CN110273017A - A kind of ring mediated isothermal amplification method detects primer and its application of bacillus subtilis - Google Patents
A kind of ring mediated isothermal amplification method detects primer and its application of bacillus subtilis Download PDFInfo
- Publication number
- CN110273017A CN110273017A CN201910739671.2A CN201910739671A CN110273017A CN 110273017 A CN110273017 A CN 110273017A CN 201910739671 A CN201910739671 A CN 201910739671A CN 110273017 A CN110273017 A CN 110273017A
- Authority
- CN
- China
- Prior art keywords
- primer
- bacillus subtilis
- reaction
- lamp
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primers of ring mediated isothermal amplification method detection bacillus subtilis, are with bacillus subtilisgyrAGene andgyrBGene designs acquisition for target sequence, wherein the primer includes one group of outer primer F3/B3, one group of inner primer FIP/BIP and one group of ring primer LF/LB.The invention also discloses application of the primer in detection bacillus subtilis.Experiment confirms that 3 groups of LAMP primers of the invention have very strong specificity, and sensitivity is shown in comparative test is at least higher by existing method an order of magnitude.Detection process of the invention need to only carry out under the conditions of water bath with thermostatic control, not need expensive variable temperature unit, as a result can judge that the reaction time, detection cycle was shorter less than 40 minutes, and experimental cost is lower by naked eyes or the simple indicator of addition.
Description
Technical field
The invention belongs to, about bacillus subtilis detection or identification technology field, be related to a kind of utilization in microbial manure
Ring mediated isothermal amplification method (loop-mediated isothermal amplification, LAMP) technology quickly detects
The primer of bacillus subtilis and its application.
Background technique
Mainly there is bacterium to be separately cultured identification method, immunological detection method and molecule the detection method of bacterium at present
Biological method.
Bacterium, which is separately cultured identification method, will to be separated using fluid nutrient medium, semisolid culturemedium or solid medium
To bacterium cultivated, and microorganism is diagnosed by Physiology and biochemistry and dyeing microscopic examination.The shortcomings that identification method is
Test period is very long, and general microorganism is separately cultured needs 2 days, and the time required for identifying was at one week or so.Therefore, such side
Method can not adapt to fast and accurately diagnose the market demand at present.
The principle of immunological detection method is to be combined to form the compound of precipitating according to Ag-Ab, be based on antigen with
A kind of serological method that the principle that antibody specificity combines is detected.The disadvantages of the method are as follows the examination needed in detection process
Agent is very expensive, while according to different objective microbes, specificity is also different, is easy to appear false positive.
Molecular biology is the subject for studying biological phenomena material base on a molecular scale.Common is micro- applied to detecting
Biological method has the methods of nucleic acid gel electrophoresis experiment, nucleic acid molecular hybridization experiments, nucleic acid in vitro amplification experiment.This method lacks
Point is, needs expensive alternating temperature consersion unit and detecting instrument.All standing is difficult to for the dispensing use of base.
Bacillus subtilis (Bacillus subtilis), it is one kind of bacillus, is widely distributed in soil and corruption
In the organic matter lost, easily bred in withered grass leaching juice, hence obtain one's name bacillus subtilis.Bacillus subtilis is as a kind of beneficial
Bacterium, itself have many advantages, such as it is environmentally friendly, to cereal crops safely, the generally pass of people is received to person poultry harmless
Note and further investigation.Bacillus subtilis has flourishing excretory system and stronger environmental suitability, supports in agricultural, aquatic products
It grows, the fields such as human body probiotics are widely applied.Bacillus subtilis all has antagonism performance to a variety of pathogens, in agricultural production
In can be used for preventing and treating plurality of plant diseases, as be used to prevent and treat caused by pepper anthracnose, rice sheath blight disease and some sickle-like bacteria
Disease.
Bacillus subtilis is widely used in bio-feritlizer.It, can be in crop rhizosphere when it acts on crop or soil
Or Colonization inside plants, and play specific fertilizer effect.Currently, microbial manure improves chemical fertilizer utilization ratio in culture fertility, inhibit agriculture
Absorption of the crop to nitrate nitrogen, heavy metal, pesticide, purification and rehabilitating soil, reduce corps diseases, promote crops straw
The decomposed utilization of stalk and municipal refuse improves crop product quality and food safety etc. and shows irreplaceable work
With.
The detection of bacillus subtilis is divided into common detection methods and rapid detection method.Common detection methods first have into
Row bacterium Zengjing Granule isolates and purifies, and is reflected by colony morphological observation, gram stain microscopy, bio-chemical characteristics etc.
It is fixed.Rapid detection method is used for quickly detecting with round pcr, immunological technique and enzyme reaction.Quickly detection concrete operations
Method multiplicity, detection speed is fast, and high sensitivity has reliability and accuracy, but sample preparation is more difficult, in detection process
Instrument level requirement height, the expensive reagents needed.
One of an important factor for selection of target gene is LAMP detection.The common target genetic region of regular-PCR is 16S
The region rRNA or 18S rRNA.However for bacillus, 16S Regional Similarity is higher, not only by the region
Whether energy accurate judgement is bacillus subtilis.The especially 16SrRNA base of bacillus subtilis and bacillus amyloliquefaciens etc.
The similarity of cause relies solely on the empiric observation bacterium of experimenter 100%, therefore in the detection such as daily agricultural, aquaculture
It falls to distinguish identification, causes very big detection error and deviation.It is quickly being examined using ring mediated isothermal amplification method (LAMP) technology
It surveys certain pathogens and bacillus cereus, clostridium etc. to have been reported that, such as patent " bacillus aerogenes capsulatus
The preparation and application of quick detection kit " (publication number CN 101200761A), quick inspection has been invented using LAMP technology
Survey the kit and method of bacillus aerogenes capsulatus；" the kit of detecting pseudomonas aeruginosa by loop-mediated isothermal amplification method
And method " (publication number CN 101392289A), then be for pathogen Pseudomonas aeruginosa LAMP detection technique invention and answer
With；" method and primer of food-borne bacillus cereus are detected using loop-mediated isothermal amplification technique " (publication number CN
107475401A), a kind of method and primer that food-borne bacillus cereus is detected using LAMP technology has been invented.But about withered
The development and application of careless bacillus correlation LAMP technology are but reported less.
Summary of the invention
For the deficiency present in bacillus subtilis detection in the prior art, the problem to be solved in the present invention is to mention
For a kind of primer and its application for quickly detecting bacillus subtilis using ring mediated isothermal amplification method (LAMP) technology.
The primer of ring mediated isothermal amplification method detection bacillus subtilis of the present invention, is with bacillus subtilisgyrAGene andgyrBGene designs acquisition for target sequence.gyrAGene andgyrBGene is in the various bacterias such as bacillus
Existing gene order is responsible for the conservative gene of coding target enzyme DNA gyrase, and variation rate is greater than 16S rRNA, therefore
Suitable for the identification between bacterium kind and it can reflect the evolutionary relationship between kind.Bacillus subtilisgyrAGene andgyrBThere are notable differences in base similitude for gene, can be used as the target gene of bacillus subtilis Rapid identification.Its feature
Be: the primer includes one group of outer primer F3/B3, one group of inner primer FIP/BIP and one group of ring primer LF/LB；Its nucleotide
Sequence difference is as follows:
F3:5 '-GCGATTCCAGTCACGG-3 '；
B3:5 '-CGTTTTTCGTTCCAATGATGA-3 '；
FIP:5 '-CGAATTGAGATAGCGATGTTCGTTTATGCGGAGCTTTACCTCT-3 '；
BIP:5 '-ATATCCGCAACAATGGTCTAATTGCTGTTTTGTGCCGTCAGTC-3 '；
LF:5 '-ACCCCATGCTTTGTAGTGAAGA-3 '；
LB:5 '-TGAAGATGATGAACTGATGGGTG-3 '.
Bacillus subtilis belongs to bacillus, which includes bacillus amyloliquefaciens, bacillus licheniformis, huge bud
A variety of strains such as spore bacillus, gel-shaped series bacillus, bacillus pumilus.Conservative of the bacillus subtilis in the region 16S
It is not high.By Comparison Study, it is found by the applicant that bacillus subtilisgyrAGene andgyrBGene is highly conserved region, because
This, which is suitable for specific detection bacillus subtilis
Bacterium.Further, for the conserved sequence, applicant devises ring mediated isothermal amplification method (LAMP) detection of the present invention
The primer of bacillus subtilis, by more covering primer optimization experiment, it is determined that the above-mentioned primer with optimum detection effect.
The primer of ring mediated isothermal amplification method detection bacillus subtilis of the present invention is in detection bacillus subtilis
Application.
The present invention utilizes above-mentioned primer, and the method using loop-mediated isothermal amplification technique detection bacillus subtilis is: mentioning
The DNA for taking sample to be tested carries out LAMP reaction using the primer using the DNA as template；It reflects to reaction product
It is fixed, judge whether contain bacillus subtilis in sample to be tested.
Specifically, the method that the primer is used to detect bacillus subtilis is:
(1) sample to be tested genomic DNA is extracted；
(2) establish ring mediated isothermal amplification method (LAMP) reaction system to be reacted: the DNA extracted using step (1) adds as template
Enter the outer primer object F3/B3, inner primer FIP/BIP and ring primer LF/LB carries out LAMP amplification, LAMP reaction mixing is added
Liquid is reacted under the conditions of 61-65 DEG C of temperature；
(3) judgement of reaction result: determined using fluorescent dye visual observations method or real-time turbidimetric assay；Wherein, fluorescence contaminates
Material visual observations method determination method is: after reaction to LAMP, color developing agent SYBR being added in the amplified production of LAMP reaction
1.0 μ L of Green I, colour developing result observe that the judgement of green fluorescence for the positive, that is, has bacillus subtilis, orange or tangerine
Yellow is feminine gender, that is, bacillus subtilis is not present；Real-time turbidimetric assay determination method is: whether observation amplified production goes out
There is the judgement of white opacity for the positive, that is, there is bacillus subtilis, no white opacity is feminine gender, i.e., in existing white opacity
There is no bacillus subtilises.
In above-mentioned application, ring mediated isothermal amplification method (LAMP) reaction system total volume described in step (2) is preferably
20 μL；Including 0.2 μM of outer primer F3/B3,1.6 μM of inner primer FIP/BIP and 0.4 μM of ring primer LF/LB, LAMP reaction
10 μ L of mixed liquor, 2.0 μ L of DNA profiling, surplus are sterilizing ultrapure water.
Wherein, above-mentioned LAMP reaction mixture is commercial product (manufacturer's citing: Ningbo Bo Ao biotech firm), master
Wanting ingredient is 20 mmol/L Tris-HCl (pH 8.8), 6.5 mmol/L MgSO4, 10 mmol/L KCl, 10
mmol/L(NH4)2SO4, 0.1% Triton X-100,1.6 mol/L glycine betaines, 1.4 mmol/L dNTPs, Bst DNA
8 U of polymerase.
In above-mentioned application, reaction temperature described in step (2) is preferably 65 DEG C.
In above-mentioned application, the reaction time described in step (2) is 30-50min.
Wherein, the reaction time described in step (2) is preferably 35min.
The present invention utilizes the basic step of ring mediated isothermal expansion technique, for 3 couples of spies of target gene specific selection
Specific primer demarcates 6 regions of testing gene group, maintains certain time under constant temperature conditions using strand displacement archaeal dna polymerase,
Complete nucleic acid amplification reaction.For morphological feature is based primarily upon to the bacillus subtilis dientification of bacteria in the prior art, method is time-consuming
The problem long, program is cumbersome, accuracy is low and existing PCR Molecular Detection need the problems such as by expensive instrument, provide one
A kind of ring mediated isothermal amplification method of kind detects primer and its application of bacillus subtilis, bacillus subtilis involved in the application
The new molecular detecting method of bacterium, it is excellent to have that detection cycle is short, accuracy is high, sensitivity is high, is easy to visually observe testing result etc.
Gesture.
Compared with prior art, the advantages and positive effects of the present invention are:
1, specificity is stronger: the present invention is directed togyrAGene andgyrBGene provides the LAMP primer of 3 group-specifics, has very strong
Specificity.And bacillus subtilis LAMP detection method is established, bacillus subtilis can detected, and other bacteriums are equal
It is not detected, test of many times result is consistent, illustrates LAMP detection method high specificity of the present invention, as a result reliably.
2, sensitivity is more preferable: being separately cultured identification, Tissue pathological diagnosis method, immunology detection side in the tradition of bacterium
In method, conventional molecular biological detection method, the sensitivity highest of the detection method of molecular biology, and sensitivity of the invention
In comparative test polymerase chain reaction, within the shorter reaction time, sensitivity is at least higher by an order of magnitude.
3, at low cost: this method detection process is carried out under the conditions of water bath with thermostatic control, does not need expensive variable temperature unit,
In judging result, it can judge that experimental cost is lower than other methods by naked eyes or the simple indicator of addition.
4, quickly: in common detection method, general culture method detection cycle longest, the molecular biology method period compared with
Short, this method is also one kind of molecular biology, maintains the short feature of diagnosis of molecular biology fast cycle.In observation result
When, the time of cost is more shorter than conventional molecular biological, and conventional polymeric enzyme chain reaction takes around 2 hours and completes, and our
The reaction time of method, detection cycle was shorter less than 40 minutes.
Detailed description of the invention
Fig. 1 is different primers fluorescence intensity testing result.
Fig. 2 is embodiment 1-3 different temperatures fluorescence intensity testing result.
Fig. 3 is primer pair different strain fluorescence intensity testing result of the present invention.
Wherein: label 1-13 successively represent 4 bacillus subtilis (B. subtilis 168、B. subtilis BS-
1、B. subtilis BS-2、B. subtilis WB800), colloid bacillus cereus, bacillus amyloliquefaciens, side spore gemma bar
Bacterium, Bacillus polymyxa, bacillus pumilus, bacillus amyloliquefaciens, bacillus licheniformis, bacillus megaterium, Su Yunjin
Bacillus；NC is sterile water.
Fig. 4 is primer sensitivity test result of the present invention.
Wherein: NC: negative control, using sterile water as template；1-8 is respectively indicated with concentration 2.73 × 102、5.46×101、
1.09×101、2.18、4.36×10-1、8.72×10-2、1.7×10-2、3.48×10-3 ng•µL-1DNA is template.
Fig. 5 is to visually observe schematic diagram after LAMP of the present invention reacts.
Wherein: a is that (after adding SYBR Green I, positive reaction pipe is presented fluorescent dye visual observations method result photo
Green, and negative reaction pipe color is constant), b is that (it is heavy that white is presented in visible positive reaction pipe to real-time turbidimetric assay result photo
It forms sediment, and negative tube reaction solution is clarification).
Specific embodiment
To better understand the objects, features and advantages of the present invention, right combined with specific embodiments below
The present invention is described further.It should be noted that in the absence of conflict, the spy in embodiments herein and embodiment
Sign can be combined with each other.
In the following description, numerous specific details are set forth in order to facilitate a full understanding of the present invention, still, the present invention may be used also
To be implemented using other modes described herein are different from, therefore, the present invention is not limited to the specific of specification is described below
The limitation of embodiment.
Embodiment 1
Extract sample to be tested genomic DNA, using the DNA of extraction as template, be added outer primer object F3/B3, inner primer FIP/BIP and
Ring primer LF/LB carries out LAMP amplification, and LAMP detects reaction system total volume as 20 μ L, including 0.2 μM of outer primer F3/B3,
1.6 μM of inner primer FIP/BIP and 0.4 μM of 10 μ L, DNA template of ring primer LF/LB, LAMP reaction mixture, 2.0 μ L are used
Sterilizing ultrapure water complements to 20 μ L.35min is reacted at 65 DEG C, then detects reaction result.
Embodiment 2
Sample to be tested genomic DNA is extracted, using the DNA of extraction as template, outer primer F3/B3, inner primer FIP/BIP and ring is added
Primer LF/LB carries out LAMP amplification, and it is 20 μ L, including 0.2 μM of outer primer F3/B3 that LAMP, which detects reaction system total volume, and 1.6
μM inner primer FIP/BIP and 0.4 μM of 10 μ L, DNA template of ring primer LF/LB, LAMP reaction mixture, 2.0 μ L, with sterilizing
Ultrapure water complements to 20 μ L.30min is reacted at 61 DEG C, then detects reaction result.
Embodiment 3
Extract sample to be tested genomic DNA, using the DNA of extraction as template, be added outer primer object F3/B3, inner primer FIP/BIP and
Ring primer LF/LB carries out LAMP amplification, and LAMP detects reaction system total volume as 20 μ L, including 0.2 μM of outer primer F3/B3,
1.6 μM of inner primer FIP/BIP and 0.4 μM of 10 μ L, DNA template of ring primer LF/LB, LAMP reaction mixture, 2.0 μ L are used
Sterilizing ultrapure water complements to 20 μ L.60min is reacted at 63 DEG C, then detects reaction result.
The primer of loop-mediated isothermal amplification technique detection bacillus subtilis, i.e. outer primer are utilized in above-described embodiment 1-3
The nucleotide sequence of F3/B3, inner primer FIP/BIP and ring primer LF/LB are as follows:
F3:5 '-GCGATTCCAGTCACGG-3 '；
B3:5 '-CGTTTTTCGTTCCAATGATGA-3 '；
FIP:5 '-CGAATTGAGATAGCGATGTTCGTTTATGCGGAGCTTTACCTCT-3 '；
BIP:5 '-ATATCCGCAACAATGGTCTAATTGCTGTTTTGTGCCGTCAGTC-3 '；
LF:5 '-ACCCCATGCTTTGTAGTGAAGA-3 '；
LB:5 '-TGAAGATGATGAACTGATGGGTG-3 '.
LAMP reaction mixture is commercially available (manufacturer's citing: Ningbo Bo Ao biotech firm) in above-described embodiment 1-3,
Main component is 20 mmol/L Tris-HCl (pH 8.8), 6.5 mmol/L MgSO4, 10 mmol/L KCl, 10
mmol/L(NH4)2SO4, 0.1% Triton X-100,1.6 mol/L glycine betaines, 1.4 mmol/L dNTPs, Bst DNA
8 U of polymerase.
By carrying out real-time fluorescence intensity detection to embodiment 1-3, as a result as shown in Fig. 2, passing through Fig. 2 result it is found that originally
The reaction time for inventing cost is more shorter than conventional molecular biological, and conventional polymeric enzyme chain reaction takes around 2 hours and completes, and
The reaction time of this method, detection cycle greatly shortened less than 40 minutes.
With traditional biological method comparison
1. primer pair ratio.
Such as Fig. 1, design 6 groups of LAMP specific primers is with same bacillus subtilis genome under the same conditions
Template carries out LAMP reaction.Quantitative fluorescent PCR real-time monitoring fluorescence intensity.
Optimal selection ID311 group primer, the primer can reach maximum copy number in the shortest time.
Under the premise of keeping the factors such as reaction condition and temperature in embodiment 1 constant, change primer type (each primer
Sequence is as follows), under the same conditions, using same bacillus subtilis genome as template, carry out LAMP reaction.Pass through detection
As a result it is found that under the same terms, primer quantitative fluorescent PCR real-time monitoring fluorescence intensity of the present invention is most strong.
Each group primer sequence used in comparative example summarizes:
(1) ID4
F3: GCATTGCGGTAGGTATGGC；
B3: CTTTTGCCCGGATCGTGAT；
FIP: GTCCGGATTCTCACTGACAGCACAAACATTCCTCCGCACCA；
BIP: TCCAGGACCTGATTTCCCGACTCCTCGGCCTGATTCGTATG；
LF: TCCGTCAATGATTTCTCCCAGC；
LB: TTGGGCCGCAGCGGTAT。
(2) ID7
F3: CAAACATTCCTCCGCACCA；
B3: ACCCGAAGATGTTTGTTCGA；
FIP: AGTCGGGAAATCAGGTCCTGGACGGAGTACTTGCTGTCAGTG；
BIP: GTCAAATCTTGGGCCGCAGCCAGCTTTTGCCCGGATCG；
LF: TGGAATGGTAATGTCCGGATTCT；
LB: CCGGAAAGCATACGAATCAGGCC。
(3) ID3
F3: CGTCCTGCGGTAGAAGTCA；
B3: TGATCCGTTTCGCCAATGA；
FIP: CGCACCTACACCGTGTAATCCTTTATGACGGTGCTTCATGCC；
BIP: TTGATGTGACGGTTCACCGTGAAGGTCTGTAACCGGAACTCC；
LF: CGCTTCCGTCAAATTTTCCTCC；
LB:CGGTAAAATTCACCGCCAAACCTA。
(4) ID9
F3: AATTTGACGGAAGCGGCTAT；
B3: CCGGGACAAAATGTGTCGT；
FIP: GTCACGGTGAACCGTCACATCAGATTACACGGTGTAGGTGCG；
BIP: CACCGCCAAACCTATAAACGCGCTGTATGATCCGTTTCGCCA；
LF: TCTGTTGATAGTGCGTTTACGAC；
LB: GAGTTCCGGTTACAGACCTTGAAAT。
(5) ID104
F3: AGGTTTAATTGAACAATTCTCAC；
B3: CAGTACGTCTTTCATCGTTAA；
FIP: CAAGAGACTGGTATTCTTCTTCGATCACAAGCGATCCTTGACA；
BIP: ATTGCAGAGCTAAAAGACATCTTGGGCTCTTTGATTTCCGTGAG；
LF: CGTTAAACGCTGGAGCCTCA；
LB: AGTGCTTGAGATCATTCGTGAAG。
(6) ID311
F3: GCGATTATTCCAGTCACGG；
B3: CGTTTTTCGTTCCAATGATGA；
FIP: CGAATTGAGATAGCGATGTTCGTTTATGCGGAGCTTTACCTCT；
BIP: ATATCCGCAACAATGGTCTAATTGCTGTTTTGTGCCGTCAGTC；
LF: ACCCCATGCTTTGTAGTGAAGA；
LB: TGAAGATGATGAACTGATGGGTG。
2. primer specificity compares.
Using the step and conditional parameter in embodiment 1, it is respectively adoptedBacillus subtilis168, withered grass gemma
Bacillus produces strain -1, bacillus subtilis production strain -2, bacillus subtilis and produces strain -3, colloid bacillus cereus, solution
Bacillus amyloliquefaciens, bacillus laterosporus, Paenibacillus polymyxa, bacillus pumilus, bacillus amyloliquefaciens, lichens gemma
Bacillus, bacillus megaterium, bacillus thuringiensis DNA be template (the label 1-13 in Fig. 3), with sterile water (NC) be mould
Plate is as blank control.NC: negative control, using sterile water as template；1-13 respectively indicate with B.168, cz-6, factory it is withered,
WB800, colloid bacillus cereus, bacillus amyloliquefaciens, bacillus laterosporus, Bacillus polymyxa, bacillus pumilus, Xie Dian
Afnyloliquefaciens, bacillus licheniformis, bacillus megaterium, bacillus thuringiensis DNA are template
From figure 3, it can be seen that only bacillus subtilis detects apparent fluorescence intensity.
3. Sensitivity comparison.
NC: negative control, using sterile water as template；1-8 is respectively indicated with concentration 2.73 × 102、5.46×101、1.09×
101、2.18、4.36×10-1、8.72×10-2、1.7×10-2、3.48×10-3 ng•µL-1DNA is template.As shown in figure 4,
DNA profiling can detect apparent fluorescence intensity at low concentrations, illustrate that its sensitivity is very high.
4. naked eyes testing result compares.
Fluorescent dye visual observations method: after reaction to LAMP, color developing agent is added in the amplified production of LAMP reaction
1.0 μ L of SYBR Green I, colour developing result are shown in that a in Fig. 5, fluorescent dye visual observations method result photo (add SYBR Green
After I, green is presented in positive reaction pipe, and negative reaction pipe color is constant).
Real-time turbidimetric assay: result is shown in b in Fig. 5, and the visible positive reaction pipe of real-time turbidimetric assay result photo is presented
White precipitate determines that there are bacillus subtilises；And negative tube reaction solution is clarification, and bacillus subtilis is not present.
The above described is only a preferred embodiment of the present invention, being not that the invention has other forms of limitations, appoint
What those skilled in the art changed or be modified as possibly also with the technology contents of the disclosure above equivalent variations etc.
It imitates embodiment and is applied to other fields, but without departing from the technical solutions of the present invention, according to the technical essence of the invention
Any simple modification, equivalent variations and remodeling to the above embodiments, still fall within the protection scope of technical solution of the present invention.
SEQUENCE LISTING
<110>Shandong Province's product quality inspection research institute, Shandong University
<120>a kind of primer of ring mediated isothermal amplification method detection bacillus subtilis and its application
<130> 1
<160> 13
<170> PatentIn version 3.5
<210> 1
<211> 16
<212> DNA
<213>artificial sequence
<400> 1
gcgattccag tcacgg 16
<210> 2
<211> 21
<212> DNA
<213>artificial sequence
<400> 2
cgtttttcgt tccaatgatg a 21
<210> 3
<211> 43
<212> DNA
<213>artificial sequence
<400> 3
cgaattgaga tagcgatgtt cgtttatgcg gagctttacc tct 43
<210> 4
<211> 43
<212> DNA
<213>artificial sequence
<400> 4
atatccgcaa caatggtcta attgctgttt tgtgccgtca gtc 43
<210> 5
<211> 22
<212> DNA
<213>artificial sequence
<400> 5
accccatgct ttgtagtgaa ga 22
<210> 6
<211> 23
<212> DNA
<213>artificial sequence
<400> 6
tgaagatgat gaactgatgg gtg 23
<210> 7
<211> 159
<212> DNA
<213>artificial sequence
<400> 7
gcattgcggt aggtatggcc ttttgcccgg atcgtgatgt ccggattctc actgacagca 60
caaacattcc tccgcaccat ccaggacctg atttcccgac tcctcggcct gattcgtatg 120
tccgtcaatg atttctccca gcttgggccg cagcggtat 159
<210> 8
<211> 165
<212> DNA
<213>artificial sequence
<400> 8
caaacattcc tccgcaccaa cccgaagatg tttgttcgaa gtcgggaaat caggtcctgg 60
acggagtact tgctgtcagt ggtcaaatct tgggccgcag ccagcttttg cccggatcgt 120
ggaatggtaa tgtccggatt ctccggaaag catacgaatc aggcc 165
<210> 9
<211> 167
<212> DNA
<213>artificial sequence
<400> 9
cgtcctgcgg tagaagtcat gatccgtttc gccaatgacg cacctacacc gtgtaatcct 60
ttatgacggt gcttcatgcc ttgatgtgac ggttcaccgt gaaggtctgt aaccggaact 120
ccgcttccgt caaattttcc tcccggtaaa attcaccgcc aaaccta 167
<210> 10
<211> 171
<212> DNA
<213>artificial sequence
<400> 10
aatttgacgg aagcggctat ccgggacaaa atgtgtcgtg tcacggtgaa ccgtcacatc 60
agattacacg gtgtaggtgc gcaccgccaa acctataaac gcgctgtatg atccgtttcg 120
ccatctgttg atagtgcgtt tacgacgagt tccggttaca gaccttgaaa t 171
<210> 11
<211> 174
<212> DNA
<213>artificial sequence
<400> 11
aggtttaatt gaacaattct caccagtacg tctttcatcg ttaacaagag actggtattc 60
ttcttcgatc acaagcgatc cttgacaatt gcagagctaa aagacatctt gggctctttg 120
atttccgtga gcgttaaacg ctggagcctc aagtgcttga gatcattcgt gaag 174
<210> 12
<211> 171
<212> DNA
<213>artificial sequence
<400> 12
gcgattattc cagtcacggc gtttttcgtt ccaatgatga cgaattgaga tagcgatgtt 60
cgtttatgcg gagctttacc tctatatccg caacaatggt ctaattgctg ttttgtgccg 120
tcagtcaccc catgctttgt agtgaagatg aagatgatga actgatgggt g 171
<210> 13
<211> 244
<212> DNA
<213>gyrA gene and gyrB gene nucleotide series
<400> 13
gtgagtggat caacgcgatt attccagtca cggaattcaa tgcggagctt tacctcttct 60
tcactacaaa gcatggggtt tcaaaacgaa catcgctatc tcaattcgct aatatccgca 120
acaatggtct aattgctctg agtcttcgtg aagatgatga actgatgggt gtacgtctga 180
ctgcggcaca aaacaaatca tcattggaac gaaaaacggt ttactgattc gtttccctga 240
aaca 244
Claims (7)
1. a kind of primer of ring mediated isothermal amplification method detection bacillus subtilis, with the gyrA gene of bacillus subtilis and
GyrB gene designs acquisition for target sequence, it is characterised in that: the primer includes one group of outer primer F3/B3, one group of inner primer
FIP/BIP and one group of ring primer LF/LB；Its nucleotide sequence difference is as follows:
F3:5 '-GCGATTCCAGTCACGG-3 '；
B3:5 '-CGTTTTTCGTTCCAATGATGA-3 '；
FIP:5 '-CGAATTGAGATAGCGATGTTCGTTTATGCGGAGCTTTACCTCT-3 '；
BIP:5 '-ATATCCGCAACAATGGTCTAATTGCTGTTTTGTGCCGTCAGTC-3 '；
LF:5 '-ACCCCATGCTTTGTAGTGAAGA-3 '；
LB:5 '-TGAAGATGATGAACTGATGGGTG-3 '.
2. ring mediated isothermal amplification method described in claim 1 detects the primer of bacillus subtilis in detection bacillus subtilis
Application.
3. application according to claim 2, which is characterized in that the method that the primer is used to detect bacillus subtilis
It is:
(1) sample to be tested genomic DNA is extracted；
(2) establish ring mediated isothermal amplification method (LAMP) reaction system to be reacted: the DNA extracted using step (1) adds as template
Enter the outer primer object F3/B3, inner primer FIP/BIP and ring primer LF/LB carries out LAMP amplification, LAMP reaction mixing is added
Liquid is reacted under the conditions of 61-65 DEG C of temperature；
(3) judgement of reaction result: determined using fluorescent dye visual observations method or real-time turbidimetric assay；Wherein, fluorescence contaminates
Material visual observations method determination method is: after reaction to LAMP, color developing agent SYBR being added in the amplified production of LAMP reaction
1.0 μ L of Green I, colour developing result observe that the judgement of green fluorescence for the positive, that is, has bacillus subtilis, orange or tangerine
Yellow is feminine gender, that is, bacillus subtilis is not present；Real-time turbidimetric assay determination method is: whether observation amplified production goes out
There is the judgement of white opacity for the positive, that is, there is bacillus subtilis, no white opacity is feminine gender, i.e., in existing white opacity
There is no bacillus subtilises.
4. application according to claim 3, which is characterized in that ring mediated isothermal amplification method (LAMP) described in step (2)
Reaction system total volume is 20 μ L；Draw including 0.2 μM of outer primer F3/B3,1.6 μM of inner primer FIP/BIP and 0.4 μM of ring
10 μ L of object LF/LB, LAMP reaction mixture, 2.0 μ L of DNA profiling, surplus is sterilizing ultrapure water.
5. application according to claim 3, which is characterized in that reaction temperature described in step (2) is 65 DEG C.
6. application according to claim 3, which is characterized in that the reaction time described in step (2) is 30-50min.
7. application according to claim 6, which is characterized in that the reaction time described in step (2) is 35min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910739671.2A CN110273017B (en) | 2019-08-12 | 2019-08-12 | Primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910739671.2A CN110273017B (en) | 2019-08-12 | 2019-08-12 | Primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110273017A true CN110273017A (en) | 2019-09-24 |
| CN110273017B CN110273017B (en) | 2020-05-12 |
Family
ID=67966090
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910739671.2A Active CN110273017B (en) | 2019-08-12 | 2019-08-12 | Primer for detecting bacillus subtilis by loop-mediated isothermal amplification method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110273017B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533981A (en) * | 2011-12-16 | 2012-07-04 | 光明乳业股份有限公司 | Primer and detection method as well as kit for rapidly detecting bacillus subtilis |
| CN103409549A (en) * | 2013-08-27 | 2013-11-27 | 中国农业科学院农业资源与农业区划研究所 | Specific primer pair for detecting and identifying PCR of bacillus subtilis |
| CN107326094A (en) * | 2017-09-04 | 2017-11-07 | 重庆市畜牧科学院 | The kit and its detection method of chicken rhinitis type Klebsiella are detected based on ring mediated isothermal amplification |
| US20180037944A1 (en) * | 2016-08-08 | 2018-02-08 | Universiti Brunei Darussalam | System and Method for Immobilization free electrochemiluminescence DNA detection using a luminophore dye for multi-species detection |
-
2019
- 2019-08-12 CN CN201910739671.2A patent/CN110273017B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533981A (en) * | 2011-12-16 | 2012-07-04 | 光明乳业股份有限公司 | Primer and detection method as well as kit for rapidly detecting bacillus subtilis |
| CN103409549A (en) * | 2013-08-27 | 2013-11-27 | 中国农业科学院农业资源与农业区划研究所 | Specific primer pair for detecting and identifying PCR of bacillus subtilis |
| US20180037944A1 (en) * | 2016-08-08 | 2018-02-08 | Universiti Brunei Darussalam | System and Method for Immobilization free electrochemiluminescence DNA detection using a luminophore dye for multi-species detection |
| CN107326094A (en) * | 2017-09-04 | 2017-11-07 | 重庆市畜牧科学院 | The kit and its detection method of chicken rhinitis type Klebsiella are detected based on ring mediated isothermal amplification |
Non-Patent Citations (4)
| Title |
|---|
| SHARMILI ROY等: "colorimetric nucleic acid detection on paper microchip using loop mediated isothermal amplification and crystal violet dye", 《ACS SENSORS》 * |
| 喻国辉等: "利用16S rDNA结合gyrA和gyrB基因对生防芽孢杆菌R31的快速鉴定", 《中国生物防治》 * |
| 汪东风等: "《食品质量与安全检测技术》", 31 July 2018, 中国轻工业出版社 * |
| 谭贵良等: "《现代分子生物学及组学技术在食品安全检测中的应用》", 30 June 2014, 中山大学出版社 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110273017B (en) | 2020-05-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1957089B (en) | Measuring contamination | |
| LaGier et al. | Electrochemical detection of harmful algae and other microbial contaminants in coastal waters using hand-held biosensors | |
| CN108977508A (en) | Primer combination and its application based on LAMP detection succulent Pathogen | |
| CN108676910A (en) | A kind of LAMP detection primer of fusarium prolifertum and its application | |
| CN103882105B (en) | Method for measuring content of saturated hydrocarbon-degrading gene AlkB in petroleum-contaminated soil | |
| CN116516058A (en) | Method and kit for visually detecting phytophthora sojae | |
| CN104313128B (en) | Method based on loop-mediated isothermal amplification technique detection Fusarium graminearum and Primer composition | |
| Patel et al. | Implementation of loop-mediated isothermal amplification methods in lateral flow devices for the detection of Rhizoctonia solani | |
| AU732150B2 (en) | Means for qualitative and quantitative analysis of microbial populations potentially present in a sample | |
| CN101182574B (en) | Method for detecting food-borne enterocolitisyersinia genus by loop-mediated isothermal amplification | |
| CN103249844A (en) | Quantitative multiplexed identification of nucleic acid targets | |
| CN107828905A (en) | Tobacco smoke pollution LAMP detection primer and detection method | |
| CN101875967B (en) | Method for quickly testing food-borne pathogenic bacteria | |
| CN108624655A (en) | Real-time fluorescence L AMP detection method and kit for potato late blight bacteria | |
| CN110273017A (en) | A kind of ring mediated isothermal amplification method detects primer and its application of bacillus subtilis | |
| CN110878373A (en) | Recombinase polymerase amplification detection kit for phytophthora infestans and application thereof | |
| CN103602727B (en) | Detection primer set, detection kit and detection method for rapidly detecting Ralstonia solanacearum | |
| CN115976254A (en) | RPA-LFD primer and detection method for plant pathogenic fusarium oxysporum | |
| CN104195254A (en) | Method and primer composition for detecting fusarium equiseti based on loop-mediated isothermal amplification technology | |
| CN108411017A (en) | Detect the LAMP primer and method of pseudomonas syringae tomato pvs oryzae and oryzicola | |
| CN105695579A (en) | Kit for rapidly detecting Avibacterium paragallinarum | |
| CN101182575B (en) | Method for detecting food-borne pseudotuberculosis yersinia genus by loop-mediated isothermal amplification | |
| CN101392289B (en) | Kit and method for detecting pseudomonas aeruginosa by loop-mediated isothermal amplification method | |
| AU2021101342A4 (en) | Enhanced loop-mediated isothermal amplification method for detecting latent xap infection in pomegranate | |
| JP2007527723A (en) | Quality assurance system for detecting microorganisms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |