CN110423766B

CN110423766B - Lycopene beta-cyclase gene and coding protein and application thereof

Info

Publication number: CN110423766B
Application number: CN201910808553.2A
Authority: CN
Inventors: 卢山; 杨立恩; 邓银银; 曹天骏
Original assignee: Nanjing University
Current assignee: Nanjing University
Priority date: 2019-08-29
Filing date: 2019-08-29
Publication date: 2021-06-29
Anticipated expiration: 2039-08-29
Also published as: CN110423766A

Abstract

A lycopene beta-cyclase gene and a coding protein and application thereof, relating to the application of a PyLCYB protein and a coding gene thereof in the metabolism of purple seaweed carotenoids. The nucleotide sequence of the gene of the invention is shown in a sequence table Seq ID No:1 or a polynucleotide sequence which has more than 80 percent of homology with the nucleotide sequence of SEQ ID NO. 1 of the sequence table and codes the protein with the same function. The amino acid sequence is shown in a sequence table Seq ID No: 2 or represented by Seq ID No: 2 is substituted, deleted or added by one or more amino acid residues and has the amino acid sequence similar to that of Seq ID No: 2, and the amino acid residue sequence has the same activity. It is used in the genetic engineering of purple seaweed carotenoid metabolism.

Description

Lycopene beta-cyclase gene and coding protein and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a porphyra yezoensis lycopene beta-cyclase PyLCYB protein and application of a coding gene thereof in metabolism of carotenoid in laver.

Background

Laver is one of the important cultivated seaweeds in the world, is mainly produced in China, Japan and Korea, and statistically, the total laver yield is about 88 billion yuan (Blouin et al.2011) in three countries in 2010-2011. The laver industry becomes an important support industry for economic earning and export earning in coastal areas, is also the industry for attracting and transferring the most workers in the traditional fishing industry, and plays an indispensable role in increasing income of fishermen, economic development and social stability in the coastal areas. Moreover, laver is an ideal material for studying plant physiology, biochemistry and early evolution (Waaland et al 2004; Lin et al 2009; Su et al 2010).

The laver grows in the intertidal zone, and must endure the day-cycle extreme adverse environment (such as high light, high salt, water loss and the like) caused by the tide, and the long-term evolution process causes the laver to generate a protection mechanism for a photosynthetic system under the adverse environment. The ultimate feature of stress, such as water loss, high light and low temperature, is the production of Reactive Oxygen Species (ROS) in plant cells, causing damage to the organism (Jithesh et al 2006). Studies have shown that cyclic carotenoids (cyclic carotenoids) are the first line of defense in higher plants against ROS damage. Studies have shown that the hindrance of the synthesis of cyclic carotenoids in aerobic photosynthetic organisms can be lethal, indicating an important role for carotenoids in plant response to environmental changes (Britton et al 1979).

Carotenoids (carotenoids) accumulate in plants, usually in flowers, fruits and roots, and bright colors can attract insects or animals as a medium for pollination or seed dispersal. In addition, carotenoids, as precursors of vitamin A, have great nutritional value to humans and animals (Cuningham and Gantt 1998; Shumskaya and Wurtzel 2013). While lutein (lutein) and zeaxanthin (zeaxanthin) in carotenoids are present in the macular area of human and animal eyes, and have a very important role in the change of light perception for human vision (Handelman et al 1998). Carotenoids can be classified into two major classes, linear carotenoids and cyclic carotenoids, according to their structural characteristics. Studies on higher plants have shown that carotenoid metabolism starts with phytoene synthesis, which undergoes a series of dehydrogenises and isomeroses by the relevant metabolic enzymes to form linear all-trans lycopene (lycopene). With lycopene as a substrate, lycopene cyclase (lycopen cyclase) is responsible for the cyclization of carotenoids, and different cyclases generate different rings at two ends of linear lycopene, so that metabolic branches appear in carotenoid metabolic pathways for the first time. Lycopene beta-cyclase catalyzes the formation of two beta-rings at both ends of linear lycopene, producing beta-carotene (beta-carotene). Through the sequential action of lycopene beta-cyclase and lycopene epsilon-cyclase, a beta-ring and an epsilon-ring are respectively formed at the tail end of linear lycopene to generate alpha-carotene (alpha-carotene). In a few plant species (e.g., lettuce), the lycopene epsilon cyclase has the ability to form an epsilon-ring at each end of linear lycopene, producing epsilon carotene (epsilon-carotenes). Studies have shown that alpha-and beta-carotenoids are simultaneously involved in stress adaptation in plants and have distinct but complementary roles in coping with environmental changes (Dall' Osto et al 2007). Therefore, precise control of the α -/β -carotenoid ratio is an important adaptive response of plants to changing environments (Krause et al 2004). Therefore, in the metabolism of carotenoid, the functional activity of different lycopene cyclases and the change of the expression thereof can control the distribution of carotenoid metabolism flow to different branches, thereby adapting plants to different environmental stresses.

Previous studies by applicants have shown that two cyclic carotenoids can be metabolically produced and accumulated in laver: alpha-carotenoids (alpha-carotenoids) and beta-carotenoids (beta-carotenoids), in particular, mainly including alpha-carotene, lutein (lutein), beta-carotene and zeaxanthin (zeaxanthin) and several trace metabolic intermediates (Yang et al 2014). However, the related researches on the metabolic pathways of the laver carotenoids are still relatively few, and only applicants report on carotene hydroxylase (PuCHY1) and geranylgeranyl diphosphate synthase (PuGGPS) in the laver umbilicalis, and no report on lycopene beta-cyclase exists. The discovery and functional identification of PyLCYB in laver species represented by porphyra yezoensis are beneficial to improving the content of nutrient components such as carotenoid in the porphyra yezoensis by utilizing a genetic engineering technology in the future so as to improve the nutritive value of the porphyra yezoensis, and the taste and flavor of the porphyra yezoensis are improved by improving the content of terpenoid substances, so that the economic value of the porphyra yezoensis is integrally improved.

Disclosure of Invention

The invention provides a lycopene beta-cyclase gene, and a coding protein and application thereof, wherein the gene transcriptome codes the lycopene beta-cyclase, so that carotenoids such as zeaxanthin and antherin can be synthesized and accumulated in porphyra.

The nucleotide sequence of the lycopene beta-cyclase gene is shown as the sequence table Seq ID No:1 is shown.

The nucleotide sequence of the lycopene beta-cyclase gene has more than 80 percent of homology with the nucleotide sequence of SEQ ID NO:1 in a sequence table and encodes protein with the same function.

The protein coded by the lycopene beta-cyclase gene has an amino acid sequence shown in a sequence table Seq ID No: 2, respectively.

The protein coded by the lycopene beta-cyclase gene has an amino acid sequence shown as Seq ID No: 2 is substituted, deleted or added by one or more amino acid residues and has the amino acid sequence similar to that of Seq ID No: 2, and the amino acid residue sequence has the same activity.

The lycopene beta-cyclase gene is derived from porphyra yezoensis (Pyropia yezoensis) and is named as PyLCYB, and the gene is abbreviated as PyLCYB hereinafter.

The lycopene beta-cyclase is derived from porphyra yezoensis.

A recombinant expression vector comprising the gene of

claim

1 or 2.

A transformant comprising a host cell containing the recombinant expression vector of claim 6.

The host of the transformant is a microorganism, a plant or a transgenic cell line.

The application of the lycopene beta-cyclase gene is used in the genetic engineering of the metabolism of the purple seaweed carotenoid.

The lycopene beta-cyclase gene (PyLCYB) of the invention is obtained in the following way:

first, extraction of Total RNA

Selecting Porphyra yezoensis (Pyropia yezoensis) (from national grade Porphyra germplasm bank of Marine aquatic research institute of Jiangsu province), extracting by using an RNAioso kit (Takara corporation) to obtain Porphyra yezoensis total RNA, detecting by electrophoresis and an ultraviolet spectrophotometer to confirm the integrity, purity and concentration of the RNA, and storing at-80 deg.C;

cloning of Porphyra yezoensis lycopene beta-cyclase Gene (PyLCYB)

Using 1. mu.g of the total RNA obtained in the first step as a template for reverse transcription, nested PCR amplification was performed using the Touchdown PCR program after synthesizing the first strand of cDNA by reverse transcription using SSRT-II reverse transcriptase according to the instructions of the SMARTer RACE cDNA Kit (Clontech) to obtain the full length PyLCYB ORF. Wherein

The primers used for 5' -RACE were as follows:

PyLCY1-ER1：CGTAGAGGCGGGTGTCGTCATCGGCAGTGG

PyLCY1-ER2：GGGCGGAAGAAGAAGCGGCGGGCGACG

the primers used for 3' -RACE were as follows:

PyLCY1-HF1：TGGGCAGAGTTCCTCTCTTTCCGTCTGCT

PyLCY1-HF2：TGTTGCCGCTGTACCCGGTGGAGGTGCCAC

connecting the PCR product to a pMD19-T (Takara company) vector, sequencing and splicing to obtain an ORF sequence Seq ID No of the porphyra yezoensis lycopene beta-cyclase gene PyLCYB with a complete coding region: 1.

thirdly, construction of Escherichia coli expression vector

The site of the signal peptide in the PyLCYB protein is predicted by software such as targetP, ChroroP and the like, and then a partial sequence of the PyLCYB cut signal peptide is amplified by a primer with an EcoR I enzyme cutting site and cloned to a pMAL-C5X vector.

The primer sequences with EcoR I cleavage sites are as follows:

PyLCY1-pMAL-HF：

ccgcgatatcgtcgacggatccAGTGCGGCGGTCGCGGCGCAGCG

PyLCY1-pMAL-HF：

tacctgcagggaattcggatccTCACTCCGTCTCCGCCGGCAGCG

wherein, the lower case letters represent the homologous arm sequences, the upper case letters are the gene sequences as primers, and the underlined part is the introduced enzyme cutting site.

Fourth, enzyme activity identification

And co-transferring the expression vector pMAL-PyLCYB obtained in the third step and a vector pAC-LYC carrying a series of Erwinia uredovora carotenoid synthesis related genes CrtE (GGPS), CrtB (PSY) and CrtI (PDS/ZDS) into escherichia coli. The gene carried on the vector pAC-LYC can enable the cells of the escherichia coli to accumulate beta-carotene under the condition that the active lycopene beta-cyclase exists, so that the escherichia coli colony or bacterial liquid is orange yellow; coli is orange-red if there is no active lycopene beta-cyclase. The empty vector pMAL-C5X was cotransfected with pAC-LYC as a negative control. The products of each sample were analyzed by HPLC.

The PyLCYB gene of the invention is derived from the laver umbiliciformis, and the receptor plant of the gene engineering is suitable for the organisms such as rice and the like.

The PyLCYB gene of the invention is used as a target gene to construct a plant expression vector, and a cauliflower mosaic virus CAMV35S promoter, an ethanol-induced promoter and the like can be used, and an enhancer can be included if necessary. To simplify the identification of transformed plants, selectable markers (e.g., antibiotic enzymes) can be used. The expression vector used may be Ti plasmid, Ri plasmid, plant virus vector, etc. Transformation methods Agrobacterium-mediated or other methods can be used to transform plants.

The invention discovers an enzyme involved in a carotenoid anabolism pathway in porphyra species, namely lycopene beta-cyclase for the first time, and proves that the enzyme is involved in the carotenoid metabolism in the porphyra.

The gene sequence for coding the enzyme is obtained, and a foundation is provided for improving the metabolic pathway of carotenoid in the laver by utilizing a gene engineering technology so as to improve the content of the carotenoid and terpenoid in the laver.

The PyLCYB gene and the protein provided by the invention are used for carrying out genetic engineering improvement on porphyra species, the industrial value of the gene and the protein is emphasized on two aspects, and firstly, the nutritional value of the porphyra is improved by improving the content of carotenoid in the porphyra, so that the economic value of the porphyra is improved.

Drawings

FIG. 1 shows the nucleotide and deduced amino acid sequence of PyLCYB; wherein "+" represents a stop codon;

FIG. 2 is a multiple sequence alignment of lycopene cyclase protein sequences of different species, with the marker regions being a conserved Rossmann fold (1), two cyclase domains (2,3), two transmembrane helix domains (4,6) and a dotted domain (5), the boxed region being present only in the red algae lycopene cyclase sequence;

FIG. 3 is a HPLC analysis of PyLCYB in E.coli; wherein, A: absorption spectra of different carotenoids; b: pMAL-C5X and pAC-LYC were cotransferred into E.coli as negative controls; c: pMAL-PyLCYB and pAC-LYC are co-transferred into Escherichia coli;

FIG. 4 is a phylogenetic analysis of lycopene cyclase in different species.

Detailed Description

The present invention is not limited to the above embodiments, and recombinant expression vectors, transgenic cell lines and host bacteria containing the gene of the present invention are included in the scope of the present invention.

Example 1

The gene acquisition process for PyLCYB of this example is as follows:

1) porphyra yezoensis PyLCYB transcript identification and coding region cloning

Searching homologous sequence in Porphyra yezoensis genome by using Open Reading Frame (ORF) encoding LCYB gene in Arabidopsis thaliana, wherein tblastx is adopted as searching method, and e-value is intercepted to be 1 × 10^-10Possible homologous sequences have been screened and only one transcript contig _10139 is found. RACE primers were designed based on the transcript gene sequence to amplify the ORF of PyLCYB (shown in FIG. 1).

The total RNA of porphyra yezoensis thallus is extracted by using an RNAioso reagent (Takara company), the integrity, the purity and the concentration of the RNA are confirmed by electrophoresis detection and ultraviolet spectrophotometer detection, and the RNA is stored at the temperature of minus 80 ℃.1 mu g of total RNA is used as a template for reverse transcription, a cDNA first chain is synthesized through reverse transcription, PCR amplification is carried out, after the reaction is finished, a PCR product is connected to a pMAL-C5X vector, the gene has a total length of 1872bp, a protein sequence containing 623 amino acid residues and a stop codon are coded together, and a chloroplast-located signal peptide is analyzed at the N end of the protein. The deduced protein sequence was aligned to the homologous lycopene cyclase multiple sequences in other species (shown in figure 2), indicating that the obtained PyLCYB is homologous to lycopene cyclase in other species.

2) Construction of Porphyra yezoensis PyLCYB expression vector

Using 1. mu.g of the total RNA obtained in step 1) as a template for reverse transcription, "PrimeScript" of Takara^TMThe 1st Strand cDNA Synthesis Kit "Kit inverted to synthesize the first Strand of cDNA.

According to the full-length coding sequence of the PyLCYB obtained by RACE, a signal peptide sequence of the coding protein is presumed by using chloroP and targetP, primers at two ends are designed, EcoR I restriction endonuclease sites are introduced, and a partial sequence of the PyLCYB after signal peptide truncation is amplified (the primers are synthesized by Genscript company).

Using 1 μ g of total RNA obtained in step 2) as a reverse transcription template, performing PCR amplification after synthesizing a first strand cDNA by reverse transcription, wherein the PCR program is as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30s, annealing at 67 ℃ for 1min, extension at 72 ℃ for 1min, and after 35 cycles, extension at 72 ℃ for 10 min. After the reaction is finished, the PCR product is connected to a pMAL-C5X vector, the positive clone is screened after the connecting product is transformed into escherichia coli BL21(DE3) competent cells, and a recombinant vector carrying PyLCYB is obtained and named as pMAL-PyLCYB.

3) Heterologous expression and functional characterization of PyLCYB

Transforming the PyLCYB-containing vector constructed in the step 2) into Escherichia coli BL21(DE3) cells in the presence of carboxybenzylmycin (50. mu.g.mL)^-1) Culturing on LB-Agar culture medium overnight for screening, picking single colony and transferring into the medium containing the same concentrationCulturing on LB liquid culture medium of carbenicillin at 37 deg.C and 200rpm under shaking to OD₆₀₀Adding isopropyl-beta-D-thiogalactoside (IPTG, 0.5 mmol. multidot.L) to the mixture to obtain a mixture of 0.4-0.6^-1) And (3) performing induced expression for 3-4 h. The expressed protein was analyzed by SDS-polyacrylamide gel electrophoresis (PAGE, 10%).

Example 2

The functional verification of PyLCYB is as follows:

in order to identify the function of PyLCYB, an in vivo enzyme activity identification system of Escherichia coli is adopted, and the activity of the enzyme is analyzed by a color complementary method and HPLC. The system uses plasmid pAC-LYC which carries Erwinia uredovora carotenoid synthesis related genes geranylgeranyl diphosphate synthase (CrtE, GGPS), phytoene synthase (CrtB, PSY) and phytoene desaturase (CrtI, PDS/ZDS), and can accumulate lycopene (orange red) in Escherichia coli cells as a substrate of lycopene cyclase. Can synthesize and accumulate beta-carotene in Escherichia coli cells under the condition of lycopene beta-cyclase, so that the Escherichia coli is orange yellow; and the colibacillus is still orange red under the condition of not having the beta-lycopene cyclase, so that whether the beta-cyclase of the lycopene exists or not can be easily distinguished.

4) pMAL-PyLCYB and pAC-LYC which can be normally expressed are co-transferred into an Escherichia coli BL21(DE3) strain by a heat shock method. The empty vector pMAL-C5X was cotransformed with pAC-LYC as a negative control. Co-transformed strains in the presence of chloramphenicol (50. mu.g.mL)^-1) And Carboxybenzylmycin (50. mu.g.mL)^-1) The LB medium of (1). Selecting yellow colonies to inoculate 5mL of liquid LB culture medium with chloramphenicol and carbenicillin, carrying out shaking culture at 37 ℃ and 200rpm overnight, inoculating 200 microliter of the yellow colonies to 20mL of resistant LB culture medium, carrying out shaking culture at 200rpm for 3d, and centrifugally collecting thalli, wherein the color of escherichia coli is orange yellow in a sample containing porphyra yezoensis PyLCYB, while the color of the negative control escherichia coli containing an empty vector pMAL-C5X is orange red, which shows that the PyYBLC has the activity of catalyzing the beta-cyclization of lycopene, so that the escherichia coli cells accumulate beta-carotene.

5) Pigment extraction and HPLC analysis

The Escherichia coli thallus containing the double vectors pAC-LYC and pMAL-C5X/pMAL-PyLCYB is collected by centrifugation at 10,000g for 1min and then is subjected to ultrasonication. Adding 400 μ L of 80% acetone to the ultrasonicated material, shaking vigorously for 30min to completely extract pigment contained in the material, and then adding 250 μ L of ethyl acetate and ddH in this order₂O, shaking vigorously for 15sec, standing for 5min, and centrifuging at 4 deg.C for 5min at 10,000 g. The supernatant was aspirated and dried with nitrogen and dissolved in 100. mu.L of ethyl acetate. The extracted pigment was separated by reverse phase high performance liquid chromatography (reverse-phase HPLC) on a Spherisorb ODS2C18 column (Waters) of 4.6X 250mm with a mobile phase of linearly developed ethyl acetate (0-100%) in acetonitrile, water, triethylamine (9:1: 0.01). The development time is 45min, and the flow rate is 1 mL/min^-1The column temperature was 50 ℃. The scanning wavelength of the detector is 300-800 nm. The results of the 296nm and 440nm scans were selected. Identification of carotenoids was determined based on standard or reported retention times and absorption profiles. All chemicals were chromatographically pure. The analysis of the structure indicated that beta-carotene was accumulated in the sample, whereas no beta-carotene was accumulated in the negative control (fig. 3), further demonstrating that PyLCYB can catalyze the beta-cyclization of lycopene to beta-carotene.

6) Systematic analysis

To determine the type of the cloned gene PyLCYB, we searched the homologous sequence of PyLCYB in GenBank and took the lycopene cyclase sequence of different plants according to the previous report and carried out phylogenetic analysis. All sequences were aligned with ClustalX and phylogenetic trees were constructed using the adjacency method in MEGA5.1(Tamura et al, 2011). The bootstrap test was repeated 1,000 times for analyzing the reliability of each node. The results of the analysis showed that PyLCYB indeed belongs to lycopene beta-cyclase in plants (shown in figure 4).

Sequence listing

<110> Nanjing university

<120> lycopene beta-cyclase gene and coding protein and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1872

<212> DNA

<213> Porphyra yezoensis (Pyropia yezoensis)

<400> 1

atggcggcgt ttgtaccggc ggcgccggcg acggctggcc cgcggccgct cgggcggtcg 60

gtcggcgcat tgggggtcgc gcccgcggtt tggccgctgt ctaccagact ccgcggtcgc 120

agtgcggcgg tcgcggcgca gcggctgggg cagcggccgc cgcgcggcgc gcccgcgacg 180

cggatggtga cgacgcccgc agcggccggg tcgactgccg cggcggcagc gtcgtcgtcg 240

cccgccgctt cttcttccgc cccttcgatg gcctctgtgg cggccgctgc gacggcgacg 300

tcgcccatcc cccccactgc cgatgacgac acccgcctct acgacgtggt ggtaattggc 360

ggcggccccg cgggcctgtc cctgtctgcg ggccttggcg agcgcggcct ccggacgctg 420

gtgctggacg cggcgcttga tcagccgtgg cccaacaatt acggggtgtg gttggacgag 480

ctggaggcgc tcggcctggg cgactgcacc agcgccgttt ggcccgacgc ggtggcgtac 540

gtgcgcgccg acggggctcc gtcggcactt aaccgggtgt acgtgcggct ggaccggcac 600

gcgctcaagc ggcggctgct tgctcgctgc cgcgcgtcgg gggcggtgac ggtccgacac 660

gcggcggcgg ccgacgtgga cgtgacgccc gctgcccatt cggtggtgag ctaccaggac 720

gtggtacccg cgcccgtggc ggacggtgac gacgcgacgg gggcgggggg tggcggcccg 780

tctcgcccgc ggctggtcgg gccccttcgg tctgcccgtg gggcggtcgt cgcggacgcc 840

actggccacg cgcttcggtt tgttgagatg gagggcgccg ctgccgacgg ggacgggccg 900

tcctctttgg accagcgggg cttccaggcc gcctatggca ttgaggctga ggtagagtcc 960

cacccctacg cgcctggtcg aatggtgctc atggactacc gggatgacca catgcagggg 1020

agcgcagccg agcgcaccga gtccaccgcc gtcccgacct tcctgtatgc catgcccacg 1080

gctcccaacc gcgttttctt tgaggagacc tccctcatcg cctcccccgc ggtgccattt 1140

gacgacctaa agcgccgcct ccacgcgcgc ctggcacacg acggcatcac cgtcacgcgg 1200

gtgctcgacg aggaatactg tctcatccct atgggcgggc cactgccggc ccggcggcag 1260

cgggttgttg cgtttggcgg cgctgccgcg ctcgtccacc ccgcgacggg ctacatggtt 1320

gcccgcgcgc tcgagttggc cgacgaggcc gcggggctga ttgcggggca gctggcggcg 1380

gccaaggcca ccgctgtaga ggcggccgcg gccgccggtt gtgcagtgag tggccctgca 1440

tccacgccga cgcctttgtc aggccagcag ggtgccccgg agttggaagt agatgcggac 1500

gcggtagcgg cgggcgtgtg ggatgcgctg tggagcattg gccggcggcg acagcgtgac 1560

tttttcaact ttggcggcga gtacctgcgg cggttggacc tgctcacgct ccgcgatttc 1620

ttctccgcgt ttttccgcct gccccgccag cagtgggcag agttcctctc tttccgtctg 1680

ctgcggccgg gtgagcgcct ggcgtttggt ttgggcgtct ttttccggac gagcaaccgg 1740

gtgcgggcga cgatcacacc atttggggcg tttcacgggc ggggcaagct gctaatgagc 1800

ctgttgccgc tgtacccggt ggaggtgcca ccaccggtca aactgccacc gctgccggcg 1860

gagacggagt ga 1872

<210> 2

<211> 623

<212> PRT

<213> Porphyra yezoensis (Pyropia yezoensis)

<400> 2

Met Ala Ala Phe Val Pro Ala Ala Pro Ala Thr Ala Gly Pro Arg Pro

1 5 10 15

Leu Gly Arg Ser Val Gly Ala Leu Gly Val Ala Pro Ala Val Trp Pro

20 25 30

Leu Ser Thr Arg Leu Arg Gly Arg Ser Ala Ala Val Ala Ala Gln Arg

35 40 45

Leu Gly Gln Arg Pro Pro Arg Gly Ala Pro Ala Thr Arg Met Val Thr

50 55 60

Thr Pro Ala Ala Ala Gly Ser Thr Ala Ala Ala Ala Ala Ser Ser Ser

65 70 75 80

Pro Ala Ala Ser Ser Ser Ala Pro Ser Met Ala Ser Val Ala Ala Ala

85 90 95

Ala Thr Ala Thr Ser Pro Ile Pro Pro Thr Ala Asp Asp Asp Thr Arg

100 105 110

Leu Tyr Asp Val Val Val Ile Gly Gly Gly Pro Ala Gly Leu Ser Leu

115 120 125

Ser Ala Gly Leu Gly Glu Arg Gly Leu Arg Thr Leu Val Leu Asp Ala

130 135 140

Ala Leu Asp Gln Pro Trp Pro Asn Asn Tyr Gly Val Trp Leu Asp Glu

145 150 155 160

Leu Glu Ala Leu Gly Leu Gly Asp Cys Thr Ser Ala Val Trp Pro Asp

165 170 175

Ala Val Ala Tyr Val Arg Ala Asp Gly Ala Pro Ser Ala Leu Asn Arg

180 185 190

Val Tyr Val Arg Leu Asp Arg His Ala Leu Lys Arg Arg Leu Leu Ala

195 200 205

Arg Cys Arg Ala Ser Gly Ala Val Thr Val Arg His Ala Ala Ala Ala

210 215 220

Asp Val Asp Val Thr Pro Ala Ala His Ser Val Val Ser Tyr Gln Asp

225 230 235 240

Val Val Pro Ala Pro Val Ala Asp Gly Asp Asp Ala Thr Gly Ala Gly

245 250 255

Gly Gly Gly Pro Ser Arg Pro Arg Leu Val Gly Pro Leu Arg Ser Ala

260 265 270

Arg Gly Ala Val Val Ala Asp Ala Thr Gly His Ala Leu Arg Phe Val

275 280 285

Glu Met Glu Gly Ala Ala Ala Asp Gly Asp Gly Pro Ser Ser Leu Asp

290 295 300

Gln Arg Gly Phe Gln Ala Ala Tyr Gly Ile Glu Ala Glu Val Glu Ser

305 310 315 320

His Pro Tyr Ala Pro Gly Arg Met Val Leu Met Asp Tyr Arg Asp Asp

325 330 335

His Met Gln Gly Ser Ala Ala Glu Arg Thr Glu Ser Thr Ala Val Pro

340 345 350

Thr Phe Leu Tyr Ala Met Pro Thr Ala Pro Asn Arg Val Phe Phe Glu

355 360 365

Glu Thr Ser Leu Ile Ala Ser Pro Ala Val Pro Phe Asp Asp Leu Lys

370 375 380

Arg Arg Leu His Ala Arg Leu Ala His Asp Gly Ile Thr Val Thr Arg

385 390 395 400

Val Leu Asp Glu Glu Tyr Cys Leu Ile Pro Met Gly Gly Pro Leu Pro

405 410 415

Ala Arg Arg Gln Arg Val Val Ala Phe Gly Gly Ala Ala Ala Leu Val

420 425 430

His Pro Ala Thr Gly Tyr Met Val Ala Arg Ala Leu Glu Leu Ala Asp

435 440 445

Glu Ala Ala Gly Leu Ile Ala Gly Gln Leu Ala Ala Ala Lys Ala Thr

450 455 460

Ala Val Glu Ala Ala Ala Ala Ala Gly Cys Ala Val Ser Gly Pro Ala

465 470 475 480

Ser Thr Pro Thr Pro Leu Ser Gly Gln Gln Gly Ala Pro Glu Leu Glu

485 490 495

Val Asp Ala Asp Ala Val Ala Ala Gly Val Trp Asp Ala Leu Trp Ser

500 505 510

Ile Gly Arg Arg Arg Gln Arg Asp Phe Phe Asn Phe Gly Gly Glu Tyr

515 520 525

Leu Arg Arg Leu Asp Leu Leu Thr Leu Arg Asp Phe Phe Ser Ala Phe

530 535 540

Phe Arg Leu Pro Arg Gln Gln Trp Ala Glu Phe Leu Ser Phe Arg Leu

545 550 555 560

Leu Arg Pro Gly Glu Arg Leu Ala Phe Gly Leu Gly Val Phe Phe Arg

565 570 575

Thr Ser Asn Arg Val Arg Ala Thr Ile Thr Pro Phe Gly Ala Phe His

580 585 590

Gly Arg Gly Lys Leu Leu Met Ser Leu Leu Pro Leu Tyr Pro Val Glu

595 600 605

Val Pro Pro Pro Val Lys Leu Pro Pro Leu Pro Ala Glu Thr Glu

610 615 620

<210> 3

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cgtagaggcg ggtgtcgtca tcggcagtgg 30

<210> 4

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gggcggaaga agaagcggcg ggcgacg 27

<210> 5

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgggcagagt tcctctcttt ccgtctgct 29

<210> 6

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgttgccgct gtacccggtg gaggtgccac 30

<210> 7

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccgcgatatc gtcgacggat ccagtgcggc ggtcgcggcg cagcg 45

<210> 8

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tacctgcagg gaattcggat cctcactccg tctccgccgg cagcg 45

Claims

1. The lycopene beta-cyclase gene is characterized in that the nucleotide sequence is shown in a sequence table Seq ID No:1 is shown.

2. The protein coded by the lycopene beta-cyclase gene is characterized in that the amino acid sequence of the protein is shown in a sequence table Seq ID No: 2, respectively.

3. A recombinant expression vector comprising the gene of claim 1.

4. The use of the lycopene beta-cyclase gene as claimed in claim 1, wherein the lycopene beta-cyclase gene is used in genetic engineering of the metabolism of carotenoids in the laver.