CN110423765A - A kind of lycopene ε-cyclase gene and its coding albumen and application - Google Patents

A kind of lycopene ε-cyclase gene and its coding albumen and application Download PDF

Info

Publication number
CN110423765A
CN110423765A CN201910807944.2A CN201910807944A CN110423765A CN 110423765 A CN110423765 A CN 110423765A CN 201910807944 A CN201910807944 A CN 201910807944A CN 110423765 A CN110423765 A CN 110423765A
Authority
CN
China
Prior art keywords
sequence
lycopene
ala
amino acid
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910807944.2A
Other languages
Chinese (zh)
Inventor
卢山
杨立恩
邓银银
曹天骏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing University
Original Assignee
Nanjing University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nanjing University filed Critical Nanjing University
Priority to CN201910807944.2A priority Critical patent/CN110423765A/en
Publication of CN110423765A publication Critical patent/CN110423765A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y505/00—Intramolecular lyases (5.5)
    • C12Y505/01—Intramolecular lyases (5.5.1)
    • C12Y505/01018—Lycopene epsilon-cyclase (5.5.1.18)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

A kind of lycopene ε-cyclase gene and its coding albumen and application, it is related to a kind of application of PyLCYE albumen and its encoding gene in seaweed Carotenoid Metabolism.The nucleotide sequence of gene of the invention is as shown in sequence table Seq ID No:1 or has 80% or more homology with sequence table SEQ ID NO:1 nucleotide sequence and encodes the polynucleotide sequence of identical function protein.Amino acid residue sequence identical active amino acid sequence of its amino acid sequence shown in sequence table Seq ID No:2 or as the amino acid sequence as described in sequence table Seq ID No:2 by substitution, missing or the addition of one or several amino acid residues and as described in having with sequence table Seq ID No:2.It is in seaweed carotenoid metabolic gene engineering.

Description

A kind of lycopene ε-cyclase gene and its coding albumen and application
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of Porphyra yezoensis lycopene ε-cyclase PyLCYE The application of albumen and its encoding gene in seaweed carotenoid and chlorophyll metabolism.
Background technique
Seaweed is one of cultivation seaweed important in the world, mainly originates in China, Japan and South Korea, according to statistics, 2010- 2011 annual three national about 8,800,000,000 yuan of the gross output value of seaweeds (Blouin et al.2011).Seaweed industry has become coastal area Economic extra earning, the mainstay industry of foreign exchange earning, and attract, the industry that transfer tradition fishing industry practitioner is most, Indispensable role is played to coastal area fisherman's increased income, economic development and social stability.Moreover, seaweed is still studied Ideal material (the Waaland et al.2004 that plant physiology, biochemistry and early stage evolve；Lin et al.2009；Su et al.2010)。
Seaweed is grown in intertidal zone, it is necessary to tolerance by tide bring date periodicity extreme adverse circumstance (such as bloom, it is with high salt, Dehydration etc.), long-term evolutionary process make which create under adverse circumstance to the protection mechanism of photosynthetical system.Dehydration, bloom and low temperature Etc. adverse circumstances final feature be all in plant cell generation active oxygen matter (ROS, reactive oxygen species), it is right Biology causes damage (Jithesh et al.2006).Studies have shown that cyclisation carotenoid (cyclic carotenoids) It is the first line of defence of higher plant defence ROS damage.Studies have shown that in aerobic photosynthetic organism synthesis cyclisation carotenoid by Resistance may be it is lethal, show cyclisation carotenoid plant response environment variation in important function (Britton et al.1979)。
Carotenoid (carotenoids) is usually accumulated in colored, fruit in plant and root, chromatic colour can To attract insect or animal as pollination or the medium to disseminate seeds.In addition, precursor of the carotenoid as vitamin A, There is very big nutritive value (Cuningham and Gantt 1998 to human and animal；Shumskaya and Wurtzel 2013).And the lutein (lutein) and luteole (zeaxanthin) in carotenoid are present in human and animal's eye In macular region, to human vision experience light variation have highly important effect (Handelman et al.1998).Root According to its structure feature, carotenoid can be divided into linear carotenoid and cyclisation carotenoid two major classes.For high Plant studies have shown that the metabolism of carotenoid originates in the synthesis of phytoene (phytoene), by related generation A series of dehydrogenations and the isomery for thanking to enzyme, form linear all-trans lycopene (lycopene).Using lycopene as substrate, kind Lycopene cyclase (lycopene cyclase) is responsible for the cyclisation of carotenoid, and different cyclases is in linear kind Lycopene both ends generate different rings, to first appear metabolism branch in Carotenoid Metabolism approach.Lycopene beta- Cyclase can form two β-rings in linear two terminal catalytics of lycopene, generate beta carotene (β- carotene).By lycopene beta cyclase and the successively effect of lycopene ε-cyclase, respectively in linear lycopene End form a β-ring and a ε-ring, generate alpha-carotene (α-carotene).(such as lettuce in a small number of floristics Lettuce, romaine lettuce), lycopene ε-cyclase has and can form a ε-ring in each end of linear lycopene, generates ε- Carrotene (ε-carotene).Lycopene ε-cyclase of most plants only can be in linear lycopene one end ε-ring is formed, δ-carrotene is generated.Studies have shown that the adverse circumstance that α-and β-carotenoid simultaneously participate in plant adapts to, and Play the role of completely different in response environment variation but is complementary to one another (Dall'Osto et al.2007).Therefore, smart Really regulation α -/β-carotenoid ratio is that plant copes with important adaptive reaction (the Krause et of continuous changing environment al.2004).Therefore, in the metabolism of carotenoid, the functional activity of different lycopene cyclases and its variation of expression It can control Carotenoid Metabolism and flow to the distribution of different branches, so that plant be made to adapt to different environment-stress.
Applicant early period studies have shown that generation can be metabolized in seaweed and accumulate two classes cyclisation carotenoid: α-class Carrotene (α-caroteniods) and β-carotenoid (β-carotenoids) mainly include specifically α-Hu Luo Bu Su, lutein (lutein), beta carotene and luteole (zeaxanthin) and several micro metabolic intermediates (Yang et al.2014).However, the correlative study of seaweed carotenoid metabolic pathway is also fewer at present, only apply Report of the person to Cartoene hydroxylase (PuCHY1) and Mang ox base Mang ox base diphosphate synthase (PuGGPS) in navel shape seaweed Road, there has been no any about lycopene ε-cyclase report.To using Porphyra yezoensis as PyLCYE in the seaweed species of representative Discovery and Function Identification be conducive to following improve containing for nutritional ingredients such as carotenoid in seaweed using technique for gene engineering It measures to improve the nutritive value of seaweed, and the content by improving terpene substances improves the taste and flavor of seaweed, thus whole The economic value of seaweed is improved on body.
Summary of the invention
The present invention provides a kind of lycopene ε-cyclase gene and its coding albumen and application, which is compiled Code lycopene ε-cyclase, to make that the carotenoid such as alpha-carotene and lutein can be synthesized and accumulated in seaweed.
A kind of lycopene ε-cyclase gene of the invention, its nucleotide sequence such as sequence table Seq ID No:1 institute Show.
A kind of lycopene ε-cyclase gene of the invention, its nucleotides sequence are classified as and sequence table SEQ ID NO:1 Nucleotide sequence has 80% or more homology and encodes the polynucleotide sequence of identical function protein.
A kind of lycopene ε of the invention-cyclase gene coding albumen, its amino acid sequence such as sequence table Seq Shown in ID No:2.
A kind of lycopene ε of the invention-cyclase gene coding albumen, its amino acid sequence is by sequence table Substitution, missing or addition and tool of the amino acid sequence described in Seq ID No:2 by one or several amino acid residues There is active amino acid sequence identical as amino acid residue sequence described in sequence table Seq ID No:2.
Lycopene ε-cyclase gene of the invention derives from Porphyra yezoensis (Pyropia yezoensis), entitled PyLCYE, the gene is referred to as PyLCYE below.
The lycopene ε-cyclisation enzyme source Porphyra yezoensis.
A kind of recombinant expression carrier, it includes gene of any of claims 1 or 2.
A kind of transformant, it includes the host cell containing recombinant expression carrier as claimed in claim 6.
A kind of transformant, its host are microorganism, plant or transgenic cell line.
A kind of application of lycopene ε-cyclase gene of the invention, it is used for seaweed carotenoid metabolic gene work Cheng Zhong.
Lycopene ε of the invention-cyclase gene (PyLCYE) acquisition modes are as follows:
One, the extraction of total serum IgE
It chooses Porphyra yezoensis (Pyropia yezoensis) and (comes from Jiangsu Prov. Inst. of Marine Aquatic Products's national level seaweed kind Matter library), it is extracted using RNAiso kit (Takara company) and obtains Porphyra yezoensis total serum IgE, through electrophoresis detection and ultraviolet spectrometry After photometer detection confirms the integrality, purity and concentration of RNA, saved in -80 DEG C；
Two, Porphyra yezoensis lycopene ε-cyclase gene (PyLCYE) clone
Use the total serum IgE of 1 μ g step 1 acquisition as the template of reverse transcription, according to SMARTer RACE cDNA Kit (Clontech) specification operation after reverse transcription synthesizes the first chain of cDNA, is used using SSRT-II reverse transcriptase Touchdown PCR program carries out nested PCR amplification, to obtain PyLCYE ORF overall length.
Wherein
5'-RACE the primer is as follows:
PyLCY2-ER1:ACCCGCAGGTAGGGGCGGTCGAGCACAA
PyLCY2-ER2:CGCGGTCACGTTTGCCCGTTCAATGACCAC
3'-RACE the primer is as follows:
PyLCY2-HF1:CCTCCAGGCCTCTAACCGCATCCGGGGG
PyLCY2-HF2:TGATCCGCTCGGTGCTGCCCCTGTGGCTG
PCR product is connected to pMD19-T (Takara company) carrier, obtaining after sequencing through splicing has complete coding region Porphyra yezoensis lycopene ε-cyclase gene PyLCYE ORF sequence Seq ID No:1.
Three, the building of coli expression carrier
The site that signal peptide in PyLCYE albumen is speculated with softwares such as TargetP and ChloroP, then with EcoR I Partial sequence and pMAL-C5X carrier is cloned into after the primer amplification PyLCYE amputation signal peptide of restriction enzyme site.
Primer sequence with EcoR I restriction enzyme site is as follows:
PyLCY2-pMAL-HF:
ccgcgatatcgtcgacggatccGCCACCAGCCGGTCGGCGGGGGC
PyLCY2-pMAL-HF:
tacctgcagggaattcggatccCTACTGCTGGTTCTCCCCCCGCTG
Wherein, the homology arm sequence that lowercase represents, capitalization is the gene order as primer, underscore part For the restriction enzyme site of introducing.
Four, enzyme activity is identified
By the expression vector pMAL-PyLCYE of step 3 acquisition and carry a series of uredo erwinia phage carotenoids The carrier pAC-LYC corotation of plain synthesis related gene CrtE (GGPS), CrtB (PSY) and CrtI (PDS/ZDS) enters Escherichia coli. The gene carried on carrier pAC-LYC can make the cell of Escherichia coli in the case where there is lycopene ε-cyclase activity ε-carrotene or in which product δ-carrotene (single ε-cyclisation) are accumulated, to make E. coli clones or bacterium solution in orange Color；If not having lycopene ε-cyclase activity, Escherichia coli are orange red.Empty carrier pMAL-C5X and pAC-LYC corotation are made For negative control.HPLC analyzes the product of each sample.
PyLCYE gene source of the invention is suitable for the biologies such as rice in navel shape seaweed, genetic engineering recipient plant.
Using the PyLCYE gene gene constructed plant expression vector as a purpose of this law invention, cauliflower flower can use Mosaic virus CAMV35S promoter, ethanol inducible promoter etc., it may be necessary to including enhancer.In order to simplify transformed plant Identification can be used selected marker (such as antibiotic enzyme).Ti-plasmids, Ri plasmid and phytopathy can be used in expression vector used Poisonous carrier etc..Method for transformation can convert plant with agrobacterium-mediated transformation or other methods.
Present invention firstly discovers that participating in an enzyme, that is, tomato in carotenogenesis metabolic pathway in seaweed species Red pigment ε-cyclase, and confirm that the enzyme participates in the metabolism of carotenoid in seaweed.
The present invention obtains the gene order for encoding the enzyme, to improve carotenoid generation in seaweed using technique for gene engineering It thanks to approach, is provided the foundation with improving the content of carotenoid and terpene substances in seaweed.
The PyLCYE gene and albumen provided through the invention carries out genetic engineering improvement, industry to seaweed species Value focuses on two aspects, first is that the nutritive value of seaweed is improved by the content for improving carotenoid in seaweed, To improve the economic value of seaweed.
Detailed description of the invention
Fig. 1 is the nucleotide and putative amino acid sequence of PyLCYE；Wherein, " * " represents terminator codon；
Fig. 2 is the Multiple Sequence Alignment of different plant species lycopene cyclase protein sequence, and marked region is conservative Ross Graceful folding (1), two cyclisation enzyme domains (2,3), two transmembrane helix structure domains (4,6) and with point structure domain (5), in box Region exists only in red algae lycopene cyclase sequence；
Fig. 3 is the HPLC analysis chart that PyLCYE is tested in Escherichia coli；Wherein, A: the absorption light of different carotenoid Spectrum；B:pMAL-C5X and pAC-LYC corotation is into Escherichia coli as negative control；C:pMAL-PyLCYE and pAC-LYC corotation is into big Enterobacteria；
Fig. 4 is the Phylogenetic analysis figure of lycopene cyclase in different plant species.
Specific embodiment
The content of present invention is not limited only to the content of the various embodiments described above, and the recombinant expression carrier containing gene of the present invention turns Gene cell system and host strain belong to protection scope of the present invention.
Embodiment 1
It is as follows that the gene of the PyLCYE of the present embodiment obtains process:
1) identification of Porphyra yezoensis PyLCYE transcript and code area clone
With the open reading frame (ORF) for encoding LCYE gene in arabidopsis, the homologous sequence in Porphyra yezoensis genome is searched for Column, searching method tblastx, interception e-value value are 1 × 10-10Possible homologous sequence is screened, only discovery one turns Record this contig_25259.The ORF of RACE primer amplification PyLCYE is designed according to the transcript gene order (shown in Fig. 1).
RNAiso reagent (Takara company) is selected to extract spot laver thallus total serum IgE, through electrophoresis detection and ultraviolet point Integrality, purity and the concentration of light photometer detection confirmation RNA, saves in -80 DEG C.Use 1 μ g total serum IgE as the mould of reverse transcription Plate carries out PCR amplification after reverse transcription synthesizes the first chain of cDNA, and PCR product is connected to pMAL-C5X after reaction and is carried Body, full length gene 1830bp encode protein sequence and a terminator codon containing 609 amino acid residues altogether, through dividing Analysis, in the signal peptide that the N-terminal of the albumen has one section of chloroplaset to position.By the protein sequence speculated with it is homologous in other species Lycopene cyclase multiple sequences alignments (shown in Fig. 2) illustrate the tomato red prime ring in PyLCYE obtained and other species It is homologous to change enzyme.
2) building of Porphyra yezoensis PyLCYE expression vector
The total serum IgE for using 1 μ g step 1) to obtain uses " the PrimeScript of Takara company as reverse transcription templateTM 1st Strand cDNA Synthesis Kit " kit reversion synthesis the first chain of cDNA.
According to the complete encoding sequence of the RACE PyLCYE obtained, speculate that it encodes albumen with ChloroP and TargetP Signal peptide sequence designs both ends primer and introduces EcoR I restriction endonuclease sites, after amplification PyLCYE amputation signal peptide Partial sequence (primer is synthesized by Genscript company).
The template of the total serum IgE for using 1 μ g step 2) to obtain as reverse transcription carries out after reverse transcription synthesizes the first chain of cDNA PCR amplification, PCR program are as follows: 94 DEG C of initial denaturation 2min；94 DEG C of denaturation 30s, 67 DEG C of annealing 1min, 72 DEG C of extension 1min, 35 After circulation, 72 DEG C of 10min.PCR product is connected to pMAL-C5X carrier after reaction, connection product converts Escherichia coli Screening positive clone after BL21 (DE3) competent cell obtains the recombinant vector for carrying PyLCYE, is named as pMAL-PyLCYE.
3) heterogenous expression and Function Identification of PyLCYE
It is transformed into e. coli bl21 (DE3) cell, is being contained with the carrier containing PyLCYE that step 2) is built Carboxylic benzyl mycin (50 μ gmL-1) LB-Agar culture medium on overnight incubation screening, choose single colonie and be transferred to containing same concentrations carboxylic benzyl 37 DEG C in the LB liquid medium of mycin, 200rpm shaken cultivation to OD600It is 0.4~0.6, isopropyl-beta D-thio half is added Lactoside (IPTG, 0.5mmolL-1) 3~4h of inducing expression.The albumen of expression is through SDS- polyacrylamide gel electrophoresis (PAGE, 10%) analysis.
Embodiment 2
The functional verification of PyLCYE is as follows:
In order to identify the function of PyLCYE, we use complementary colors using enzyme activity identification systems in Escherichia coli body Method combination HPLC enzyme analysis activity.The system uses plasmid pAC-LYC, which carries uredo erwinia phage class recklessly Radish element synthesis related gene Mang ox base Mang ox base diphosphate synthase (CrtE, GGPS), phytoene synthase (CrtB, PSY), phytoene desaturase (CrtI, PDS/ZDS), can accumulate tomato red in Bacillus coli cells Plain (orange red), the substrate as lycopene cyclase.It can be in large intestine bar in the case where there is lycopene ε-cyclase ε-carrotene or in which product δ-carrotene are synthesized and accumulated in bacterium cell, Escherichia coli are presented orange-yellow；And do not have Have in the case where lycopene ε-cyclase Escherichia coli be still it is orange red, can be easy to differentiate whether have lycopene ε- Enzyme activity is cyclized to exist.
4) by can with the pMAL-PyLCYE of normal expression and pAC-LYC with heat shock method corotation into e. coli bl21 (DE3) In bacterial strain.Using empty carrier pMAL-C5X and pAC-LYC corotation as negative control.The bacterial strain of corotation is in (the 50 μ gmL containing chloramphenicol-1) and carboxylic benzyl mycin (50 μ gmL-1) LB culture medium in cultivate.It selects yellow color colonies and is seeded to 5mL with chloramphenicol and carboxylic The LB liquid medium of parasiticin, 37 DEG C, 200rpm shaken cultivation stay overnight, take 200 μ L to be seeded to 20mL resistance LB culture medium Middle 200rpm shaken cultivation 3d, thalline were collected by centrifugation, finds the face of Escherichia coli in the sample containing Porphyra yezoensis PyLCYE Color is all in orange-yellow, and the negative control Escherichia coli containing empty carrier pMAL-C5X illustrate PyLCYE and have to urge in orange red Change lycopene ε-cyclisation activity, so that Bacillus coli cells be made to accumulate δ-carrotene.
5) pigment extracts and HPLC is analyzed
Coli somatic containing complex carries pAC-LYC and pMAL-C5X/pMAL-PyLCYE is centrifuged through 10,000g Ultrasonication after 1min is collected.The acetone of 400 μ L 80% is added into the material of ultrasonication, vibrates 30min acutely with thorough Contained pigment in material is extracted, 250 μ L ethyl acetate and ddH are then sequentially added2O acutely vibrates 15sec respectively, stands After 5min, 10,000g, 4 DEG C of centrifugation 5min.Supernatant is drawn, is dissolved in 100 μ L ethyl acetate with after being dried with nitrogen.Extracted color Plain reversed-phase high performance liquid chromatography (reverse-phase HPLC) method, in Spherisorb ODS2 C18 chromatographic column (Waters) it is separated on, chromatographic column is 4.6 × 250mm, and mobile phase is in acetonitrile: water: linearly being opened up in triethylamine (9:1:0.01) Open ethyl acetate (0-100%).Duration of run is 45min, flow velocity 1mLmin-1, 50 DEG C of column temperature.Detector scanning wavelength is 300~800nm.Select the scanning result of 296nm and 440nm.The identification of carotenoid is according to standard items or reported guarantor Time and absorption spectra is stayed to determine.All chemical reagent are chromatographically pure.Analysis structure shows to have accumulated δ-Hu Luo in sample Bu Su, and there is no δ-carrotene accumulation (Fig. 3) in negative control, lycopene can be catalyzed by further demonstrating PyLCYE ε-cyclisation generates δ-carrotene.
6) Phylogenetic Analysis
The type belonging to clone gene PyLCYE in order to determine, we retrieved the homologous sequence of PyLCYE in GenBank Column, and the lycopene cyclase sequence of different plants is taken according to forefathers' report and Phylogenetic analysis is carried out to it.Institute is orderly Column are compared with ClustalX, construct genealogical tree with the adjacent method in MEGA5.1 (Tamura et al., 2011).Weight is examined in bootstrapping Multiple 1,000 times for analyzing the reliability of each node.PyLCYE really belongs to the lycopene in plant as the result is shown for analysis ε-cyclase (shown in Fig. 4).
Sequence table
<110>Nanjing University
<120>a kind of lycopene ε-cyclase gene and its coding albumen and application
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1830
<212> DNA
<213>Porphyra yezoensis (Pyropia yezoensis)
<400> 1
atgcccccct ccgcggcctt cctgcccgtc cccccgcggg cgcccgccgc gggcgctgcc 60
gccgccgcgg gcacccgggc gccccggcgg ggctgccgac tacgcccgcg ggtgtcggtg 120
gtcgccacca gccggtcggc gggggcggac gcggtccggc cggcgcgggg ggtgtggcca 180
ccgcgcggcg cggccgccgc atcacccccc acccccaccc ccacccccac tcccgtggtc 240
accgtgtcag cggcagctgc gacagcgtcc tcgacggcgg cgccgaccgc ggcggtgccg 300
gtagcgccag cgacggcacc gtcggtggcc acggatccgg ctgctccccc gctccgcacc 360
tatgacgtga cggtcattgg gggtggaccg gcgggcctct ccctggccgc cgcccttggc 420
gccacgggcc tgagtgtggc cgccctcgac gctgccattg atgtgccgtg gcccaaccac 480
tatggtgtgt gggcagatga gtttgagccc ctcggcctgg ccgactgcgc cacctccacc 540
tacccgacca ccaccatcta tgtgccgtct gccgcaggtg ggggagcggg ggcggcgcct 600
gttgtgctcg accgccccta cctgcgggtg gaccgggtga agctcaaggc gcggctgctg 660
gagcggtgcg cagcgggagg ggtggtcatt gaacgggcaa acgtgaccgc ggtggatcac 720
agtagcgata ctcactcgac ggtgacattt gtggagggtc acccgcgccc atccacatcg 780
aggggggacg gcgcgggctc accaccaacc ccaccgtcgg cgcctgcacc acgacagctg 840
cggacgcggc tggttgtgga cgccactggt cacgcgctgc gatttgtaca gaccgcccca 900
ggctacagcc ccggcttcca ggccgcttat ggcattgagg cggttgttga gggccacccc 960
tttcctctcg acgagatgct gctgatggac tttcgggacg accacatgca gggggatgcg 1020
gccgatgtgg ctgcctcgtc ggcggcgccc accttcctct acgtctttcc cacagatagc 1080
aaccgggtct ttctggagga aacgtcgatc attttgcccg aagccatgcc atttgaaaca 1140
ctgcgggagc ggctgaacaa gcggcttgcc cacctgggcg tcaccgtcaa gttggtggtc 1200
gaggaggagt actcgctgat ccccctgggc gggtcggtgc cgctgctcgg ccagcgggtt 1260
gttggatttg gggggtctgc ctgcctcgtc cacccggcca cgggctacat ggttgcccgc 1320
acactgtcac tcgccgagtc gctcgcgggg gagattgcca ctgccttgcg gactcccgct 1380
gcagggacgt ctcgtcgggg atggggggcg aatgccgccg ccgccgccga cgcaccgcca 1440
ccgcccctgg cgcccgcgga cacggtggcg gccgccgcat gggcgcacct gtggtctgaa 1500
tcccgaatcc gcgagcggga ctttctcctc tttggcgccg acctcttggc gggcctggac 1560
ctgggggcga tgaaggagtt cttcgccgcc tttttccgcc tgccccaacc actgtgggcg 1620
ggcttcctca gctttcggct ggagcggccg agcgagcggg cgacgtttgc gtttgtcttt 1680
ttcctccagg cctctaaccg catccggggg gggctgctgc gggggattgt gacgacgggg 1740
cggtggaaac tgatccgctc ggtgctgccc ctgtggctgg cacggctggg cgactcttct 1800
cgcgaacagc ggggggagaa ccagcagtag 1830
<210> 2
<211> 609
<212> PRT
<213>Porphyra yezoensis (Pyropia yezoensis)
<400> 2
Met Pro Pro Ser Ala Ala Phe Leu Pro Val Pro Pro Arg Ala Pro Ala
1 5 10 15
Ala Gly Ala Ala Ala Ala Ala Gly Thr Arg Ala Pro Arg Arg Gly Cys
20 25 30
Arg Leu Arg Pro Arg Val Ser Val Val Ala Thr Ser Arg Ser Ala Gly
35 40 45
Ala Asp Ala Val Arg Pro Ala Arg Gly Val Trp Pro Pro Arg Gly Ala
50 55 60
Ala Ala Ala Ser Pro Pro Thr Pro Thr Pro Thr Pro Thr Pro Val Val
65 70 75 80
Thr Val Ser Ala Ala Ala Ala Thr Ala Ser Ser Thr Ala Ala Pro Thr
85 90 95
Ala Ala Val Pro Val Ala Pro Ala Thr Ala Pro Ser Val Ala Thr Asp
100 105 110
Pro Ala Ala Pro Pro Leu Arg Thr Tyr Asp Val Thr Val Ile Gly Gly
115 120 125
Gly Pro Ala Gly Leu Ser Leu Ala Ala Ala Leu Gly Ala Thr Gly Leu
130 135 140
Ser Val Ala Ala Leu Asp Ala Ala Ile Asp Val Pro Trp Pro Asn His
145 150 155 160
Tyr Gly Val Trp Ala Asp Glu Phe Glu Pro Leu Gly Leu Ala Asp Cys
165 170 175
Ala Thr Ser Thr Tyr Pro Thr Thr Thr Ile Tyr Val Pro Ser Ala Ala
180 185 190
Gly Gly Gly Ala Gly Ala Ala Pro Val Val Leu Asp Arg Pro Tyr Leu
195 200 205
Arg Val Asp Arg Val Lys Leu Lys Ala Arg Leu Leu Glu Arg Cys Ala
210 215 220
Ala Gly Gly Val Val Ile Glu Arg Ala Asn Val Thr Ala Val Asp His
225 230 235 240
Ser Ser Asp Thr His Ser Thr Val Thr Phe Val Glu Gly His Pro Arg
245 250 255
Pro Ser Thr Ser Arg Gly Asp Gly Ala Gly Ser Pro Pro Thr Pro Pro
260 265 270
Ser Ala Pro Ala Pro Arg Gln Leu Arg Thr Arg Leu Val Val Asp Ala
275 280 285
Thr Gly His Ala Leu Arg Phe Val Gln Thr Ala Pro Gly Tyr Ser Pro
290 295 300
Gly Phe Gln Ala Ala Tyr Gly Ile Glu Ala Val Val Glu Gly His Pro
305 310 315 320
Phe Pro Leu Asp Glu Met Leu Leu Met Asp Phe Arg Asp Asp His Met
325 330 335
Gln Gly Asp Ala Ala Asp Val Ala Ala Ser Ser Ala Ala Pro Thr Phe
340 345 350
Leu Tyr Val Phe Pro Thr Asp Ser Asn Arg Val Phe Leu Glu Glu Thr
355 360 365
Ser Ile Ile Leu Pro Glu Ala Met Pro Phe Glu Thr Leu Arg Glu Arg
370 375 380
Leu Asn Lys Arg Leu Ala His Leu Gly Val Thr Val Lys Leu Val Val
385 390 395 400
Glu Glu Glu Tyr Ser Leu Ile Pro Leu Gly Gly Ser Val Pro Leu Leu
405 410 415
Gly Gln Arg Val Val Gly Phe Gly Gly Ser Ala Cys Leu Val His Pro
420 425 430
Ala Thr Gly Tyr Met Val Ala Arg Thr Leu Ser Leu Ala Glu Ser Leu
435 440 445
Ala Gly Glu Ile Ala Thr Ala Leu Arg Thr Pro Ala Ala Gly Thr Ser
450 455 460
Arg Arg Gly Trp Gly Ala Asn Ala Ala Ala Ala Ala Asp Ala Pro Pro
465 470 475 480
Pro Pro Leu Ala Pro Ala Asp Thr Val Ala Ala Ala Ala Trp Ala His
485 490 495
Leu Trp Ser Glu Ser Arg Ile Arg Glu Arg Asp Phe Leu Leu Phe Gly
500 505 510
Ala Asp Leu Leu Ala Gly Leu Asp Leu Gly Ala Met Lys Glu Phe Phe
515 520 525
Ala Ala Phe Phe Arg Leu Pro Gln Pro Leu Trp Ala Gly Phe Leu Ser
530 535 540
Phe Arg Leu Glu Arg Pro Ser Glu Arg Ala Thr Phe Ala Phe Val Phe
545 550 555 560
Phe Leu Gln Ala Ser Asn Arg Ile Arg Gly Gly Leu Leu Arg Gly Ile
565 570 575
Val Thr Thr Gly Arg Trp Lys Leu Ile Arg Ser Val Leu Pro Leu Trp
580 585 590
Leu Ala Arg Leu Gly Asp Ser Ser Arg Glu Gln Arg Gly Glu Asn Gln
595 600 605
Gln
<210> 3
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
acccgcaggt aggggcggtc gagcacaa 28
<210> 4
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cgcggtcacg tttgcccgtt caatgaccac 30
<210> 5
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
cctccaggcc tctaaccgca tccggggg 28
<210> 6
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
tgatccgctc ggtgctgccc ctgtggctg 29
<210> 7
<211> 45
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
ccgcgatatc gtcgacggat ccgccaccag ccggtcggcg ggggc 45
<210> 8
<211> 46
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
tacctgcagg gaattcggat ccctactgct ggttctcccc ccgctg 46

Claims (9)

1. a kind of lycopene ε-cyclase gene, it is characterised in that its nucleotide sequence such as sequence table Seq ID No:1 institute Show.
2. a kind of lycopene ε-cyclase gene, it is characterised in that its nucleotides sequence is classified as and sequence table SEQ ID NO:1 Nucleotide sequence has 80% or more homology and encodes the polynucleotide sequence of identical function protein.
3. a kind of lycopene ε-cyclase gene coding albumen, it is characterised in that its amino acid sequence such as sequence table Seq Shown in ID No:2.
4. a kind of lycopene ε-cyclase gene coding albumen, it is characterised in that its amino acid sequence is by sequence table Substitution, missing or addition and tool of the amino acid sequence described in Seq ID No:2 by one or several amino acid residues There is active amino acid sequence identical as amino acid residue sequence described in sequence table Seq ID No:2.
5. lycopene ε according to claim 1,2,3 or 4-cyclase gene coding albumen, it is characterised in that tomato Red pigment ε-cyclisation enzyme source Porphyra yezoensis.
6. a kind of recombinant expression carrier, it is characterised in that it includes gene of any of claims 1 or 2.
7. a kind of transformant, it is characterised in that it includes the host cell containing recombinant expression carrier as claimed in claim 6.
8. a kind of transformant according to claim 7, it is characterised in that its host is that microorganism, plant or transgenosis are thin Born of the same parents system.
9. a kind of application of lycopene ε-cyclase gene, it is characterised in that it is used for seaweed carotenoid metabolic gene work Cheng Zhong.
CN201910807944.2A 2019-08-29 2019-08-29 A kind of lycopene ε-cyclase gene and its coding albumen and application Pending CN110423765A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910807944.2A CN110423765A (en) 2019-08-29 2019-08-29 A kind of lycopene ε-cyclase gene and its coding albumen and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910807944.2A CN110423765A (en) 2019-08-29 2019-08-29 A kind of lycopene ε-cyclase gene and its coding albumen and application

Publications (1)

Publication Number Publication Date
CN110423765A true CN110423765A (en) 2019-11-08

Family

ID=68418008

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910807944.2A Pending CN110423765A (en) 2019-08-29 2019-08-29 A kind of lycopene ε-cyclase gene and its coding albumen and application

Country Status (1)

Country Link
CN (1) CN110423765A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111454976A (en) * 2020-03-17 2020-07-28 深圳大学 Transgenic chlamydomonas for improving lutein content of chlamydomonas reinhardtii as well as construction method and application of transgenic chlamydomonas
CN111518779A (en) * 2020-05-08 2020-08-11 沈阳药科大学 Oxazole cyclase gene and coding protein and application thereof
CN113549639A (en) * 2021-07-21 2021-10-26 云南中烟工业有限责任公司 Regulatory gene for reducing content of total protein and smoke phenol in tobacco leaves

Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1558953A (en) * 2001-09-26 2004-12-29 维塔特内有限公司 Biosynthetic genes of blakeslea trispora beta-carotene that code for lycopene cyclase/phytoene synthase (carRP) and phytoene dehydrogenase (carB)
CN1668754A (en) * 2002-05-14 2005-09-14 马泰克生物科学公司 Carotene synthase gene and uses therefor
CN1670211A (en) * 2005-02-22 2005-09-21 华南理工大学 Gene for coding lycopene beta cyclase(Lyc-B) of Dunaliella salina
WO2011028120A1 (en) * 2009-09-04 2011-03-10 Wageningen Universiteit Method for increasing the level of zeaxanthin in a plant line, method for selecting a plant or part thereof, including a seed and tuber, and use thereof
CN104152475A (en) * 2014-08-18 2014-11-19 中国烟草总公司郑州烟草研究院 Tobacco epsilon-lycopene cyclase gene and its application
CN105255926A (en) * 2015-11-25 2016-01-20 天津大学 Wolfberry lycopene epsilon-cyclase gene and recombinant vector comprising gene
WO2016154314A1 (en) * 2015-03-23 2016-09-29 Arch Innotek, Llc Compositions and methods of biosynthesizing carotenoids and their derivatives
US20180105839A1 (en) * 2016-10-18 2018-04-19 Arch Innotek, Llc Compositions and methods of biosynthesizing xanthophylls
CN110423766A (en) * 2019-08-29 2019-11-08 南京大学 A kind of lycopene beta cyclase gene and its coding albumen and application

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1558953A (en) * 2001-09-26 2004-12-29 维塔特内有限公司 Biosynthetic genes of blakeslea trispora beta-carotene that code for lycopene cyclase/phytoene synthase (carRP) and phytoene dehydrogenase (carB)
CN1668754A (en) * 2002-05-14 2005-09-14 马泰克生物科学公司 Carotene synthase gene and uses therefor
CN1670211A (en) * 2005-02-22 2005-09-21 华南理工大学 Gene for coding lycopene beta cyclase(Lyc-B) of Dunaliella salina
WO2011028120A1 (en) * 2009-09-04 2011-03-10 Wageningen Universiteit Method for increasing the level of zeaxanthin in a plant line, method for selecting a plant or part thereof, including a seed and tuber, and use thereof
CN104152475A (en) * 2014-08-18 2014-11-19 中国烟草总公司郑州烟草研究院 Tobacco epsilon-lycopene cyclase gene and its application
WO2016154314A1 (en) * 2015-03-23 2016-09-29 Arch Innotek, Llc Compositions and methods of biosynthesizing carotenoids and their derivatives
CN105255926A (en) * 2015-11-25 2016-01-20 天津大学 Wolfberry lycopene epsilon-cyclase gene and recombinant vector comprising gene
US20180105839A1 (en) * 2016-10-18 2018-04-19 Arch Innotek, Llc Compositions and methods of biosynthesizing xanthophylls
CN110423766A (en) * 2019-08-29 2019-11-08 南京大学 A kind of lycopene beta cyclase gene and its coding albumen and application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
WANG,S. ET AL.: "lycopene epsilon-cyclase [Ahnfeltiopsis flabelliformis] GenBank: AUE44515.1", 《GENBANK》 *
XIE,X. ET AL.: "lycopene beta cyclase [Pyropia yezoensis] GenBank: QJT93737.1", 《GENEBANK》 *
XIE,X. ET AL.: "Pyropia yezoensis lycopene beta cyclase mRNA, complete cds GenBank: MK704399.1", 《GENEBANK》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111454976A (en) * 2020-03-17 2020-07-28 深圳大学 Transgenic chlamydomonas for improving lutein content of chlamydomonas reinhardtii as well as construction method and application of transgenic chlamydomonas
CN111454976B (en) * 2020-03-17 2022-11-01 深圳大学 Transgenic chlamydomonas for improving lutein content of chlamydomonas reinhardtii as well as construction method and application of transgenic chlamydomonas
CN111518779A (en) * 2020-05-08 2020-08-11 沈阳药科大学 Oxazole cyclase gene and coding protein and application thereof
CN111518779B (en) * 2020-05-08 2022-03-11 沈阳药科大学 Oxazole cyclase gene and coding protein and application thereof
CN113549639A (en) * 2021-07-21 2021-10-26 云南中烟工业有限责任公司 Regulatory gene for reducing content of total protein and smoke phenol in tobacco leaves
CN113549639B (en) * 2021-07-21 2022-07-29 云南中烟工业有限责任公司 Regulatory gene for reducing contents of total proteins and phenol in flue gas of tobacco leaves

Similar Documents

Publication Publication Date Title
Ahrazem et al. Carotenoid cleavage oxygenases from microbes and photosynthetic organisms: features and functions
Ahrazem et al. The expression of a chromoplast-specific lycopene beta cyclase gene is involved in the high production of saffron's apocarotenoid precursors
CN110423765A (en) A kind of lycopene ε-cyclase gene and its coding albumen and application
Li et al. Isolation and characterization of a R2R3-MYB transcription factor gene related to anthocyanin biosynthesis in the spathes of Anthurium andraeanum (Hort.)
Ahrazem et al. Evolutionarily distinct carotenoid cleavage dioxygenases are responsible for crocetin production in Buddleja davidii
Sankari et al. Prospects and progress in the production of valuable carotenoids: Insights from metabolic engineering, synthetic biology, and computational approaches
Dautermann et al. A functional zeaxanthin epoxidase from red algae shedding light on the evolution of light‐harvesting carotenoids and the xanthophyll cycle in photosynthetic eukaryotes
Sams et al. Selenium regulates gene expression for glucosinolate and carotenoid biosynthesis in Arabidopsis
Blatt et al. A lycopene β‐cyclase/lycopene ε‐cyclase/light‐harvesting complex‐fusion protein from the green alga Ostreococcus lucimarinus can be modified to produce α‐carotene and β‐carotene at different ratios
CN111100849A (en) Tea tree carotenoid-splitting dioxygenase CsCCD4 and application thereof in catalytic synthesis of β -ionone
CN110423766A (en) A kind of lycopene beta cyclase gene and its coding albumen and application
Liang et al. Induction of carotenoid cleavage by salt stress and the effect of their products on cell growth and pigment accumulation in Dunaliella sp. FACHB-847
He et al. The R2R3-MYB transcription factor MYB44 modulates carotenoid biosynthesis in Ulva prolifera
Shen et al. Isolation and expression of McF3H gene in the leaves of crabapple
CN101636492A (en) Dayflower flavonoid 3&#39;,5&#39;-hydroxylase gene
Araya-Garay et al. cDNA cloning of a novel gene codifying for the enzyme lycopene β-cyclase from Ficus carica and its expression in Escherichia coli
Sabir et al. Identification and comprehensive genome-wide analysis of glutathione S-transferase gene family in sweet cherry (Prunus avium) and their expression profiling reveals a likely role in anthocyanin accumulation
Wang et al. Functional identification of anthocyanin glucosyltransferase genes: a Ps3GT catalyzes pelargonidin to pelargonidin 3-O-glucoside painting the vivid red flower color of Paeonia
CN112831507A (en) Gene causing color change of cotton corolla and identification method thereof
Rosas-Saavedra et al. Putative Daucus carota capsanthin-capsorubin synthase (DcCCS) possesses lycopene β-cyclase activity, boosts carotenoid levels, and increases salt tolerance in heterologous plants
CN114450404A (en) C-glycosidase gene derived from buckwheat and use thereof
CN104694557B (en) A kind of Mang ox base Mang ox base diphosphate synthase genes and its encoding proteins and application
Shang et al. Identification of interacting proteins of transcription factor DpAP2 related to carotenoid biosynthesis from marine microalga Dunaliella parva
Liu et al. Cloning and functional characterization of chalcone isomerase genes involved in anthocyanin biosynthesis in Clivia miniata
Yang et al. Characterization and expression analysis of a chalcone isomerase-like gene in relation to petal color of Actinidia chrysantha

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20191108

RJ01 Rejection of invention patent application after publication