Gene To Rust target interval, which includes 219 genes altogether, wherein 112
For DEGs, 43 are R gene；Right side shows the physical distribution of 43 R genes, wherein containing eastern cottonwood leaf rust resistance
PdGsSRK gene.
Fig. 3 is RNA-seq expression of the PdGsSRK gene in 8 inoculation time points of resistant, susceptible poplar clones.
Fig. 4 is that qRT-PCR detects expression pattern of the disease-resistant gene PdGsSRK in other resistant, susceptible poplar genotype.
Specific embodiment
In order to make the foregoing objectives, features and advantages of the present invention clearer and more comprehensible, right combined with specific embodiments below
A specific embodiment of the invention is described in detail.
Embodiment 1: disease-resistant site target interval sequence analysis combination transcript profile Expression Analysis and Screening goes out eastern cottonwood
The PdGsSRK gene of leaf rust resistance
1, eastern cottonwood genome Resistant Gene To Rust target interval sequence is obtained
In conjunction with SSR primer sequence in poplar genetic map, resistance in genetic map is bridged using 7 SSR primer sequences
Target interval and poplar Genomic sequence information (table 1).It is to be utilized with reference to genome with eastern cottonwood three generations's genome of assembling
Poplar leaf rust resistance Quantitative and Qualitative resistant target interval are anchored to genomic physical position by BLASTN algorithm, obtain base
Because of a group target interval sequence.Further utilize the R gene in Pfam, SMART database and MEME algorithm annotation target sequence.
The SSR primer sequence of table 1 poplar leaf rust resistance Quantitative and Qualitative resistant target interval
2, prepare anti-, sense rust poplar material and rust inoculation experiments
The poplar rest fungus biological strain Melampsora larici-populina of premenstruum (premenstrua) identification is selected, the microspecies are in length
The poplar clones " NL895 " that river In The Middle And Lower Reaches are widely applied are also serious susceptible.The acquisition mixing rust on poplar " NL895 "
Bacterium spore is configured to the conidial suspension of spore concentration about 100,000urediniospore/ml with aqua sterilisa, for connecing
Kind processing.
Select the poplar Resistant Gene To Rust clone " T-120 " and susceptible clone " D-896 " cuttage seeding of premenstruum (premenstrua) resistant determination
For test material (Fig. 1).In investigation of the nursery lot Jing Guo last decade, it is high resistance that poplar " T-120 " is completely immune to leaf rust
The poplar clones of rust, and poplar " D-896 " is the poplar clones of severe infections rust.The present invention select eastern cottonwood without
Property system " T-120 " and " D-896 " be used as crt gene type, by its cuttage in the native flowerpot of band, each 30 basin of clone cuttage,
Two clone cuttage seedings are placed in diurnal temperature is respectively 25 DEG C and 20 DEG C, air humidity 90%, the brightness time is than 12/12
It is cultivated in greenhouse.After 12 weeks, treelet grows to 1 meter of height, has more than 10 leaves being fully deployed.
The spore suspension of above-mentioned preparation is uniformly sprayed at 3 of clone " T-120 " and " D-896 " to be fully deployed
Vacuum side of blade (the 5th, the 7th and the 9th from terminal bud), progress are handled without inoculation is hurt.After inoculation, it is placed in a greenhouse and continues to train
Support, before inoculation, inoculation after for 24 hours, 48h, 72h, 96h, 120h, 144h, 168h carry out the sampling of eastern cottonwood leaf harvest.
After sampling, blade is set in 50mL centrifuge tube rapidly, is put into liquid nitrogen, then deposited in -80 DEG C of ultra low temperature freezers.
3, transcript profile Expression is analyzed
Poplar is extracted respectively to resist, feel genotype in the total serum IgE of the blade at different vaccination time point, is enriched with out mRNA, is inverted
Simultaneously synthetic double chain cDNA is recorded, after purified, end reparation plus A is carried out to cDNA and connect sequence measuring joints, construction cDNA library,
It corresponds respectively to the sample that two kinds of comparison genotype are acquired 8 different vaccination time points and uses Illumina after library inspection is qualified
2000 platform of HiSeq carries out transcript profile sequencing.
It compares software HISAT2 using RNA-seq to snap to clean reads with reference on genome, with comparison
Original count of the reads number as each gene, and it is normalized to FPKM value.Confrontation, sense genotype are 8 different vaccination periods
Transcript profile data compared two-by-two (T0VS D0, T24VS D24, T48VS D48, T72VS D72, T96VS D96,
T120VS D120, T144VS D144, T168VS D168), using EBseq R packet to the differential expression base of each relatively centering
Because (DEGs) is identified.
4, the identification of disease-resistant gene PdGsSRK
Poplar leaf rust resistance Quantitative and Qualitative resistant target interval obtain 112 DEGs altogether, wherein 43 annotations are R
It includes 4 R genes that gene, which is R1 resistance locus respectively, and Mer resistance locus includes 13 R genes, and Dqtl resistance interval includes 26
A R gene (Fig. 2).43 differential expression R genes are analyzed in anti-, 8 different vaccination time points of sense genotype expression pattern hair
It now and only finds an induction type R gene PdGsSRK, encodes G type agglutinin S receptor serine/threonine kinase, which exists
Resisting, expression quantity is not detected in sense genotype before inoculation, 24,48 and 72 hours after inoculation, the gene was in Resistant Gene To Rust base
Because generating inducible expression in type poplar, and show PdGsSRK base without generating expression (Fig. 3) in susceptible genotype poplar
Because being the specific gene for defending rest fungus dip dyeing.
Embodiment 2: resistant, susceptible eastern cottonwood is inoculated with the verifying of rest fungus PdGsSRK gene Resistant reaction
Using qRT-PCR detection disease-resistant gene PdGsSRK in expression pattern anti-, in sense poplar genotype, with reference to transcription
The experimental design scheme of group sequencing, selects poplar Resistant Gene To Rust clone " T20 " and two kinds of opposite bases of susceptible clone " NL895 "
Because type carries out rust inoculation processing, respectively to anti-, the sense genotype poplar after leaf rust inoculation in 0h, for 24 hours, 48h, 72h, 96h,
The mRNA that the leaf sample of 120h, 144h, 168h extract, and reverse transcription cDNA carries out qRT-PCR analysis.
Using 5.0 programming gene-specific primer of Primer Premier, two terminal sequences in PdGsSRK gene
Two pairs of primers:
Forward primer: AAACCTTGTCGCCTACCCTAC 21；
Reverse primer: GAGACTCAACCCCTTTTCGCT 21.
Using Applied Biosystems 7500Fast real-time PCR and SYBR Premix Ex Taq reagent
Box (Takara, Shiga, Japan) carries out realtime quantitative inspection (qRT-PCR) detection.
QRT-PCR reaction system (20 μ l per reaction) includes:
PCR program is 95 DEG C of initial denaturations 10min, 95 DEG C of denaturation 5s, 60 DEG C of annealing 30s, 72 DEG C of extension 1min, circulation 40
It is secondary, every group of three repetitions.It selects ubiquitin gene as reference gene, uses 2 after reaction-ΔΔCtMethod analysis of fluorescence
It is worth change curve and solubility curve.The result shows that PdGsSRK gene qRT-PCR expression pattern and the consistent (figure of RNA-seq expression
4), for PdGsSRK gene, qRT-PCR confirms that it is not expressed in anti-, sense genotype before inoculation, and in disease-resistant gene
In type, expression quantity is increased in 24 and 48hpi Shi Junyou induction type, subsequent 72h to 168h expression quantity decline, it was demonstrated that
PdGsSRK is the resistant gene of special response poplar rust disease dip dyeing.Above specific embodiments of the present invention retouch in detail
It states, but it is merely an example, the present invention is not restricted to particular embodiments described above.For those skilled in the art
Speech, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention.Therefore, the present invention is not being departed from
Spirit and scope under made equal transformation and modification, all should be contained within the scope of the invention.
Sequence table
<110>Nanjing Forestry University
<120>the disease-resistant gene PdGsSRK of eastern cottonwood leaf rust resistance, expression albumen, cloning primer pair and its application
<141> 2019-09-11
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 2286
<212> DNA
<213> Populus deltoides
<400> 1
atggctttag cttatgcagc tttcgttttg ttagtaattt gtatttacaa acctgtaagt 60
tcccagcaga accactcaaa cttgataagt ttaggttctt caatcttcac caacgtccca 120
ccaacttcat ggcgctcccc ttctggcaca tttgcctttg ggttctaccc acagggcact 180
ggctttatag tgggaatttg gttggtgggt aagccagctg atataatcac ctggacagca 240
taccgagatg accctcctgt gccatcaaat gctacgttgg agttgaccgt caacggtaag 300
cttcttttaa gaacttatta tgccaacaat gaggccgaaa tcgcagcttc agcttcaatg 360
cttgattctg gtaatttcgt gctttacaat ggttcttctg ttatttggca aagctttgat 420
tacccaactg acaccatatt agtaggtcag aatcttactt attctgataa attggtttca 480
agtgtgtcga gctcaaatca ctccagtgga aggtttttcc tcgcgatgca ggcagatgga 540
aaccttgtcg cctaccctac aaacagcgct ggtctatctg ttgatgctta ctgggccagt 600
aatacttatc aagacagcga aaaggggttg agtctctatt tcaatcacca gggatttctg 660
ttcatggata cggtctctaa aaaaccagtc ttattggcaa gaagttctta tccctgtaac 720
aacaaaacaa ctatctttcg tgcgacgctt gatgctgatg ggattttcag gttgtattca 780
cactgcttag agaacaaaac tagccagagt gtgcatattg agtggtctgc gttgaacaat 840
acatgcaatg ttcgtggctt ctgtgatttc aacagttatt gctctggcat gggcactagt 900
gctgactgtt cctgttatcc tggatttgct ttcaatgacc ccagtgagaa attcagtgga 960
tgctacaaaa atgtcactga aagtttttgc acgggcacca aagaagggct aatgtacgat 1020
gtcataaccg tagagaatat attgttcgaa cgatatcctt attctgttct agaagagaag 1080
aaggaaaatt gtggtttgtc ttgcctggaa gattgtctct gtgatgttgc tctatatatg 1140
aatgagaggt gtgaaaagta tactgcacca attcgatatg gtttaaaaga tgtaaacaca 1200
atatctatag ccttcttcaa agtgaaagca gcaactcctg ctgcacctcc aatgagcctg 1260
acaatcatca tagaaagcaa gaaaagttta cttgtgtttc ttgctatagc atttggatct 1320
gttactttct tgtgttttgt cattgcaatc tctactttct gcgtgtacag ggatcgagct 1380
tatctttacg aaaagctgtc aggaatcata agcttggctg gagagttcac tctgcggtca 1440
ttttcttata gtgagcttga gaaagctaca ggtggttttg gagaagagtt gggcaggggt 1500
tctattggtg cagtttacag agggacaata cctgggggtg acagaactgt tgctgttaag 1560
agacttggga aagttttaga tgaaggggaa aaaaagtttc gagccgaaat cactgtgatt 1620
ggacaaactt atcacaggaa cttggttcgg ttgcttggtt tttgtgttga gggttctcgg 1680
agggttctct ctgagaggcg ccccatttgg aaagaaagag tgaggattgc tctagatata 1740
gctagaggaa tactctatct acatgaagag tgtcaagcct gcatcatcca ttgcaatata 1800
acccctcaaa acattctcat ggatgattct tggatagcca aaatctccga tttcggatta 1860
tcaaagctat tatatccaga cgaaataaga agctcgatgg cactctcaca gagtagaggg 1920
cacatggcac ctgaatggca gaataacgcc ttgatgtcgg taaaagctga tatctacagc 1980
ttcggagttg tacttctgga gatcatctgt tgcagaagca gtataaaagt agacgtctca 2040
acaccagatg aaatgaatct ttccagttgg gcatatcaat gctttgcagc tggacagttg 2100
gataagcttg tgaaggatga agatattgaa ttcgagtcac tggaaagaat ggtgaagatt 2160
ggactgctgt gcgttcagca tgatccagct tcacgtcctt gtatcaagaa tgtgatcttg 2220
atgcttgaag ggtccgaaga cattccagct ccaccagcta tagctccatt ccgtatcacc 2280
acttag 2286
<210> 2
<211> 761
<212> PRT
<213> Populus deltoides
<400> 2
Met Ala Leu Ala Tyr Ala Ala Phe Val Leu Leu Val Ile Cys Ile Tyr
1 5 10 15
Lys Pro Val Ser Ser Gln Gln Asn His Ser Asn Leu Ile Ser Leu Gly
20 25 30
Ser Ser Ile Phe Thr Asn Val Pro Pro Thr Ser Trp Arg Ser Pro Ser
35 40 45
Gly Thr Phe Ala Phe Gly Phe Tyr Pro Gln Gly Thr Gly Phe Ile Val
50 55 60
Gly Ile Trp Leu Val Gly Lys Pro Ala Asp Ile Ile Thr Trp Thr Ala
65 70 75 80
Tyr Arg Asp Asp Pro Pro Val Pro Ser Asn Ala Thr Leu Glu Leu Thr
85 90 95
Val Asn Gly Lys Leu Leu Leu Arg Thr Tyr Tyr Ala Asn Asn Glu Ala
100 105 110
Glu Ile Ala Ala Ser Ala Ser Met Leu Asp Ser Gly Asn Phe Val Leu
115 120 125
Tyr Asn Gly Ser Ser Val Ile Trp Gln Ser Phe Asp Tyr Pro Thr Asp
130 135 140
Thr Ile Leu Val Gly Gln Asn Leu Thr Tyr Ser Asp Lys Leu Val Ser
145 150 155 160
Ser Val Ser Ser Ser Asn His Ser Ser Gly Arg Phe Phe Leu Ala Met
165 170 175
Gln Ala Asp Gly Asn Leu Val Ala Tyr Pro Thr Asn Ser Ala Gly Leu
180 185 190
Ser Val Asp Ala Tyr Trp Ala Ser Asn Thr Tyr Gln Asp Ser Glu Lys
195 200 205
Gly Leu Ser Leu Tyr Phe Asn His Gln Gly Phe Leu Phe Met Asp Thr
210 215 220
Val Ser Lys Lys Pro Val Leu Leu Ala Arg Ser Ser Tyr Pro Cys Asn
225 230 235 240
Asn Lys Thr Thr Ile Phe Arg Ala Thr Leu Asp Ala Asp Gly Ile Phe
245 250 255
Arg Leu Tyr Ser His Cys Leu Glu Asn Lys Thr Ser Gln Ser Val His
260 265 270
Ile Glu Trp Ser Ala Leu Asn Asn Thr Cys Asn Val Arg Gly Phe Cys
275 280 285
Asp Phe Asn Ser Tyr Cys Ser Gly Met Gly Thr Ser Ala Asp Cys Ser
290 295 300
Cys Tyr Pro Gly Phe Ala Phe Asn Asp Pro Ser Glu Lys Phe Ser Gly
305 310 315 320
Cys Tyr Lys Asn Val Thr Glu Ser Phe Cys Thr Gly Thr Lys Glu Gly
325 330 335
Leu Met Tyr Asp Val Ile Thr Val Glu Asn Ile Leu Phe Glu Arg Tyr
340 345 350
Pro Tyr Ser Val Leu Glu Glu Lys Lys Glu Asn Cys Gly Leu Ser Cys
355 360 365
Leu Glu Asp Cys Leu Cys Asp Val Ala Leu Tyr Met Asn Glu Arg Cys
370 375 380
Glu Lys Tyr Thr Ala Pro Ile Arg Tyr Gly Leu Lys Asp Val Asn Thr
385 390 395 400
Ile Ser Ile Ala Phe Phe Lys Val Lys Ala Ala Thr Pro Ala Ala Pro
405 410 415
Pro Met Ser Leu Thr Ile Ile Ile Glu Ser Lys Lys Ser Leu Leu Val
420 425 430
Phe Leu Ala Ile Ala Phe Gly Ser Val Thr Phe Leu Cys Phe Val Ile
435 440 445
Ala Ile Ser Thr Phe Cys Val Tyr Arg Asp Arg Ala Tyr Leu Tyr Glu
450 455 460
Lys Leu Ser Gly Ile Ile Ser Leu Ala Gly Glu Phe Thr Leu Arg Ser
465 470 475 480
Phe Ser Tyr Ser Glu Leu Glu Lys Ala Thr Gly Gly Phe Gly Glu Glu
485 490 495
Leu Gly Arg Gly Ser Ile Gly Ala Val Tyr Arg Gly Thr Ile Pro Gly
500 505 510
Gly Asp Arg Thr Val Ala Val Lys Arg Leu Gly Lys Val Leu Asp Glu
515 520 525
Gly Glu Lys Lys Phe Arg Ala Glu Ile Thr Val Ile Gly Gln Thr Tyr
530 535 540
His Arg Asn Leu Val Arg Leu Leu Gly Phe Cys Val Glu Gly Ser Arg
545 550 555 560
Arg Val Leu Ser Glu Arg Arg Pro Ile Trp Lys Glu Arg Val Arg Ile
565 570 575
Ala Leu Asp Ile Ala Arg Gly Ile Leu Tyr Leu His Glu Glu Cys Gln
580 585 590
Ala Cys Ile Ile His Cys Asn Ile Thr Pro Gln Asn Ile Leu Met Asp
595 600 605
Asp Ser Trp Ile Ala Lys Ile Ser Asp Phe Gly Leu Ser Lys Leu Leu
610 615 620
Tyr Pro Asp Glu Ile Arg Ser Ser Met Ala Leu Ser Gln Ser Arg Gly
625 630 635 640
His Met Ala Pro Glu Trp Gln Asn Asn Ala Leu Met Ser Val Lys Ala
645 650 655
Asp Ile Tyr Ser Phe Gly Val Val Leu Leu Glu Ile Ile Cys Cys Arg
660 665 670
Ser Ser Ile Lys Val Asp Val Ser Thr Pro Asp Glu Met Asn Leu Ser
675 680 685
Ser Trp Ala Tyr Gln Cys Phe Ala Ala Gly Gln Leu Asp Lys Leu Val
690 695 700
Lys Asp Glu Asp Ile Glu Phe Glu Ser Leu Glu Arg Met Val Lys Ile
705 710 715 720
Gly Leu Leu Cys Val Gln His Asp Pro Ala Ser Arg Pro Cys Ile Lys
725 730 735
Asn Val Ile Leu Met Leu Glu Gly Ser Glu Asp Ile Pro Ala Pro Pro
740 745 750
Ala Ile Ala Pro Phe Arg Ile Thr Thr
755 760
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 3
aaaccttgtc gcctacccta c 21
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 4
gagactcaac cccttttcgc t 21
Claims (8)
1. a kind of disease-resistant gene PdGsSRK of eastern cottonwood leaf rust resistance, nucleotide sequence is as shown in SEQ ID NO.1.
2. a kind of expression albumen of the disease-resistant gene PdGsSRK of eastern cottonwood leaf rust resistance, amino acid sequence such as SEQ ID
Shown in NO.2.
3. the cloning primer pair of the disease-resistant gene PdGsSRK of eastern cottonwood leaf rust resistance described in claim 1, nucleotides sequence
Column are as shown in SEQ ID NO.3 and SEQ ID NO.4.
4. the disease-resistant gene PdGsSRK of eastern cottonwood leaf rust resistance described in claim 1 is in eastern cottonwood leaf rust resistance breeding
In application.
5. the disease-resistant gene PdGsSRK of eastern cottonwood leaf rust resistance described in claim 1 is improving eastern cottonwood leaf rust resistance
Application in ability.
6. a kind of identification method of the disease-resistant gene PdGsSRK of eastern cottonwood leaf rust resistance described in claim 1, including it is following
Step:
(1) eastern cottonwood genome Resistant Gene To Rust target interval sequence is obtained；
(2) material chosen eastern cottonwood leaf rust resistance respectively, feel leaf rust kind carries out rest fungus inoculation experiments, to transcript profile
Expression analyzed；
(3) eastern cottonwood leaf rust resistance target interval and transcript profile data authentication is combined to obtain disease-resistant gene PdGsSRK.
7. the identification method of the disease-resistant gene PdGsSRK of eastern cottonwood leaf rust resistance according to claim 6, feature exist
In the specific steps analyzed in step (2) the Expression of transcript profile are as follows: extract respectively eastern cottonwood leaf rust resistance,
Leaf rust kind is felt in the total serum IgE of the blade at different vaccination time point, is enriched with out mRNA, reverse transcription and synthetic double chain cDNA, warp
After purification, end reparation plus A are carried out to cDNA and connects sequence measuring joints, construction cDNA library corresponds respectively to two kinds of comparison bases
Because of the sample that type is acquired 8 different vaccination time points, transcript profile sequencing is carried out；
It compares software HISAT2 using RNA-seq to snap to clean reads with reference on genome, with the reads number of comparison
As the original count of each gene, and it is normalized to FPKM value, to eastern cottonwood leaf rust resistance, sense leaf rust variety and genetype
Compared two-by-two in the transcript profile data in 8 different vaccination periods, using EBseq R packet to the difference table of each relatively centering
It is identified up to gene.
8. the identification method of the disease-resistant gene PdGsSRK of eastern cottonwood leaf rust resistance according to claim 7, feature exist
In: combine eastern cottonwood leaf rust resistance target interval and transcript profile data authentication disease-resistant gene PdGsSRK specific in step (3)
Are as follows: to eastern cottonwood leaf rust resistance, the difference expression gene that is obtained in resistance target interval of sense leaf rust genotype, analyze its
The expression pattern at different vaccination time point, obtains an induction type R gene PdGsSRK, and coding G type agglutinin S receptor serine/
Expression quantity is not detected in eastern cottonwood leaf rust resistance of the gene before inoculation, sense leaf rust genotype in threonine kinase,
24,48 and 72 hours after inoculation, which generated inducible expression in leaf rust resistance gene type poplar, and in sense leaf rust
Without generating expression in genotype poplar, show that PdGsSRK gene is the specific gene for defending rest fungus dip dyeing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910858818.XA CN110438135B (en) | 2019-09-11 | 2019-09-11 | Populus deltoides leaf rust resistant disease-resistant gene PdGsSRK, expression protein, cloning primer pair and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910858818.XA CN110438135B (en) | 2019-09-11 | 2019-09-11 | Populus deltoides leaf rust resistant disease-resistant gene PdGsSRK, expression protein, cloning primer pair and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110438135A true CN110438135A (en) | 2019-11-12 |
| CN110438135B CN110438135B (en) | 2021-04-30 |
Family
ID=68439852
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910858818.XA Active CN110438135B (en) | 2019-09-11 | 2019-09-11 | Populus deltoides leaf rust resistant disease-resistant gene PdGsSRK, expression protein, cloning primer pair and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110438135B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110511943A (en) * | 2019-09-11 | 2019-11-29 | 南京林业大学 | The acid mediated eastern cottonwood leaf rust resistance diagnostic gene PdPR-1 of bigcatkin willow, expression albumen, cloning primer pair and its application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080057093A1 (en) * | 2006-08-07 | 2008-03-06 | University Of Missouri Board Of Curators | LysM Receptor-Like Kinases To Improve Plant Defense Response Against Fungal Pathogens |
| CN106834314A (en) * | 2017-02-22 | 2017-06-13 | 山东省农业科学院生物技术研究中心 | Millet adversity gene SiRLK35 and encoding proteins and application |
| CN108456740A (en) * | 2018-03-02 | 2018-08-28 | 江苏里下河地区农业科学研究所 | One Rice Resistance To Rice Blast site ' Pi-jx ' and its Indel labeled primers and Breeding Application |
-
2019
- 2019-09-11 CN CN201910858818.XA patent/CN110438135B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080057093A1 (en) * | 2006-08-07 | 2008-03-06 | University Of Missouri Board Of Curators | LysM Receptor-Like Kinases To Improve Plant Defense Response Against Fungal Pathogens |
| CN106834314A (en) * | 2017-02-22 | 2017-06-13 | 山东省农业科学院生物技术研究中心 | Millet adversity gene SiRLK35 and encoding proteins and application |
| CN108456740A (en) * | 2018-03-02 | 2018-08-28 | 江苏里下河地区农业科学研究所 | One Rice Resistance To Rice Blast site ' Pi-jx ' and its Indel labeled primers and Breeding Application |
Non-Patent Citations (6)
| Title |
|---|
| C. HERVE ET AL.: "Characterization of an Arabidopsis thaliana Gene that Kinases with an Extracellular Lectin-like Domain", 《JMB》 * |
| FREDDY BOUTROT ET AL.: "Function, Discovery,and Exploitation of Plant Pattern Recognition Receptors for Broad-Spectrum Disease Resistance", 《ANNU. REV. PHYTOPATHOL.》 * |
| GENBANK: "PREDICTED: Populus trichocarpa G-type lectin S-receptor-like serine/threonine-protein kinase LECRK1 (LOC18109840), mRNA ACCESSION：XM_006388068", 《GENBANK》 * |
| SUYUN WEI ET AL.: "Identification of Genes Underlying the Resistance to Melampsora larici-populina in an R Gene Supercluster of the Populus deltoides Genome", 《PLANT DIS.》 * |
| XIAO-LI SUN ET AL.: "GsSRK, a G-type lectin S-receptor-like serine/threonine protein kinase, is a positive regulator of plant tolerance to salt stress", 《JOURNAL OF PLANT PHYSIOLOGY》 * |
| 张博 等: "美洲黑杨抗黑斑病基因的RAPD标记筛选和连锁分析", 《遗传》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110511943A (en) * | 2019-09-11 | 2019-11-29 | 南京林业大学 | The acid mediated eastern cottonwood leaf rust resistance diagnostic gene PdPR-1 of bigcatkin willow, expression albumen, cloning primer pair and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110438135B (en) | 2021-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Shigyo et al. | Molecular evolution of the AP2 subfamily | |
| CN103993018B (en) | Control Plant Height of Rice, improve lodging tolerance, increase available tillering and the gene of yield and application thereof | |
| CN108165653B (en) | InDel molecular marker for identifying pepper maturity and application thereof | |
| US20230323382A1 (en) | B3 transcription factor gene for simultaneously improving length, strength and elongation of cotton fibers and use thereof | |
| CN109628630B (en) | Gene obviously related to cotton coat-dividing character, SNP marker and application thereof | |
| US11692200B2 (en) | Method for improving rice yield and/or rice blast resistance and protein used thereof | |
| CN108165554A (en) | Control corn leaf width gene ZmNL4 and its application | |
| Ming-Yu et al. | Estimating genetic diversity of rice landraces from Yunnan by SSR assay and its implication for conservation | |
| de Matos Nogueira et al. | Characterization of glutamine synthetase genes in sugarcane genotypes with different rates of biological nitrogen fixation | |
| CN114181950B (en) | Gene for controlling plum blossom single and double valve characters, molecular marker and application thereof | |
| Ro et al. | Genome-wide association study of resistance to Phytophthora capsici in the pepper (Capsicum spp.) collection | |
| Du et al. | Selection of generally applicable SSR markers for evaluation of genetic diversity and identity in Lilium | |
| CN102260736A (en) | Identification method for distant hybrid progenies of peony | |
| CN110698550B (en) | Molecular detection method for rapidly identifying real plum/apricot plum strain | |
| CN110438135A (en) | Disease-resistant gene PdGsSRK, expression albumen, cloning primer pair and its application of eastern cottonwood leaf rust resistance | |
| CN108531636B (en) | Molecular marker TJcM01 for identifying melon unisexual flower and application thereof | |
| CN115807011A (en) | ROPGEF gene capable of simultaneously improving length, strength and elongation of cotton fiber and application thereof | |
| CN109207485A (en) | Application of the OsAPS1 gene in improvement Rice Resistance characteristic of disease | |
| Han et al. | Genetic relatedness and association mapping of horticulturally valuable traits for the ceiba plants using ddRAD sequencing | |
| CN116144697A (en) | GhKV3WRKY29 gene and application of protein thereof in improving verticillium dahliae verticillium resistance of plants | |
| CN115786564A (en) | Rice Pi-ta and Ptr dominant functional molecular marker and application thereof | |
| CN111518803B (en) | RNAi fragment and application thereof in regulation and control of lignin synthesis | |
| CN110128517B (en) | Primula forbesii flower fragrance related gene PfLIS/NES and application thereof | |
| CN114277033A (en) | Chinese platycodon root RPL13 reference gene sequence and primer and application thereof | |
| CN113293170A (en) | Gene MeTIR1 for regulating cassava starch content and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |