CN110273017B - Primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof - Google Patents
Primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof Download PDFInfo
- Publication number
- CN110273017B CN110273017B CN201910739671.2A CN201910739671A CN110273017B CN 110273017 B CN110273017 B CN 110273017B CN 201910739671 A CN201910739671 A CN 201910739671A CN 110273017 B CN110273017 B CN 110273017B
- Authority
- CN
- China
- Prior art keywords
- bacillus subtilis
- primer
- loop
- reaction
- lamp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer for detecting bacillus subtilis by a loop-mediated isothermal amplification method, which is used for detecting bacillus subtilisgyrAGenes andgyrBthe gene is obtained by designing a target sequence, wherein the primer comprises a group of outer primers F3/B3, a group of inner primers FIP/BIP and a group of loop primers LF/LB. The invention also discloses application of the primer in detection of bacillus subtilis. Experiments prove that the 3 groups of LAMP primers have strong specificity, and the sensitivity is at least one order of magnitude higher than that of the conventional method in a comparison test. The detection process of the invention is only carried out under the condition of constant temperature water bath, an expensive temperature change instrument is not needed, the result can be judged by naked eyes or by adding a simple indicating reagent, the reaction time is less than 40 minutes, the detection period is shorter, and the experiment cost is lower.
Description
Technical Field
The invention belongs to the technical field of bacillus subtilis detection or identification in microbial fertilizers, and relates to a primer for quickly detecting bacillus subtilis by using loop-mediated isothermal amplification (LAMP) technology and application thereof.
Background
At present, the detection methods for bacteria mainly comprise a bacteria separation culture identification method, an immunological detection method and a molecular biological method.
The bacteria isolation culture identification method is to culture the bacteria obtained by separation by using a liquid culture medium, a semi-solid culture medium or a solid culture medium and diagnose the microorganisms by physiological biochemistry and dyeing microscopy. The identification method has the defects that the test period is long, the isolation and culture of microorganisms generally need 2 days, and the time required for identification is about one week. Therefore, such methods cannot be adapted to the current rapid, accurate diagnostic market needs.
The principle of the immunological detection method is that a precipitated complex is formed by antigen-antibody binding, and the method is a serological method for detection based on the principle of specific binding of antigen and antibody. The method has the disadvantages that reagents required in the detection process are very expensive, and the specificity is different according to different target microorganisms, so that false positive is easy to occur.
Molecular biology is the subject of studying the material basis of life phenomena at the molecular level. The method is commonly applied to methods for detecting microorganisms, such as nucleic acid gel electrophoresis experiments, nucleic acid molecule hybridization experiments, nucleic acid in-vitro amplification experiments and the like. This method has a disadvantage in that expensive temperature-variable reaction equipment and detection instruments are required. It is difficult to achieve full coverage for the base layer.
Bacillus subtilis (A), (B) and (C)Bacillus subtilis) The bacillus subtilis is one of bacillus, is widely distributed in soil and putrefactive organic matters, and is easy to propagate in the bacillus subtilis extract, so the bacillus subtilis is obtained. The bacillus subtilis is a beneficial bacterium, has the advantages of environmental friendliness, safety to grain crops, no harm to people and livestock and the like, and is widely concerned and deeply researched by people. The bacillus subtilis has a developed secretion system and strong environmental adaptability, and is widely applied to the fields of agriculture, aquaculture, human probiotics and the like. The bacillus subtilis has antagonistic performance to various pathogenic bacteria, and can be used for preventing and treating various plant diseases in agricultural production, such as pepper anthracnose, rice sheath blight and diseases caused by some fusarium.
The bacillus subtilis is widely applied to biological fertilizers. When it acts on crops or soil, it can colonize in the rhizosphere or body of crops and play a special fertilizer role. At present, the microbial fertilizer shows irreplaceable effects in the aspects of fertilizing soil fertility, improving the utilization rate of the fertilizer, inhibiting the absorption of nitrate nitrogen, heavy metals and pesticides by crops, purifying and repairing soil, reducing crop diseases, promoting the decomposition and utilization of crop straws and municipal waste, improving the quality of crop products, improving food safety and the like.
The detection of the bacillus subtilis is divided into a conventional detection method and a rapid detection method. The conventional detection method comprises the steps of bacteria enrichment culture, separation and purification, and identification through colony morphology observation, gram staining microscopy, physiological and biochemical experiments and the like. The rapid detection method is to use PCR technology, immunological technology and enzyme reaction for rapid detection. The method for rapid detection has the advantages of various specific operation methods, high detection speed, high sensitivity, reliability and accuracy, but the sample preparation is difficult, the requirement on the level of an instrument required in the detection process is high, and the reagent is expensive.
The selection of the target gene is one of the important factors for LAMP detection. The target gene region commonly used in general PCR is the 16S rRNA or 18S rRNA region. However, the similarity of the 16S region is high for Bacillus, and the Bacillus subtilis cannot be accurately judged only by the region. Especially, the similarity of the 16SrRNA genes of the bacillus subtilis, the bacillus amyloliquefaciens and the like is 100 percent, so that in daily agriculture, aquaculture and other detection, colonies are observed only by the experience of experimenters to distinguish and identify, and great detection errors and deviations are caused. The rapid detection of some pathogenic bacteria, bacillus cereus, clostridium and the like by using a loop-mediated isothermal amplification (LAMP) technology is reported, for example, in the patent preparation and use method of a clostridium perfringens rapid detection kit (publication No. CN 101200761A), the kit and the method for rapidly detecting clostridium perfringens are invented by using the LAMP technology; a kit and a method for detecting pseudomonas aeruginosa by a loop-mediated isothermal amplification method (publication No. CN 101392289A) are the invention and the application of an LAMP detection technology aiming at the pseudomonas aeruginosa; a method and primers for detecting food-borne bacillus cereus by using a loop-mediated isothermal amplification technology (publication No. CN 107475401A) invents a method and primers for detecting food-borne bacillus cereus by using a LAMP technology. But there are few reports about the development and application of related LAMP technology of Bacillus subtilis.
Disclosure of Invention
Aiming at the defects in the detection of the bacillus subtilis in the prior art, the invention aims to provide a primer for quickly detecting the bacillus subtilis by using a loop-mediated isothermal amplification (LAMP) technology and application thereof.
The primer for detecting the bacillus subtilis by the loop-mediated isothermal amplification method is the primer for detecting the bacillus subtilisgyrAGenes andgyrBthe gene is obtained by designing a target sequence.gyrAGenes andgyrBthe gene is a gene sequence existing in various bacteria such as bacillus and the like, is a conserved gene responsible for coding a target enzyme DNA gyrase, has a variation rate of more than 16S rRNA, and is suitable for identification among bacterial species and can reflect the evolutionary relationship among the species. Of Bacillus subtilisgyrAGenes andgyrBthe gene has obvious difference in base similarity and can be used as a target gene for rapid identification of bacillus subtilis. The method is characterized in that: the primers comprise a group of outer primers F3/B3, a group of inner primers FIP/BIP and a group of loop primers LF/LB; the nucleotide sequences are respectively shown as follows:
F3：5’- GCGATTATTCCAGTCACGG -3’；
B3：5’-CGTTTTTCGTTCCAATGATGA-3’；
FIP：5’-CGAATTGAGATAGCGATGTTCGTTTATGCGGAGCTTTACCTCT-3’；
BIP：5’-ATATCCGCAACAATGGTCTAATTGCTGTTTTGTGCCGTCAGTC-3’；
LF：5’-ACCCCATGCTTTGTAGTGAAGA-3’；
LB：5’-TGAAGATGATGAACTGATGGGTG-3’。
the bacillus subtilis belongs to the bacillus genus, which comprises various strains such as bacillus amyloliquefaciens, bacillus licheniformis, bacillus megaterium, paenibacillus mucilaginosus, bacillus pumilus and the like. Bacillus subtilis is not highly conserved in the 16S region. Through comparison research, the applicant finds that the bacillus subtilis has the advantages ofgyrAGenes andgyrBthe gene is a highly conserved region, so that the conserved sequence (the nucleotide sequence of the targeting DNA is shown as SEQ ID No. 1) is suitable for specifically detecting the bacillus subtilis. Further, the applicants have designed the loop-mediated sequences of the present invention against the conserved sequencesThe primers for detecting the bacillus subtilis by an isothermal amplification method (LAMP) are determined to have the best detection effect through a plurality of sets of primer optimization experiments.
The invention discloses application of a primer for detecting bacillus subtilis by a loop-mediated isothermal amplification method in detecting the bacillus subtilis.
The method for detecting the bacillus subtilis by using the primers and adopting the loop-mediated isothermal amplification technology comprises the following steps: extracting DNA of a sample to be detected, and performing LAMP reaction by using the primer by taking the DNA as a template; and identifying the reaction product, and judging whether the sample to be detected contains the bacillus subtilis or not.
Specifically, the method for detecting the bacillus subtilis by using the primer comprises the following steps:
(1) extracting genome DNA of a sample to be detected;
(2) establishing a loop-mediated isothermal amplification (LAMP) reaction system for reaction: adding the external primer F3/B3, the inner primer FIP/BIP and the loop primer LF/LB into the DNA extracted in the step (1) as a template for LAMP amplification, adding LAMP reaction mixed liquid, and reacting at the temperature of 61-65 ℃;
(3) and (3) judging a reaction result: judging by adopting a fluorescent dye visual inspection method or a real-time turbidity detection method; the judgment method of the fluorescent dye visual observation method comprises the following steps: after the LAMP reaction is finished, adding 1.0 mu L of a color developing agent SYBR Green I into an amplification product of the LAMP reaction, and observing the judgment of Green fluorescence as positive in a color development result, namely existence of bacillus subtilis, and orange or orange as negative in color development result, namely existence of bacillus subtilis; the real-time turbidity detection method comprises the following steps: and observing whether the amplified product is white turbid or not, wherein the judgment that the amplified product is white turbid is positive, namely bacillus subtilis exists, and the judgment that the amplified product is white turbid is negative, namely the amplified product is not white turbid.
In the above application, the total volume of the loop-mediated isothermal amplification (LAMP) reaction system in the step (2) is preferably 20 μ L; comprises 0.2 mu M outer primer F3/B3, 1.6 mu M inner primer FIP/BIP and 0.4 mu M loop primer LF/LB, 10 mu L LAMP reaction mixed liquor, 2.0 mu L DNA template and the balance of sterilized ultrapure water.
Wherein the LAMP reaction mixture is a commercially available product (manufacturer: Ningbo-ao Biopsis Co., Ltd.) and contains, as main components, 20 mmol/L Tris-HCl (pH 8.8) and 6.5 mmol/L MgSO4, 10 mmol/L KCl, 10mmol/L(NH4)2SO40.1% Triton X-100, 1.6 mol/L betaine, 1.4 mmol/L dNTPs, Bst DNA polymerase 8U.
In the above application, the reaction temperature in the step (2) is preferably 65 ℃.
In the above application, the reaction time in the step (2) is 30-50 min.
Wherein, the reaction time in the step (2) is preferably 35 min.
The invention utilizes the basic steps of the loop-mediated isothermal expansion technology, selects 3 pairs of specific primers aiming at the specificity of a target gene, calibrates 6 regions of a genome to be detected, and utilizes strand displacement DNA polymerase to maintain for a certain time under the constant temperature condition to complete the nucleic acid amplification reaction. Aiming at the problems that the identification of the bacillus subtilis in the prior art is mainly based on morphological characteristics, the method is long in time consumption, complicated in procedure and low in accuracy, and the existing PCR molecular detection needs to depend on expensive instruments, and the like, a primer for detecting the bacillus subtilis by using a loop-mediated isothermal amplification method and application thereof are provided.
Compared with the prior art, the invention has the advantages and positive effects that:
1. the specificity is stronger: the present invention is directed togyrAGenes andgyrBthe gene provides 3 groups of specific LAMP primers, and has strong specificity. And the LAMP detection method of the bacillus subtilis is established, the bacillus subtilis can be detected, other bacteria are not detected, and the multiple test results are consistent, which shows that the LAMP detection method of the invention has strong specificity and reliable results.
2. The sensitivity is better: the sensitivity of the molecular biology detection method is the highest in the traditional separation culture identification of bacteria, the pathological histology diagnosis method, the immunological detection method and the traditional molecular biology detection method, and the sensitivity of the invention is at least one order of magnitude higher in the polymerase chain reaction of the contrast test in shorter reaction time.
3. The cost is low: the detection process of the method is carried out under the condition of constant-temperature water bath, an expensive temperature-changing instrument is not needed, the judgment can be carried out by naked eyes or by adding a simple indicating reagent when the result is judged, and the experiment cost is lower than that of other methods.
4. And (3) fast: in common detection methods, the conventional culture method has the longest detection period, and the molecular biology method has the shorter period, and the method is also one of molecular biology, and keeps the characteristic of short rapid period of molecular biology diagnosis. When observed, the time taken is shorter than that of the conventional molecular biology, the conventional polymerase chain reaction takes about 2 hours to complete, and the reaction time of the method is less than 40 minutes, and the detection period is shorter.
Drawings
FIG. 1 shows the results of fluorescence intensity measurements of different primers.
FIG. 2 shows the results of fluorescence intensity measurements at different temperatures in examples 1 to 3.
FIG. 3 shows the fluorescence intensity detection results of different strains of the primer pair of the present invention.
Wherein: the reference numerals 1 to 13 represent 4 strains of Bacillus subtilis in sequence (B. subtilis168、B. subtilisBS-1、B. subtilisBS-2、B. subtilisWB 800), Bacillus mucilaginosus, Bacillus amyloliquefaciens, Bacillus laterosporus, Bacillus polymyxa, Bacillus pumilus, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus megaterium, and Bacillus thuringiensis; NC is sterile water.
FIG. 4 shows the results of the sensitivity test of the primers of the present invention.
Wherein: NC: negative control, using sterile water as template; 1 to 8 are expressed in terms of concentration 2.73X 10, respectively2、5.46×101、1.09×101、2.18、4.36×10-1、8.72×10-2、1.7×10-2、3.48×10-3ng•µL-1DNA is used as a template.
FIG. 5 is a schematic view of the LAMP reaction of the present invention followed by visual observation.
Wherein: a is a result photo of a fluorescent dye visual inspection method (after adding SYBR Green I, the positive reaction tube is Green, and the negative reaction tube is unchanged in color), and b is a result photo of a real-time turbidity detection method (the positive reaction tube is visible to be white precipitate, and the reaction solution of the negative reaction tube is clear).
Detailed Description
In order that the above objects, features and advantages of the present invention may be more clearly understood, the present invention will be further described with reference to specific embodiments. It should be noted that the embodiments and features of the embodiments of the present application may be combined with each other without conflict.
In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, however, the present invention may be practiced in other ways than those specifically described herein, and thus the present invention is not limited to the specific embodiments of the present disclosure.
Example 1
Extracting genome DNA of a sample to be detected, taking the extracted DNA as a template, adding an external primer F3/B3, an internal primer FIP/BIP and a loop primer LF/LB to perform LAMP amplification, wherein the total volume of an LAMP detection reaction system is 20 mu L, the LAMP detection reaction system comprises 0.2 mu M of external primer F3/B3, 1.6 mu M of internal primer FIP/BIP and 0.4 mu M of loop primer LF/LB, 10 mu L of LAMP reaction mixed liquid and 2.0 mu L of DNA template, and the 20 mu L of DNA template is complemented by sterilized ultrapure water. Reacting at 65 ℃ for 35min, and detecting the reaction result.
Example 2
Extracting genome DNA of a sample to be detected, taking the extracted DNA as a template, adding an outer primer F3/B3, an inner primer FIP/BIP and a loop primer LF/LB to carry out LAMP amplification, wherein the total volume of an LAMP detection reaction system is 20 mu L, the LAMP detection reaction system comprises 0.2 mu M of outer primer F3/B3, 1.6 mu M of inner primer FIP/BIP and 0.4 mu M of loop primer LF/LB, 10 mu L of LAMP reaction mixed liquid and 2.0 mu L of DNA template, and the 20 mu L of the LAMP detection reaction mixed liquid is supplemented with sterilized ultrapure water. The reaction was carried out at 61 ℃ for 30min, and then the reaction results were examined.
Example 3
Extracting genome DNA of a sample to be detected, taking the extracted DNA as a template, adding an external primer F3/B3, an internal primer FIP/BIP and a loop primer LF/LB to perform LAMP amplification, wherein the total volume of an LAMP detection reaction system is 20 mu L, the LAMP detection reaction system comprises 0.2 mu M of external primer F3/B3, 1.6 mu M of internal primer FIP/BIP and 0.4 mu M of loop primer LF/LB, 10 mu L of LAMP reaction mixed liquid and 2.0 mu L of DNA template, and the 20 mu L of DNA template is complemented by sterilized ultrapure water. Reacting at 63 ℃ for 60min, and detecting the reaction result.
The primers for detecting Bacillus subtilis by using the loop-mediated isothermal amplification technology in the above examples 1-3, namely, the nucleotide sequences of the outer primer F3/B3, the inner primer FIP/BIP and the loop primer LF/LB, are as follows:
F3：5’- GCGATTATTCCAGTCACGG -3’；
B3：5’-CGTTTTTCGTTCCAATGATGA-3’；
FIP：5’-CGAATTGAGATAGCGATGTTCGTTTATGCGGAGCTTTACCTCT-3’；
BIP：5’-ATATCCGCAACAATGGTCTAATTGCTGTTTTGTGCCGTCAGTC-3’；
LF：5’-ACCCCATGCTTTGTAGTGAAGA-3’；
LB：5’-TGAAGATGATGAACTGATGGGTG-3’。
the LAMP reaction mixture in examples 1 to 3 was commercially available (manufacturer: Ningbo-ao Bio Inc., for example), and its main components were 20 mmol/L Tris-HCl (pH 8.8), 6.5 mmol/L MgSO4, 10 mmol/L KCl, 10mmol/L(NH4)2SO40.1% Triton X-100, 1.6 mol/L betaine, 1.4 mmol/L dNTPs, Bst DNA polymerase 8U.
The results of real-time fluorescence intensity detection of examples 1-3 are shown in FIG. 2. from the results of FIG. 2, it can be seen that the reaction time of the present invention is shorter than that of the conventional molecular biology, the conventional polymerase chain reaction takes about 2 hours to complete, but the reaction time of the present method is less than 40 minutes, and the detection period is greatly shortened.
Comparison with conventional biological methods
1. And (5) primer comparison.
As shown in FIG. 1, 6 sets of LAMP specific primers were designed, and LAMP reaction was performed under the same conditions using the genome of the same strain of Bacillus subtilis as a template. Fluorescence intensity was monitored in real time by fluorescent quantitative PCR.
The primers of the ID311 group, which can achieve the maximum copy number in the shortest time, were optimally selected.
Under the condition that the reaction conditions, temperature and other factors in example 1 are kept unchanged, the LAMP reaction is carried out by changing the types of primers (each primer sequence is as follows) and using the genome of the same strain of Bacillus subtilis as a template under the same conditions. According to the detection result, the primer fluorescence quantitative PCR real-time monitoring has the strongest fluorescence intensity under the same condition.
Summary of the primer sequences used in the comparative examples:
（1）ID4
F3: GCATTGCGGTAGGTATGGC；
B3: CTTTTGCCCGGATCGTGAT；
FIP: GTCCGGATTCTCACTGACAGCACAAACATTCCTCCGCACCA；
BIP: TCCAGGACCTGATTTCCCGACTCCTCGGCCTGATTCGTATG；
LF: TCCGTCAATGATTTCTCCCAGC；
LB: TTGGGCCGCAGCGGTAT。
（2）ID7
F3: CAAACATTCCTCCGCACCA；
B3: ACCCGAAGATGTTTGTTCGA；
FIP: AGTCGGGAAATCAGGTCCTGGACGGAGTACTTGCTGTCAGTG；
BIP: GTCAAATCTTGGGCCGCAGCCAGCTTTTGCCCGGATCG；
LF: TGGAATGGTAATGTCCGGATTCT；
LB: CCGGAAAGCATACGAATCAGGCC。
（3）ID3
F3: CGTCCTGCGGTAGAAGTCA；
B3: TGATCCGTTTCGCCAATGA；
FIP: CGCACCTACACCGTGTAATCCTTTATGACGGTGCTTCATGCC；
BIP: TTGATGTGACGGTTCACCGTGAAGGTCTGTAACCGGAACTCC；
LF: CGCTTCCGTCAAATTTTCCTCC；
LB:CGGTAAAATTCACCGCCAAACCTA。
（4）ID9
F3: AATTTGACGGAAGCGGCTAT；
B3: CCGGGACAAAATGTGTCGT；
FIP: GTCACGGTGAACCGTCACATCAGATTACACGGTGTAGGTGCG；
BIP: CACCGCCAAACCTATAAACGCGCTGTATGATCCGTTTCGCCA；
LF: TCTGTTGATAGTGCGTTTACGAC；
LB: GAGTTCCGGTTACAGACCTTGAAAT。
（5）ID104
F3: AGGTTTAATTGAACAATTCTCAC；
B3: CAGTACGTCTTTCATCGTTAA；
FIP: CAAGAGACTGGTATTCTTCTTCGATCACAAGCGATCCTTGACA；
BIP: ATTGCAGAGCTAAAAGACATCTTGGGCTCTTTGATTTCCGTGAG；
LF: CGTTAAACGCTGGAGCCTCA；
LB: AGTGCTTGAGATCATTCGTGAAG。
（6）ID311
F3: GCGATTATTCCAGTCACGG；
B3: CGTTTTTCGTTCCAATGATGA；
FIP: CGAATTGAGATAGCGATGTTCGTTTATGCGGAGCTTTACCTCT；
BIP: ATATCCGCAACAATGGTCTAATTGCTGTTTTGTGCCGTCAGTC；
LF: ACCCCATGCTTTGTAGTGAAGA；
LB: TGAAGATGATGAACTGATGGGTG。
2. and (5) primer specificity comparison.
Using the procedure and the condition parameters of example 1, respectivelyBacillus subtilis168. The DNA of Bacillus subtilis production strain-1, Bacillus subtilis production strain-2, Bacillus subtilis production strain-3, Bacillus mucilaginosus, Bacillus amyloliquefaciens, Bacillus laterosporus, Paenibacillus polymyxa, Bacillus pumilus, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus megaterium and Bacillus thuringiensis is used as a template (reference numerals 1-13 in figure 3), and sterile water (NC) is used as a template as a blank control. NC: negative control, using sterile water as template; 1 to 13 represent the following formulae B.168, cz-6, respectively,Factory bacillus subtilis, WB800, Bacillus mucilaginosus, Bacillus amyloliquefaciens, Bacillus laterosporus, Bacillus polymyxa, Bacillus pumilus, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus megaterium and Bacillus thuringiensis DNA are taken as templates
As can be seen from FIG. 3, only B.subtilis detected a significant fluorescence intensity.
3. And (5) sensitivity comparison.
NC: negative control, using sterile water as template; 1 to 8 are expressed in terms of concentration 2.73X 10, respectively2、5.46×101、1.09×101、2.18、4.36×10-1、8.72×10-2、1.7×10-2、3.48×10-3ng•µL-1DNA is used as a template. As shown in FIG. 4, the DNA template was detected at a low concentration with a significant fluorescence intensity, indicating a high sensitivity.
4. And (5) comparing the detection results by naked eyes.
Visual observation method of fluorescent dye: after the LAMP reaction is finished, 1.0 mu L of a color developing agent SYBR Green I is added into an amplification product of the LAMP reaction, the color development result is shown as a in figure 5, and a result photo of a fluorescent dye visual observation method is shown (after the SYBR Green I is added, a positive reaction tube is Green, and the color of a negative reaction tube is unchanged).
Real-time turbidity assay: the result is shown in b in FIG. 5, the positive reaction tube is white precipitate in the picture of the real-time turbidity detection method result, and the existence of the bacillus subtilis is determined; and the reaction liquid in the negative tube is clear, and no bacillus subtilis exists.
The above description is only a preferred embodiment of the present invention, and not intended to limit the present invention in other forms, and any person skilled in the art may apply the above modifications or changes to the equivalent embodiments with equivalent changes, without departing from the technical spirit of the present invention, and any simple modification, equivalent change and change made to the above embodiments according to the technical spirit of the present invention still belong to the protection scope of the technical spirit of the present invention.
SEQUENCE LISTING
<110> Shandong province product quality inspection research institute, Shandong university
<120> primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof
<130>1
<150>2019107396712
<151>2019-08-12
<160>13
<170>PatentIn version 3.5
<210>1
<211>19
<212>DNA
<213> Artificial sequence
<400>1
gcgattattc cagtcacgg 19
<210>2
<211>21
<212>DNA
<213> Artificial sequence
<400>2
cgtttttcgt tccaatgatg a 21
<210>3
<211>43
<212>DNA
<213> Artificial sequence
<400>3
cgaattgaga tagcgatgtt cgtttatgcg gagctttacc tct 43
<210>4
<211>43
<212>DNA
<213> Artificial sequence
<400>4
atatccgcaa caatggtcta attgctgttt tgtgccgtca gtc43
<210>5
<211>22
<212>DNA
<213> Artificial sequence
<400>5
accccatgct ttgtagtgaa ga 22
<210>6
<211>23
<212>DNA
<213> Artificial sequence
<400>6
tgaagatgat gaactgatgg gtg 23
<210>7
<211>159
<212>DNA
<213> Artificial sequence
<400>7
gcattgcggt aggtatggcc ttttgcccgg atcgtgatgt ccggattctc actgacagca 60
caaacattcc tccgcaccat ccaggacctg atttcccgac tcctcggcct gattcgtatg 120
tccgtcaatg atttctccca gcttgggccg cagcggtat 159
<210>8
<211>165
<212>DNA
<213> Artificial sequence
<400>8
caaacattcc tccgcaccaa cccgaagatg tttgttcgaa gtcgggaaat caggtcctgg 60
acggagtact tgctgtcagt ggtcaaatct tgggccgcag ccagcttttg cccggatcgt 120
ggaatggtaa tgtccggatt ctccggaaag catacgaatc aggcc 165
<210>9
<211>168
<212>DNA
<213> Artificial sequence
<400>9
cgtcctgcgg tagaagtcat gatccgtttc gccaatgacg cacctacacc gtgtaatcct 60
ttatgacggt gcttcatgcc ttgatgtgac ggttcaccgt gaaggtctgt aaccggaact 120
cccgcttccg tcaaattttc ctcccggtaa aattcaccgc caaaccta 168
<210>10
<211>171
<212>DNA
<213> Artificial sequence
<400>10
aatttgacgg aagcggctat ccgggacaaa atgtgtcgtg tcacggtgaa ccgtcacatc 60
agattacacg gtgtaggtgc gcaccgccaa acctataaac gcgctgtatg atccgtttcg 120
ccatctgttg atagtgcgtt tacgacgagt tccggttaca gaccttgaaa t 171
<210>11
<211>174
<212>DNA
<213> Artificial sequence
<400>11
aggtttaatt gaacaattct caccagtacg tctttcatcg ttaacaagag actggtattc 60
ttcttcgatc acaagcgatc cttgacaatt gcagagctaa aagacatctt gggctctttg 120
atttccgtga gcgttaaacg ctggagcctc aagtgcttga gatcattcgt gaag 174
<210>12
<211>171
<212>DNA
<213> Artificial sequence
<400>12
gcgattattc cagtcacggc gtttttcgtt ccaatgatga cgaattgaga tagcgatgtt 60
cgtttatgcg gagctttacc tctatatccg caacaatggt ctaattgctg ttttgtgccg 120
tcagtcaccc catgctttgt agtgaagatg aagatgatga actgatgggt g 171
<210>13
<211>244
<212>DNA
<213> gyrA and gyrB genes
<400>13
gtgagtggat caacgcgatt attccagtca cggaattcaa tgcggagctt tacctcttct 60
tcactacaaa gcatggggtt tcaaaacgaa catcgctatc tcaattcgct aatatccgca 120
acaatggtct aattgctctg agtcttcgtg aagatgatga actgatgggt gtacgtctga 180
ctgcggcaca aaacaaatca tcattggaac gaaaaacggt ttactgattc gtttccctga 240
aaca 244
Claims (7)
1. A primer for detecting bacillus subtilis by a loop-mediated isothermal amplification method is obtained by taking gyrA gene of the bacillus subtilis as a target sequence, and is characterized in that: the primers comprise a group of outer primers F3/B3, a group of inner primers FIP/BIP and a group of loop primers LF/LB; the nucleotide sequences are respectively shown as follows:
F3：5’-GCGATTATTCCAGTCACGG-3’；
B3：5’-CGTTTTTCGTTCCAATGATGA-3’；
FIP：5’-CGAATTGAGATAGCGATGTTCGTTTATGCGGAGCTTTACCTCT-3’；
BIP：5’-ATATCCGCAACAATGGTCTAATTGCTGTTTTGTGCCGTCAGTC-3’；
LF：5’-ACCCCATGCTTTGTAGTGAAGA-3’；
LB：5’-TGAAGATGATGAACTGATGGGTG-3’。
2. the application of the primer for detecting the bacillus subtilis by the loop-mediated isothermal amplification method in the detection of the bacillus subtilis in claim 1.
3. The use of claim 2, wherein the primer is used for detecting bacillus subtilis by a method comprising:
(1) extracting genome DNA of a sample to be detected;
(2) establishing a loop-mediated isothermal amplification (LAMP) reaction system for reaction: adding the outer primer F3/B3, the inner primer FIP/BIP and the loop primer LF/LB into the DNA extracted in the step (1) as a template to perform LAMP amplification, adding LAMP reaction mixed liquid, and reacting at the temperature of 61-65 ℃;
(3) and (3) judging a reaction result: judging by adopting a fluorescent dye visual inspection method or a real-time turbidity detection method; the judgment method of the fluorescent dye visual observation method comprises the following steps: after the LAMP reaction is finished, adding 1.0 mu L of a color developing agent SYBRGreen I into an amplification product of the LAMP reaction, and observing the judgment of green fluorescence as positive in a color development result, namely existence of bacillus subtilis, and orange or orange as negative in color development result, namely existence of the bacillus subtilis; the real-time turbidity detection method comprises the following steps: and observing whether the amplified product is white turbid or not, wherein the judgment that the amplified product is white turbid is positive, namely bacillus subtilis exists, and the judgment that the amplified product is white turbid is negative, namely the amplified product is not white turbid.
4. The use according to claim 3, wherein the total volume of the loop-mediated isothermal amplification (LAMP) reaction system in step (2) is 20 μ L; comprises 0.2 mu M outer primer F3/B3, 1.6 mu M inner primer FIP/BIP and 0.4 mu M loop primer LF/LB, 10 mu L LAMP reaction mixed liquor, 2.0 mu L DNA template and the balance of sterilized ultrapure water.
5. Use according to claim 3, wherein the reaction temperature in step (2) is 65 ℃.
6. Use according to claim 3, wherein the reaction time in step (2) is 30-50 min.
7. The use according to claim 6, wherein the reaction time in step (2) is 35 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910739671.2A CN110273017B (en) | 2019-08-12 | 2019-08-12 | Primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910739671.2A CN110273017B (en) | 2019-08-12 | 2019-08-12 | Primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110273017A CN110273017A (en) | 2019-09-24 |
| CN110273017B true CN110273017B (en) | 2020-05-12 |
Family
ID=67966090
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910739671.2A Active CN110273017B (en) | 2019-08-12 | 2019-08-12 | Primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110273017B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533981B (en) * | 2011-12-16 | 2014-01-08 | 光明乳业股份有限公司 | Primer and detection method as well as kit for rapidly detecting bacillus subtilis |
| CN103409549A (en) * | 2013-08-27 | 2013-11-27 | 中国农业科学院农业资源与农业区划研究所 | Specific primer pair for detecting and identifying PCR of bacillus subtilis |
| US10889854B2 (en) * | 2016-08-08 | 2021-01-12 | Universiti Brunei Darussalam | System and method for immobilization free electrochemiluminescence DNA detection using a luminophore dye for multi-species detection |
| CN107326094A (en) * | 2017-09-04 | 2017-11-07 | 重庆市畜牧科学院 | The kit and its detection method of chicken rhinitis type Klebsiella are detected based on ring mediated isothermal amplification |
-
2019
- 2019-08-12 CN CN201910739671.2A patent/CN110273017B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110273017A (en) | 2019-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104232769B (en) | rRNA-targeted quantitative analysis method for microorganisms | |
| CN106434993B (en) | For detecting LAMP primer composition object and its application of cucumber fusarium axysporum | |
| Jin et al. | A real-time LAMP-based dual-sample microfluidic chip for rapid and simultaneous detection of multiple waterborne pathogenic bacteria from coastal waters | |
| CN110257509B (en) | Tigecycline drug-resistant gene family tetX multiplex PCR detection kit | |
| CN112111494B (en) | DNAzymes for identifying pseudomonas aeruginosa, screening and detecting method and application | |
| AU732150B2 (en) | Means for qualitative and quantitative analysis of microbial populations potentially present in a sample | |
| CN107022638A (en) | The LAMP primer group of quick detection salmonella and its application | |
| CN110273017B (en) | Primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof | |
| CN107012216B (en) | LAMP primer group, kit and rapid detection method for detecting enterobacter cloacae | |
| CN105695584B (en) | The gyrB primer of test experience animal staphylococcus aureus combines | |
| CN101875967B (en) | Method for rapidly identifying food-borne pathogenic bacteria | |
| CN114540516B (en) | LAMP double-strand detection probe, kit and detection method for staphylococcus aureus | |
| KR101987388B1 (en) | Composition for colorimetric isothermal detecting of vibrio species containing molecular beacon and uses thereof | |
| KR101846182B1 (en) | Primer sets for simultaneous detection of Staphylococcus aureus, Bacillus cereus and Salmonella spp., polymerase chain reaction kit thereof | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| JP2003219878A (en) | Primer for detection of legionella and detection method using the same | |
| CN111621549B (en) | LAMP (loop-mediated isothermal amplification) rapid detection method for bacterial blight in rice seeds and application | |
| CN114703304A (en) | LAMP double-strand detection probe and freeze-dried microspheres of burkholderia gladioli, and preparation method and detection method thereof | |
| RU2567011C2 (en) | PEPTIDE-NUCLEIC ACID PROBE, SET AND METHOD FOR DETECTION AND/OR QUANTITATIVE DETERMINATION OF Salmonella spp AND THEIR APPLICATIONS | |
| CN114164296B (en) | Primer probe composition for detecting pythium oligandrum, kit and application and detection method | |
| KR102178672B1 (en) | Composition for colorimetric isothermal detection comprising molecular beacon and uses thereof | |
| CN114672578B (en) | Primer composition for detecting corynebacterium bovis and application of primer composition | |
| CN104032000A (en) | Method and kit for detecting bacillus cereus | |
| EP4365292A1 (en) | Aptamer for the detection of the microorganism bacillus subtilis | |
| Munawar | Novel Methods for Detection of Microbes at Cellular and Molecular Level |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |