CN110237235B - Application of clonorchis sinensis recombinant protein CsHscB in cholestatic liver fibrosis treatment drug - Google Patents

Abstract

The invention relates to the field of biotechnology, in particular to clonorchis sinensis recombinant protein CsHscB (short for rCsHscB) and application thereof in medicaments for treating cholestatic liver fibrosis, wherein the CsHscB protein has the amino acid sequence shown in SEQ NO:2, the invention discovers that the protein has obvious treatment effect on cholestatic liver fibrosis through extensive and intensive research, and can obviously improve liver function indexes of animals suffering from cholestatic liver fibrosis and pathological changes such as inflammatory cell infiltration, bile duct hyperplasia, bile duct peribiliary liver fibrosis and the like through the protein treatment; meanwhile, the invention can obviously reduce the level of inflammatory factors (such as IL-6, MCP-1 and the like) in a cholestatic hepatic fibrosis animal model; therefore, the application prospect and value of the drug field for treating cholestatic hepatic fibrosis containing the rCsHscB protein provided by the invention are very high.

Description

Application of clonorchis sinensis recombinant protein CsHscB in cholestatic liver fibrosis treatment drug

Technical Field

The invention belongs to the field of biotechnology, and particularly relates to application of clonorchis sinensis recombinant protein CsHscB in a cholestatic hepatic fibrosis treatment drug.

Background

Cholestatic liver fibrosis is a condition of liver fibrosis caused by the stagnation of bile flow or the failure of bile secretion and transport by hepatocytes and cholangiocytes, or cell injury and inflammation due to the obstruction of extrahepatic free bile flow and excretion pathways. Unlike non-biliary liver fibrosis, biliary liver fibrosis progresses faster, with abnormal proliferation of bile ducts and fibrosis around bile ducts. The curative effect of the medicament for treating intrahepatic cholestasis is not satisfactory clinically. Although the existing medicine for treating cholestatic liver fibrosis is ursodeoxycholic acid, the medicine has the phenomena of strong toxic and side effects and no response to partial patients. In order to improve the life quality of patients and reduce the fatality rate, the search for effective novel anti-cholestatic liver fibrosis drugs is urgently needed.

The establishment of the cholestatic liver fibrosis animal model provides a way for basic research and treatment research of cholestatic liver fibrosis and research of screening drugs for preventing and treating cholestatic liver fibrosis. Chronic DDC (3, 5-Diethoxycarbonyl-1, 4-dihydrogliadine, 3,5-Diethoxycarbonyl-1, 4-dihydro-uracil) feeding is a xenobiotic induced cholestatic liver fibrosis model, and the model is mainly characterized in that a mouse is fed with a feed containing 0.1% DDC, so that the DDC can increase the secretion of porphyrin substances, form porphyrin embolism, cause abnormal proliferation and degeneration necrosis of bile duct epithelial cells and liver cells, increase the expression of vascular adhesion molecules, osteopontin (OPN), tumor necrosis factor alpha (TNF-alpha) and the like in the bile duct epithelial cells, and finally form peribiliary fibrosis.

Molecular chaperones (CsHscB) from clonorchis sinensis, found by bioinformatic analysis to be members of the Co-chaperone (Co-chaperone hsc 20) family, which contains predominantly small Heat shock protein family members, are particularly important when cells are subjected to high temperatures or other stresses because they prevent the denaturation of unfolded proteins and promote the lytic renaturation of aggregated proteins, and many Molecular chaperones have been identified for the first time in organisms as Heat shock proteins (Hsp). The most clear of these studies is the Hsp70-DnaK system, which as a Co-chaperone modulates the activity of Hsp70 by enhancing the ATPase activity of Hsp 70. However, the mechanism of action of the CsHscB protein, one of the Hsp family members, in the immune regulation and pathological damage of the body to the infection of clonorchis sinensis is not clear.

Disclosure of Invention

The technical problem to be solved by the invention is to provide the clonorchis sinensis recombinant protein CsHscB, which can be used for treating hepatic fibrosis, specifically cholestatic hepatic fibrosis.

The purpose of the invention is realized by the following modes: by constructing a prokaryotic expression vector pET-28a-CsHscB, the clonorchis sinensis recombinant protein CsHscB (hereinafter referred to as rCsHscB) is induced, expressed and purified.

In particular to application of rCsHscB in a cholestatic hepatic fibrosis treatment drug.

As the application of the rCsHscB in the cholestatic hepatic fibrosis treatment drug, the rCsHscB contains CsHscB protein and His tag protein;

the sequence of the coding gene of the rCsHscB is shown as SEQ ID NO: 1. as shown.

As an optimization scheme of the application of the rCsHscB in the cholestatic liver fibrosis treatment medicine, the application of the rCsHscB comprises the following steps: the amino acid sequence of the rCsHscB protein is shown as SEQ ID NO: 2. as shown.

As an optimization scheme of the application of the rCsHscB in the cholestatic liver fibrosis treatment medicine, the application of the rCsHscB comprises the following steps: the amino acid sequence of the His tag protein is the amino acid sequence corresponding to the His tag protein coding sequence on the Pet-28a (+) plasmid: HHHHHHHH.

As an optimization scheme of the application of the rCsHscB in the cholestatic liver fibrosis treatment medicine, the application of the rCsHscB comprises the following steps: the N-terminus of the His-tag protein is linked to the C-terminus of the CsHscB protein.

The optimization scheme of the application of the rCsHscB in the cholestatic hepatic fibrosis treatment drug comprises the following steps: the CsHscB protein and the His tag protein are connected through a connecting peptide.

A medicament for the treatment of cholestatic liver fibrosis comprising the rchscb of claim 2.

The cholestatic liver fibrosis treatment drug also contains a pharmaceutically acceptable carrier.

The pharmaceutically acceptable carrier refers to a substance that is suitable for use in humans and/or animals without undue adverse side effects (such as toxicity, irritation, and allergic response), commensurate with a reasonable benefit/risk ratio.

Further, the pharmaceutically acceptable carrier is a pharmaceutically or comestibly acceptable solvent, suspending agent or excipient for delivering the rcshhcb of the invention to an animal or human. The carrier may be a liquid or a solid.

Further, the pharmaceutically acceptable carrier is various pharmaceutically commonly used adjuvants and/or excipients, including, but not limited to, saccharides (such as lactose, glucose and sucrose), starches (such as corn starch and potato starch), celluloses and derivatives thereof (such as sodium carboxymethylcellulose, ethyl cellulose and methyl cellulose), tragacanth powder, malt, gelatin, talc, solid lubricants (such as stearic acid and magnesium stearate), calcium sulfate, vegetable oils (such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cacao oil), polyols (such as propylene glycol, glycerin, sorbitol, mannitol and polyethylene glycol), alginic acid, emulsifiers (such as Tween, polyoxyethylene castor oil), wetting agents (such as sodium lauryl sulfate), colorants, flavors, tableting agents, stabilizers, antioxidants, preservatives, pyrogen-free water, isotonic saline solution, phosphate buffer solution and the like; the carrier can improve the stability, activity, bioavailability and the like of the formula according to needs.

When the invention is used as a preparation in cholestatic liver fibrosis drugs, the rCsHscB is used as the only effective component, or the rCsHscB is used as one of the effective components and can be mixed with one or more pharmaceutically acceptable carriers or excipients to prepare pharmaceutical dosage forms with different administration routes.

Further, the pharmaceutical preparation is in the form of a tablet, a capsule, a powder, a granule, a syrup, a solution, an oral liquid, a spirit, a tincture, an aerosol, a powder cloud, an injection, a sterile powder for injection, or a suppository. The above formulation types can be understood in terms of the relevant definitions in pharmacy (sixth edition, people health Press, toruford), and the preparation of the above formulations can be formulated in terms of the relevant formulations in pharmacy (sixth edition, people health Press, toford).

Compared with the prior art, the invention has the following beneficial effects:

the invention discovers that the rCsHscB has obvious treatment effect on cholestatic liver fibrosis for the first time through extensive and intensive research, and discovers the new application of the rCsHscB in preparing the medicine for treating cholestatic liver fibrosis for the first time.

Drawings

FIG. 1 shows the PCR result of the target gene of the clonorchis sinensis recombinant protein CsHscB (rCsHscB). Note: m is DNAmarker, lane 1 is rCsHscB PCR amplified fragment.

FIG. 2 shows the result of the plasmid sequence alignment of pET-28 a-CsHscB; note: query: sequencing results of pET-28a-CsHscB, sbjct: GAA34393.2 gene of interest.

FIG. 3 shows SDS-PAGE electrophoresis of different concentrations of IPTG induced rCsHscB expression; note: m is represented as a protein Marker; wherein,

1-4 are respectively 1.0, 0.6, 0.2 and 0 (mM) IPTG induced expression product precipitation extracts;

5-8 are respectively 1.0, 0.6, 0.2 and 0 (mM) IPTG induced expression product supernatant extract.

FIG. 4 shows an SDS-PAGE electrophoresis of rCsHscB purification; note: m is represented as a protein Marker; wherein,

1-2 are Binding buffer protein eluent respectively;

3-6 are 100, 200, 400, 500 (mM) imidazole protein eluents respectively.

FIG. 5 shows Western blot detection of rCsHscB; note: m is protein marker; wherein 1 is an anti-His monoclonal antibody.

Figure 6, shows that rchscb improves liver gross appearance in DDC-induced cholestatic liver fibrosis.

Figure 7, shows that rchscb ameliorated DDC-induced cholestatic liver fibrosis hepatopathological changes (H & E staining). Black arrows indicate bile duct epithelial cell proliferation and inflammatory cell infiltration.

Figure 8, shown as rchscb improves collagen fiber deposition (Masson staining) in DDC-induced cholestatic liver fibrosis figure 8A: liver collagen fiber deposition in each group of mice fig. 8B: masson staining image analysis results, by comparison with corresponding groupsp<0.05，***p<0.001。

FIG. 9 shows that rCsHscB improves liver function index in DDC-induced cholestatic liver fibrosis. FIG. 9A: ALT; FIG. 9B: AST, to respective group ratiop<0.001。

Figure 10, shows that rchscb reduces hydroxyproline content in DDC-induced cholestatic liver fibrosis. To respective group ratiop<0.05，***p<0.001。

Figure 11, shows that rchscb reduces the expression levels of fibrosis-associated proteins and mRNA levels in DDC-induced cholestatic liver fibrosis. FIG. 11A: western blot detection of expression levels of fibrosis-associated proteins in mouse liver tissue FIG. 11B: semi-quantitative analysis of related proteins fig. 11C: qRT-PCR detection in mouse liver tissuecol1Change in mRNA expression, by comparison with corresponding groupsp<0.001。

FIG. 12, shows that rCsHscB reduces DDC in cholestatic liver fibrosis induced by DDCEpithelial cell proliferation (CK 19). FIG. 12A: DDC model profile of CK19 in liver tissue of mice in each group 12B: semi-quantitative analysis of CK19 expression, by comparison with the corresponding groupsp<0.01，***p<0.001 。

Figure 13, shows that rchscb reduces the proliferation of hepatocytes in DDC-induced cholestatic liver fibrosis. FIG. 13A: DDC model profile of Ki67 in liver tissue of each group of mice 13B: semi-quantitative analysis of Ki67 expression, to respective groupsp<0.05，***p<0.001。

Figure 14, shows that rchscb reduces Osteopontin (OPN) levels in DDC-induced cholestatic liver fibrosis. FIG. 14A: DDC model profile of OPN in liver tissue of mice in each group 14B: semi-quantitative analysis of OPN expression, by comparison with corresponding groupsp<0.05，***p<0.001。

Figure 15, shows that rchscb reduces the expression of pro-inflammatory cytokines in DDC-induced cholestatic liver fibrosis. FIGS. 15A to 15B show the expression changes of the DDC models IL-6 and MCP-1 detected by ELISA, respectively. FIGS. 15C to 15D are respectively a model for detecting DDC by qRT-PCRtnfa、il1bThe mRNA level expression of (A) is changed, compared with the corresponding groupp<0.05，**p<0.01，***p<0.001。

FIG. 16, shows that rCsHscB inhibits TGF-. Beta.induced activation of hepatic stellate cells. Note: FIGS. 16A and 16B are graphs showing the effect of rCsHscB on expression of α -SMA protein after treatment of LX-2 cells; FIG. 16C is a graph of rCsHscB treated LX-2 cells in pairsACTA2The effect of gene expression; wherein TGF-beta 1 is 15 ng/ml; RSG rosiglitazone at 1. Mu.M; rCsHscB is 40 μ g/ml; ratio of respective groupsp<0.05。

Detailed Description

The present invention will be further described with reference to the following examples.

Example 1 preparation of clonorchis sinensis recombinant protein CsHscB

1. Construction of recombinant expression vectors

Primer design

A Primer premier 5 software is used for designing a specific Primer for amplifying the whole sequence of the clonorchis sinensis CsHscB protein coding gene by referring to a gene sequence (GenBank: DF 143487.1) of a Henan strain of the clonorchis sinensis.

Introducing a restriction enzyme site (GGATCC) of a restriction enzyme BamH I into an upstream primer P1, wherein the upstream primer P1 has the following sequence: 5' CAGCAAATGGGTCGCGGATCCATGTCATTTCGTCCGCACCA-.

The downstream primer P2 introduces a restriction site (CTCGAG) of a restriction endonuclease Xho I, and the sequence of the downstream primer P2 is as follows: 5 'GTGGTGGTGGTGGTGCTCGAGTTAATGCGGAGGAATCAACTGT-3'.

The upstream primer P1 and the downstream primer P2 are both synthesized by Shanghai Biotechnology Ltd.

The method for extracting the total RNA of the clonorchis sinensis polypide comprises the following specific operations:

(1) Collecting a plurality of adult clonorchis sinensis, fully grinding in a precooled mortar, and adding 1ml of Trizol;

(2) Slightly inverting and mixing, standing at room temperature for 5min;

(3) Centrifuging at 12000g for 5min at 4 ℃;

(4) Taking the upper water phase in a new ribozyme-free EP tube, and discarding the precipitate;

(5) Adding 200 μ l chloroform (0.2 times of RNAiso plus volume) into the supernatant, suspending thoroughly (vigorously vortexing until the solution is milky), and standing at room temperature for 5min;

(6) Centrifuging at 12000g for 15min at 4 ℃;

(7) Taking the supernatant to a new ribozyme-free EP tube, and discarding the precipitate;

(8) Adding 0.5ml of isopropanol (0.5-1.0 time of the volume of the RNAasso plus) into the supernatant;

(9) Standing at room temperature for 10min;

(10) Centrifuging at 12000g for 10min at 4 ℃;

(11) Taking the precipitate, and removing the supernatant;

(12) mRNA was washed by adding 1ml of pre-chilled 75% alcohol (volume equivalent to RNAiSo plus) to the pellet;

(13) Centrifuging at 7500g for 5min at 4 deg.C;

(14) The precipitate is left, the supernatant is discarded, and the washing is repeated once;

(15) Drying in air at room temperature for 5-10min, adding 50-100 μ l of RNAase-free ddH2O, and fully dissolving to obtain the total nucleic acid RNA.

(16) Integrity testing of RNA: mu.l of the total nucleic acid RNA extraction stock solution was added to 5. Mu.l of RNAase-free ddH ₂ O, adding 1. Mu.l of the loading buffer, mixing, performing 1% agarose gel electrophoresis (condition 180V, electrophoresis for 10 min), and observing by a gel imaging system.

(17) Concentration and purity detection of extracted total nucleic acid RNA

Measuring the concentration of the sample and the ratio of A260 to A280 by using a NanoDrop Lite spectrophotometer, and detecting the concentration and the purity of RNA; RNA with the ratio of A260/A280 of 1.8-2.0 is selected for reverse transcription.

Synthesis of cDNA by reverse transcription

Step (1) Total nucleic acid RNA plus PolyA reaction: 3.0 μ g, total nucleic acid RNA;1.0 μ l, oligo dT Primer (50 μ M); 1.0 μ l, dNTP mix (10 μ M); adding ribozyme-free water to 10 μ l; the reaction mixture was incubated in a 65 ℃ water bath for 5min and immediately cooled on ice (very important) to give 10. Mu.l of the reaction product.

Step (2) reverse transcription: and centrifuging briefly to collect wall-hanging liquid drops, and adding the following components: 10.μ l of the reaction product of step (1) above; 4.0 μ l, 5 × PrimeScriptII Buffer;0.5 μ l, RNase Inhibitor (40U/. Mu.l); 1.0 μ l, primeScriptII Rtase (200U/. Mu.l); ribozyme-free water was made up to a total volume of 20. Mu.l.

And (3) gently mixing the mixture by using a pipette, centrifuging the mixture for 10s for a short time, and then putting the mixture into a water bath kettle at the temperature of 50 ℃ for warm bath for 50min.

And (4) placing the mixture in another water bath kettle which is heated to 95 ℃ in advance, and carrying out water bath for 5min to terminate the reaction.

And (5) cooling to normal temperature on ice to finally obtain cDNA, and performing subsequent experiments or freezing and storing at-80 ℃.

PCR amplification of target genes

(1) A50. Mu.l PCR reaction system included: 1.0. Mu.l of the cDNA obtained above; 10.0 μ l, phusion HF (5 ×); 5.0 μ l of dNTPs (2 mM); 2.5 μ l, upstream primer P1;2.5 μ l, downstream primer P2;0.5 μ l, high fidelity DNA polymerase; the ribozyme-free water was made up to 50. Mu.l.

(2) And lightly mixing the 50 mu l of the PCR reaction system uniformly, performing on-machine amplification after short centrifugation (time of 10 s), wherein the amplification parameters are pre-denaturation at 98 ℃ for 2min, denaturation at 98 ℃ for 5s, annealing at 68 ℃ for 30s, extension at 72 ℃ for 1min, performing 30 cycles, and preserving heat at 72 ℃ for 5min after the last cycle to finally obtain a PCR nucleic acid amplification product I containing the HscB base sequence, and storing at 4 ℃.

Identification of PCR nucleic acid amplification product I containing CsHscB base sequence by agarose gel electrophoresis

(1) Preparation of 1.0% (W/V) agarose gel: weighing 1g of electrophoresis-grade agarose, adding the agarose into a triangular flask containing 100ml of 0.5 XTAE electrophoresis buffer solution, and heating the agarose for 30s in a microwave oven to completely dissolve the agarose; when the gel is cooled to 50 ℃,5 μ l of biotin is added, the gel is poured after shaking up, and the gel is placed for 15min at room temperature to solidify the gel.

(2) Electrophoresis: mixing the PCR nucleic acid amplification product I containing the HscB base sequence with 5 mul and 1 mul and 6 Xloading buffer solution (purchased from Tiangen Biochemical technology (Beijing) Co., ltd.) uniformly, and loading into gel loading wells; meanwhile, a nucleic acid standard (Marker, available from Tiangen Biotechnology (Beijing) Ltd.) was added as a reference, and electrophoresis was carried out for 30min at a constant voltage of 3 to 4V/cm.

(3) And (4) observation: after electrophoresis, the fragment is observed under an ultraviolet lamp and photographed for storage, as shown in FIG. 1, the fragment is shown to be located between 800bp and 1000bp of nucleic acid standard molecular weight (Marker), approximately 852bp, and is consistent with the size of the expected target fragment.

Purification and recovery of PCR nucleic acid amplification product I containing CsHscB base sequence

(1) Cutting off the gel (100 mg) containing the target fragment under a long-wave ultraviolet lamp, and weighing in a 1.5ml EP tube;

(2) PCR nucleic acid amplification product I containing HscB base sequence was purified according to the instruction of PCR product recovery kit of OMEGA, hereinafter abbreviated as: a PCR product I containing an HscB base sequence;

(3) The purified DNA fragment (4. Mu.l) was subjected to 1% agarose gel electrophoresis, and the recovery result was observed.

(4) And (3) sending the DNA fragment obtained in the step (3) to Shanghai bioengineering technology GmbH for sequencing, wherein a sequencing sequence is an encoding gene sequence of the rCsHscB, and is shown as SEQ ID NO:1 is shown.

Gene cloning (T/A cloning) and identification

(1) Ligation of pEASY-T1 Simpe Cloning Vector with CsHscB

The cloning reaction system is as follows: 4.0 Mu l of PCR product I containing HscB base sequence; 1.0 μ l, pEASY-T1 Simpe Cloning Vector; gently mixing, and reacting at room temperature for 10min; finally, a ligation product, namely pEASY-T1-CsHscB plasmid is obtained, and after the reaction is finished, the centrifuge tube filled with the ligation product is placed on ice.

Transformation and characterization of plasmids

(1) Adding 5 mul of ligation product, namely pEASY-T1-CsHscB plasmid, into a centrifuge tube containing 50 mul of competent cell DH-5 alpha, gently rotating to mix the content evenly, and placing in ice for 30min;

(2) Placing the centrifuge tube in a 42 deg.C water bath for 90s without shaking the tube;

(3) Quickly transferring the centrifugal tube into an ice bath, and cooling for 2-3 min;

(4) Adding 400 mul of LB liquid culture medium into the centrifuge tube, transferring the centrifuge tube to a 37 ℃ shaking bed, and incubating for 60min to recover the cells;

(5) Centrifuging at 13000r/min for 30s at room temperature, removing part of supernatant, utilizing the rest part of liquid to resuspend cells, and uniformly coating the cells in LB solid culture medium containing kanamycin resistance with the concentration of 50 mu g/ml;

the LB solid medium formula in the step is as follows: an LB solid medium containing 1.5% agar, wherein the amount of 1.5% agar is 1.5% of the mass of the LB solid medium, and after thawing the LB solid medium, 50mg/ml kanamycin is added at 50 ℃ to a final concentration of 50. Mu.g/ml kanamycin;

(6) Inverting the plate, culturing at 37 ℃ for 12 to 1693 h, and then generating bacterial colonies;

(7) Selecting a single white colony, inoculating the single white colony to 5ml of LB liquid culture medium containing 50 mu g/ml kanamycin, transferring the single white colony to a shaker at 37 ℃, and culturing the single white colony overnight at 200 r/min; obtaining a bacterial liquid containing pEASY-T1-CsHscB plasmid;

(8) 2ml of fresh bacterial liquid sample containing pEASY-T1-CsHscB plasmid is collected and sent to Shanghai bioengineering technology, inc. for sequencing. The sequencing sequence is shown as SEQ ID NO:1 is shown.

Subcloning the gene fragment into pET-28a (+) expression vector and identifying

(1) Extracting plasmids according to the specification of the Tiangen high-purity plasmid miniextraction kit;

(2) Taking pEASY-T1-CsHscB plasmid as a template to carry out PCR amplification, wherein the reaction system of the amplification is as follows: (1) 50. Mu.l PCR reaction system comprising: 1.0 Mu.l of the plasmid pEASY-T1-CsHscB obtained above; 10.0 μ l, phusion HF (5 ×); 5.0 μ l of dNTPs (2 mM); 2.5 μ l, upstream primer P1;2.5 μ l, downstream primer P2;0.5 μ l of high fidelity DNA polymerase; the ribozyme-free water was made up to 50. Mu.l.

And lightly mixing the 50 mu l of the PCR reaction system uniformly, centrifuging the mixture for a short time (10 s), performing amplification on the mixture on a machine, wherein the amplification parameters are pre-denaturation at 98 ℃ for 2min, denaturation at 98 ℃ for 5s, annealing at 68 ℃ for 30s, extension at 72 ℃ for 1min, performing 30 cycles, and performing heat preservation at 72 ℃ for 5min after the last cycle to finally obtain a PCR nucleic acid amplification product II containing the HscB base sequence, and storing the PCR nucleic acid amplification product II at 4 ℃.

Identifying a PCR nucleic acid amplification product II containing the CsHscB base sequence by agarose gel electrophoresis:

(1) Preparation of 1.0% (W/V) agarose gel

Weighing 1g of electrophoresis-grade agarose, adding the agarose into a triangular flask containing 100ml of 0.5 XTAE electrophoresis buffer solution, and heating the agarose for 30s in a microwave oven to completely dissolve the agarose; when the gel is cooled to 50 ℃,5 μ l of biotin is added, the gel is poured after shaking up, and the gel is placed for 15min at room temperature to solidify the gel.

(2) Electrophoresis

Mixing the PCR nucleic acid amplification product II containing the HscB base sequence with 5 mul and 1 mul of 6 Xloading buffer solution (purchased from Tiangen Biochemical technology (Beijing) Co., ltd.), and adding into the gel loading hole; meanwhile, a nucleic acid standard (Marker, available from Tiangen Biotechnology (Beijing) Ltd.) was added as a reference, and electrophoresis was carried out for 30min at a constant voltage of 3 to 4V/cm.

(3) Observation of

After electrophoresis is finished, the fragment is observed under an ultraviolet lamp and photographed for storage, and the fragment is displayed to be positioned between 800bp and 1000bp of nucleic acid standard molecular weight (Marker), about 852bp and is consistent with the size of an expected target fragment.

And (3) purifying and recovering a PCR nucleic acid amplification product II containing a CsHscB base sequence:

(1) Under a long-wave ultraviolet lamp, the gel (100 mg) containing the target fragment is cut off and placed in a 1.5ml EP tube for weighing;

(2) The PCR nucleic acid amplification product II containing the HscB base sequence was purified according to the instructions of the kit for recovering PCR products of OMEGA, hereinafter referred to as: a PCR product II containing an HscB base sequence;

(3) The purified DNA fragment (4. Mu.l) was subjected to 1% agarose gel electrophoresis, and the recovery result was observed.

(3) And carrying out recombination reaction on a PCR product II containing the HscB base sequence and a double-enzyme digestion product of pET-28a (+) according to the instruction of a Novozan One Step Cloning kit to obtain a recombinant plasmid containing the CsHscB gene fragment, and naming the recombinant plasmid as pET-28a-CsHscB. The enzyme digestion product is sent to Shanghai bioengineering technology Limited company for sequencing, and the sequence is compared by Blast, and the similarity of the sequence disclosed by NCBI database is 100%, as shown in figure 2.

2. Construction of recombinant bacteria

1. Recombinant plasmid pET-28a-CsHscB transformation expression bacterium

(1) Adding 5 mul of pET-28a-CsHscB plasmid into a centrifuge tube containing 50 mul of BL-21 bacterial liquid, slightly rotating to uniformly mix the content, and placing in ice for 30min;

(2) Then placing the centrifuge tube in a water bath kettle at 42 ℃ for 90s without shaking the test tube;

(3) Quickly transferring the centrifugal tube into an ice bath, and cooling for 2-3 min;

(4) Adding 400 mul of LB liquid culture medium into the centrifuge tube, transferring the centrifuge tube to a shaking bed at 37 ℃, and incubating for 60min to recover the cells;

(5) Centrifuging at room temperature for 30s at 13000r/min, removing part of supernatant, utilizing the rest part of liquid to resuspend cells, and uniformly coating the cells in LB solid culture medium containing kanamycin with the concentration of 50 mug/ml;

the LB solid medium in the above refers to: LB solid culture medium containing 1.5% agar, wherein 1.5% agar means agar accounts for 1.5% of the mass of the LB solid culture medium;

after melting the LB solid medium, adding 50mg/ml kanamycin at 50 ℃ to ensure that the concentration of the kanamycin in the LB solid medium is 50 mu g/ml, thus obtaining the LB solid medium containing 50 mu g/ml kanamycin;

(6) Inverting the plate, culturing at 37 ℃ for 12 to 1693 h, and then generating bacterial colonies;

(7) Selecting a single white colony, inoculating the single white colony to 5ml of LB liquid culture medium containing 50 mu g/ml kanamycin, transferring the single white colony to a 37 ℃ shaking table, and culturing the single white colony overnight at 200 r/min; obtaining a bacterial liquid containing pET-28a-CsHscB plasmid, which is called BL21-pET-28a-CsHscB bacterial liquid for short; the coding amino acid sequence of BL21-pET-28a-CsHscB bacterial liquid recombinant protein, namely the amino acid sequence of CsHscB protein is shown as SEQ ID NO:2, respectively.

BL-21 was transformed with the empty plasmid pEt-28a in the same manner to obtain a control BL21-pET-28a strain.

Expression in E.coli

(1) And (3) thallus amplification: respectively selecting BL21-pET-28a bacterial liquid and BL21-pET-28a-CsHscB bacterial liquid for cloning;

the specific cloning method comprises the following steps: placing in 5ml LB liquid culture medium containing 50 mug/ml kanamycin, shaking culturing at 37 deg.C and 200r/min overnight;

inoculating 5ml of overnight cultured bacterial liquid to 500ml of LB liquid culture medium containing 50 mu g/ml of kanamycin, and performing shake culture at 37 ℃ and 200r/min until OD600 is approximately equal to 0.6;

(2) And (3) inducing expression: collecting non-induced culture, storing in refrigerator, adding Isopropyl-beta-D-Thiogalactopyranoside (IPTG) to 1mmol/L, and shake culturing at 16 deg.C and 120r/min for 10 hr;

(4) Preparing crude protein: centrifuging thalli at 4 ℃ at 12000r/min for 5min, weighing wet weight of precipitated thalli, and adding 5 to 10ml of Binding buffer into each gram of precipitated thalli for resuspension; performing ultrasonic disruption in ice bath for 10min, centrifuging at 4 deg.C and 12000r/min for 5min, collecting supernatant, and filtering with 0.22 μm filter to remove impurity particulate matter to obtain crude rCsHscB;

wherein, the Binding buffer comprises the following components: 500mM, naCl,10 mM, na ₂ HPO ₄ •12H ₂ O，10 mM、NaH ₂ PO4•2H ₂ O,20 mM, imidazole. As shown in FIG. 3, rCsHscB was detected in the supernatant and the cells of the culture medium by SDS-PAGE gel with different concentrations of IPTG induction, and was about 36kDa, as shown in FIG. 3.

Purification and characterization in E.coli

(1) Crude rcsHscB purification

According to the operating steps of a 196KTA design chromatography system, firstly, binding buffers are used for balancing HisTrap FF column materials, then the prepared crude rCsHscB is combined with the HisTrap FF column materials, a large number of Binding buffers are used for eluting non-specifically combined hybrid proteins, imidazole (with the concentration of 100 mM, 200 mM, 400 mM and 500 mM) elusion buffers with different concentrations are used for eluting target proteins, and eluent and flow-through liquid are sequentially collected to obtain purified rCsHscB;

the Elution buffer formula is as follows: 500mM, naCl;10mM, na2HPO4.12H2O;10 mM, naH2PO4.2H2O;100 to 500mM, imidazole.

（2）SDS-PAGE

Sample preparation: sucking appropriate amount of purified rCsHscB and transudate, adding protein loading buffer solution with final concentration of 1 ×, heating at 100 deg.C for 5min, and centrifuging at 12000r/min at room temperature for 1min;

preparation of PAGE gel: adding 5ml of separation gel (the concentration is 12.5%), adding 3ml of concentration gel (the concentration is 4%) after solidification, inserting a comb, pulling out the comb after solidification, and cleaning a sample adding hole by using Running buffer;

loading: respectively loading 20 mu l of crude rCsHscB and purified rCsHscB, and leaving a protein Marker on a sample adding hole;

electrophoresis: electrophoresis is carried out at a voltage of 60V for about 45min until the indicator reaches the junction of the two gels, the voltage is raised to 120V, and electrophoresis is carried out for about 1.5h (until bromophenol blue migrates to a position about 1cm away from the bottom of the separation gel);

dyeing and shooting: the gel block was removed and stained with Coomassie Brilliant blue for 1h, destained with destaining solution for about 2h, and recorded photographically with a gel imaging system.

After purification, an expression band of rCsHscB was observed after SDS-PAGE separation of the product (see FIG. 4), and the protein molecular weight was about 36kDa, which was consistent with the predicted size.

Identification in E.coli

Identifying rCsHscB by Western blot technology

(1) Film transferring: after a wet transfer device is installed, transferring protein to a PVDF membrane by electricity at 80mA for 1.5 h;

(2) And (3) sealing: sealing a PVDF separation membrane for 5 hours at room temperature by TBST containing 5% skimmed milk;

(3) Primary anti-reaction: mouse anti-histidine tag (His-tag) IgG (1) was added and incubated overnight at 4 ℃;

(4) And (3) secondary antibody reaction: after washing the membrane with TBST (10 min/time, 4 times of washing), incubating with horseradish peroxidase-labeled goat anti-mouse IgG (1;

(6) Observation and recording: washing the membrane with TBST (10 min/time, 4 times), developing with ECL luminescent reagent, exposing, and taking picture for recording.

As shown in FIG. 5, the purified rCsHscB has a single band near 36KDa identified by Western blot, and is fused to express His tag protein.

Concentration, endotoxin removal and concentration measurement of

Concentrating and replacing buffer solution

(1) By ddH ₂ Washing an Amicon Ultra-15 10K Ultra-filtration column by using O;

(2) adding no more than 15ml of purified rCsHscB to the ultrafiltration device;

(3) placing the ultrafiltration device covered with the cover into a bucket rotor centrifuge, and rotating at 4 deg.C and 4000g for 20min;

(4) adding PBS into the upper layer concentrated solution, and rotating for 20min at 4000 g;

(5) repeating the steps (2) to (4) for 2 to 3 times;

(6) recovering the concentrated solution.

Endotoxin removal and assay

And (3) removing the endotoxin in the concentrated recombinant CsHscB according to the specification steps of the Tianeze liquid phase endotoxin remover, and detecting the content of the endotoxin in the rCsHscB by using an endotoxin quantitative kit of a Tianeze end-point color development method.

The content of endotoxin is less than 0.05EU/ml by detecting with a chelate reagent endotoxin quantitative kit.

Protein concentration determination

Filtering the rCsHscB protein by a 0.22 mu m filter, measuring the content of the rCsHscB according to the procedure of a BCA method protein concentration measuring kit, measuring the concentration to be 0.8mg/ml, and subpackaging at-80 ℃ for storage.

Example 2: rCsHscB improves DDC-induced cholestatic liver fibrosis

1. Establishment and grouping of cholestatic liver fibrosis animal model

Experimental animals: c57BL/6 mice used for experiments are purchased from Beijing Befort biotechnology, female, the week number is 6-8 weeks, the weight is 20-30 g, the SPF level is kept in an SPF level animal room of Xuzhou medical university, sufficient food and light are ensured during the feeding period, and the proper temperature and humidity are ensured.

Grouping of laboratory mice

Before establishing a model mouse, the incorporated experimental mice are grouped, 24 mice are selected and divided into a PBS group, a rCsHscB group, a DDC group and a (DDC + rCsHscB) group according to the principle of a random distribution method, and each group of the mice comprises 6 mice. (it indicates that the rCsHscB as described in the whole text refers to the clonorchis sinensis recombinant protein CsHscB).

Modeling method for induced cholestatic liver fibrosis

The PBS group and the rCsHscB group were orally administered with an appropriate amount of physiological saline, and each mouse of the DDC group was fed with a mouse diet containing 0.1% DDC per day, (DDC + rCsHscB) by additionally administering rCsHscB treatment (1.5 mg/kg body weight, intraperitoneal injection, once every three days) on the same treatment as the DDC group, and the PBS group and the rCsHscB group were administered with the same amounts of PBS and rCsHscB under normal diet. Mice were killed by dissection 4w after molding. Observing each group of mice, separating livers, observing the gross pathological changes of the livers of the mice by naked eyes, and finding out that: the liver of the PBS group and the rCsHscB group mice are bright red, smooth in surface, clear in interface and soft in quality. DDC group mice have obvious liver congestion and swelling, black brown color, granular feeling on the surface and tough texture. In the mice of the (DDC + rCsHscB) group, the liver congestion and swelling are obviously reduced, the color is dark red, the surface has no granular sensation, and the texture is slightly tough (see figure 6).

2. Sample collection and processing

Collecting liver tissue samples

4w after the model is made, blood is taken from the eyeball, and the eyeball is killed by a neck breaking method; the thoracic cavity was opened from the mouse abdominal leucorrhea with an ophthalmic scissors to expose the liver tissue, the gallbladder of the liver was removed with scissors, and the liver tissue was removed. Separating serum, centrifuging eyeball blood at 3500r/min and 4 deg.C for 15min, and packaging at-80 deg.C.

Placing the taken liver tissue on a glass block on ice, taking a liver tissue block (1 cm multiplied by 1 cm) at a position 4mm away from the edge of the liver tissue, putting the liver tissue block into a 4% paraformaldehyde solution for fixing for HE staining, cutting the rest liver tissue into a plurality of blocks (1 cm multiplied by 1 cm), and freezing and storing the blocks in a refrigerator at the temperature of-80 ℃ for later use.

Dyeing process

To study the pathological damage of the liver caused by DDC-induced C57BL/6 mice, we performed pathological observations of the liver using conventional HE staining. The results are shown in fig. 7, the liver lobules of the PBS group and the rCsHscB group which are independently injected are complete, the boundary is clear, the structure of liver cells is complete and full, and bile duct hyperplasia is not found; and inflammatory cells such as neutrophils, monocytes and the like infiltrate around the central vein of the DDC model group, the bile duct is thickened and enlarged, the hyperplasia is obvious, protoporphyrin embolism is formed in the bile duct, and the obstruction of the bile duct accompanied with the hyperplasia is shown. The collagen fibers are increased, so that obvious fiber intervals can be seen, and fibroblasts are gathered around the bile duct, which indicates that hepatic fibrosis occurs. In contrast to the DDC group, the rchschscb treated group (DDC + rchschscb group) had decreased inflammatory cell infiltration in the liver, decreased bile duct hyperplasia, decreased porphyrin embolization in the bile duct, and decreased numbers of fibroblasts aggregated around the bile duct. The results show that the rCsHscB treatment can obviously reduce inflammatory cell infiltration and bile duct epithelial cell proliferation caused by DDC.

Dyeing process

In order to observe the deposition of the collagen fibers in the liver of each group of mice, masson staining (Masson staining kit purchased from Nanjing institute of bioengineering) is carried out on the liver tissues of each group of mice, and the Masson staining of the liver tissues of the mice is observed by using a common optical microscope, so that the results are shown as follows: the hepatic lobule structure of the hepatic tissue of the normal group of mice (PBS group and rCsHscB group) is clear and complete, the hepatic cells are arranged in a radial way by taking the central vein as the center, collagen fibers are not proliferated, a small amount of collagen fibers in the central vein and the hepatic sinus internal collecting duct area are distributed, and the vascular walls of the collecting duct area and the central vein area are blue. The mouse liver lobule of the model group (DDC group) is disordered, collagen fibers are obviously deposited, blue deposition is obviously formed around the dilated bile duct along the trend of the bile duct, and the blue area is obviously increased compared with the control group through analysis of Image J software, thereby prompting that the collagen fiber deposition is increased around the bile duct (figure 8A). After the treatment of the rchschb, the improvement is obvious, the deposition area of the collagen fibers around the bile duct is reduced, the fibrosis degree is reduced (fig. 8A and B,P<0.05）。

ALT and AST detection in serum

After the collected blood is stood for coagulation, the blood is centrifuged at 3500r/min for 15min, and serum is separated and immediately detected. ALT and AST contents in serum were measured by a full-automatic biochemical analyzer, provided by the laboratory department of the subsidiary hospital of Xuzhou medical university.

As shown in FIG. 9, it was found that liver damage was evident after DDC administration, and serum alanine Aminotransferase (ALT) and aspartate Aminotransferase (AST) levels were both significantly increased (seeP<0.001 And, after treatment with rchscb, both ALT (shown in figure 9A) and AST (shown in figures 9a, b),P<0.001). The result shows that the rCsHscB can obviously reduce the liver damage index caused by DDC.

Determination of hydroxyproline (Hyp) content in liver tissue

The PBS group, the rCsHscB group, the DDC group and the (DDC + rCsHscB) group are weighed by an electronic balance, liver tissues with the wet weight of 50-100 mg are placed into each test tube, and hydroxyproline in the liver of the mouse is detected according to a commercial hydroxyproline detection kit (purchased from Nanjing institute of bioengineering).

Hydroxyproline is an important index reflecting the degree of liver fibrosis, and the result is shown in fig. 10: hydroxyproline in mouse liver after DDC induction is obviously higher than that in normal control group (P<0.001 ); after the treatment of the rCsHscB, the content of hydroxyproline in the liver of the mice is obviously reduced compared with the DDC group, and the difference has statistical significance (P<0.05）。

Fibrosis related index in mouse liver tissuecol1 andalpha-SMA protein expression assay

Liver tissues of each group of mice were taken, total RNA was isolated using a TrolLS reagent (Invirtogen, karlsruhe, german), and then reverse-transcribed into cDNA using a QuantiTectReverse Transcription kit (purchased from Beijing Tiangen Biotech Co., ltd.). The relative amount of gene expression was measured using cDNA transcribed from SYBR greenqPCR master mix according to the instructions for the operation (Roche). The expression of the gene was detected in real time using an iCycler thermal cycling System and iQ5 optical System software (Roche). RT-PCR experiments were carried out using conventional methods, and primers for detecting gene expression were:

col1F：CAGGGTATTGCTGGACAACGTC

col1R：GGACCTTGTTTGCCAGGTTCA

β-actin F：AACTCCATCATGAAGTGTGA

β-actin R：ACTCCTGCTTGCTGATCCAC

the liver tissue is cracked by RIPA, the total protein content is detected by BCA, the expression condition of alpha-SMA protein in the liver of each group of mice is detected by conventional Western blot, beta-actin is taken as an internal reference, alpha-SMA, beta-actin primary antibody and corresponding secondary antibody are added, incubation is carried out, and the protein expression level of alpha-SMA is determined.

alpha-SMA is a hepatic stellate fineAs for the sign of activation of cellular HSC, the expression condition of alpha-SMA protein in the liver of each group of mice is detected by using conventional Western blot. As a result, it was found that: compared with a control group, the protein expression level of the alpha-SMA of the mice is obviously increased after DDC infection, and the statistical difference is significant (p<0.001, as in fig. 11), and the mouse α -SMA is significantly reduced after rCsHscB treatment (p<0.001）。

The qRT-PCR results show that the DDC model group is compared with the normal groupcol1（p<0.001 Increased mRNA expression level of); after rCsHscB treatmentcol1（p<0.001 Reduced mRNA expression level (FIG. 11C).

Immunohistochemical detection of bile duct epithelial cell proliferation

In order to analyze whether the rCsHscB protein can relieve the proliferation condition of bile duct epithelial cells caused by DDC, liver tissues of all groups of mice are taken for immunohistochemical staining. Liver tissue sections were boiled in citrate buffer for 15 minutes to extinguish endogenous peroxidase. 1% methanol by volume inhibits peroxidase for 15 minutes and is incubated with 10% normal goat serum (available from Biyuntian Biotechnology Co., ltd.) to prevent nonspecific immunoglobulin binding. The monoclonal antibodies used were CK19, ki67 and OPN (both from eBioscience, inc., CA, US) labeled for biliary epithelial cell proliferation, respectively. Cell counting was performed using image pro plus6 (ipp 6) software.

It was found that CK19 was present 4 weeks after DDC feeding (see fig. 12a, b;p<0.001 Ki67 (see fig. 13a, b;p<0.001 OPN (see fig. 14a, b;p<0.001 Significantly increased, whereas CK19 was present in peri-vascular and biliary epithelial cells after rcshchb treatment (see fig. 12a, b;p<0.01 Ki67 (see fig. 13a, b;p<0.01 OPN (see fig. 14a, b;p<0.05 Positive expressing cells were significantly reduced and the differences were statistically significant.

Expression of inflammatory factors in liver tissue of mice

In order to detect the expression of inflammatory factors in liver tissues of various groups of mice, IL-6, MCP-1 and T in liver tissue homogenate were detected by ELISANF-alpha and IL-10 contents (the experimental steps refer to the kit instruction), and the conventional qRT-PCR is adopted to detecttnfa、il1bThe relative expression of the cytokine genes was equal, and as a result, it was found that the pro-inflammatory cytokine IL-6 in liver tissue of mice in DDC model group (fig. 15A;p<0.05 MCP-1 (fig. 15B;p<0.01）、tnfa(FIG. 15C;p<0.05）、il1b(FIG. 15D;p<0.05 ) also increased significantly. Following rchscb treatment, IL-6 (fig. 15A;p<0.001 MCP-1 (fig. 15B;p<0.001）、tnfa(FIG. 15C;p<0.05）、il1b(FIG. 15D;p<0.05 All are significantly reduced. The rCsHscB protein can inhibit the expression of proinflammatory factors of mouse liver tissues induced by DDC.

The qRT-PCR primer sequence is shown below, and the primer is designed and synthesized by Shanghai Jieli bioengineering Co.

β-actin F：AACTCCATCATGAAGTGTGA

β-actin R：ACTCCTGCTTGCTGATCCAC

TnfaF： CTTGTTGCCTCCTCTTTTGCTTA

TnfaR： CTTTATTTCTCTCAATGACCCGTAG

Il1bF： TGTGTTTTCCTCCTTGCCTCTGAT

Il1bR： TGCTGCCTAATGTCCCCTTGAAT

Example 3: rCsHscB can inhibit activation of hepatic stellate cell

1. Cell culture of hepatic stellate cell LX-2

LX-2 cells were purchased from Xiangya medical college of Wuhan university of science and technology, and after conventional recovery, cells in logarithmic phase were digested with 0.25% pancreatin, centrifuged, resuspended, counted and inoculated into 6 cm culture dishes, and the cells were plated at 4X 10 ⁵ Density inoculation per mL. (6) Experimental grouping and cell treatment:

after LX-2 is attached for 24h, PBS, TGF-beta 1 (15 ng/mL) + CsHscB (35 ug/mL), TGF-beta 1 (15 ng/mL) + RSG (1 μ M) are added into the culture dish, and DMEM is added to make up for 2 mL. Standing at 37 deg.C for 5% CO ₂ Culture boxThe culture is continued. Adding 1mL of Trizol after 24 hours, uniformly mixing, and storing at-80 ℃ for RNA extraction; adding pancreatin for digestion, centrifuging, adding PBS for washing, and storing at-80 deg.C for protein and total RNA extraction.

qRT-PCR and western-blot are respectively used for detecting the expression of hepatic stellate cell activation marker alpha-SMA

Each group of treated cells was taken, total RNA was isolated using a TrolLS reagent (Invirtogen, karlsruhe, german), and then reverse-transcribed into cDNA using a QuantiTectReverse Transcription kit (purchased from Beijing Tiangen Biotech Co., ltd.). The relative amount of gene expression was measured using cDNA transcribed from SYBR greenqPCR master mix according to the instructions for the operation (Roche). The expression of the genes was detected in real time using an iCycler thermal cycling system and iQ5 optical System software (Roche). RT-PCR experiments were carried out using conventional methods, and primers for detecting gene expression were:

β-actinF： GCCCTGAGGCACTCTTCCA

β-actinR： TTGCGGATGTCCACGTCA

ACTA2F： TTCATCGGGATGGAGTCTGCTGG

ACTA2R： TCGGTCGGCAATGCCAGGGT

the qRT-PCR primer is designed and synthesized by Shanghai Czeri bioengineering GmbH.

And (2) lysing the cell precipitate by using RIPA, detecting the content of total protein by using BCA, detecting the expression condition of alpha-SMA protein in each group of HSCs by using conventional Western blot, adding alpha-SMA, beta-actin primary antibody and corresponding secondary antibody by using beta-actin as an internal reference, incubating, and determining the protein expression level of the alpha-SMA. Western blot and qRT-PCR detection show that the rCsHscB can obviously reduce the expression of LX-2 cell alpha-SMA caused by TGF-beta 1, and when the concentration of the rCsHscB is 40 mug/ml,ACTA2（the gene coding for the alpha-SMA protein) is significantly reduced, and the difference has statistical significance: (p<0.05, FIG. 16C), as well as the protein expression level of α -SMA (p<0.05, fig. 16A and 16B). The literature indicates that the agonist Rosiglitazone (RSG) of PPAR γ can reverseActivation of hepatic stellate cells can reduce hepatic fibrosis, so people select RSG as a positive control, and as can be seen from FIG. 16A, RSG and rCsHscB can both reduce expression of hepatic stellate cells alpha-SMA, which shows that rCsHscB can obviously inhibit activation of hepatic stellate cells in vitro.

While the preferred embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that the invention is not limited thereto, and that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> Xuzhou university of medicine

Application of clonorchis sinensis recombinant protein CsHscB in cholestatic liver fibrosis treatment drug

<130> 2

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 852

<212> DNA

<213> Clonorchis sinensis (Clonorchis sinensis)

<400> 1

atgtcatttc gtctcgcacc atcaatcacg cgatttcgac ggatatggac gaactcactg 60

ccatcgtacc tttcaagctt ttgcctcata gcctgtcaac ctcagcatac aattttatgg 120

acacacgaaa acataaccac ccatccattc ccacgaatgt tttgcactct tccttcgaac 180

aaacgccaat gctggaattg taaccgtcca gtacgggaca acgaattttt ttgtgagtgt 240

ggtaaaattc agcctgtgga acgggattgg acttactttg aagtccttgg ttatggcgaa 300

cccacagttc atattgacct tgcagacctg gcgcagcgca tgcgtgagat gcagaaacgt 360

ttgcacccag ataaattttc ccgtgccacg ccatacgaac aagaactggc tgcagatgcc 420

gccactttcg taaatcgtgc gtatgctatg ttagaacaac ctgaaagtcg tttcgcctac 480

tttctgtccc tgcatcatcc ctcggaggac gcatcaccaa acacggacat tctggaccca 540

gacttcctaa ctgaaatgct cgagctcaat gaagagattg aggaattttc agaattgctt 600

actgcagtta aggagaaaag gcacgaggct tccaagttat ccgtattatt gaaggagttg 660

cttcatagaa tttcacagga cctaatgaca gaacgtgcca aactagtgac agctcttgat 720

gaagctaggt ggaaggatgc tcaagcttta ctcaataagt gtaggtacct ttcacggact 780

tttgatcgtc tcaaagaata tgagctggat tggcgtagag ttggtattac agttgatatt 840

cctccgcatt aa 852

<210> 2

<211> 282

<212> PRT

<213> Clonorchis sinensis (Clonorchis sinensis)

<400> 2

Met Ser Phe Arg Leu Ala Pro Ser Ile Thr Arg Phe Arg Arg Ile Trp

1 5 10 15

Thr Asn Ser Leu Pro Ser Tyr Leu Ser Ser Phe Cys Leu Ile Ala Cys

20 25 30

Gln Pro Gln His Thr Ile Leu Trp Thr His Glu Asn Ile Thr Thr His

35 40 45

Pro Phe Pro Arg Met Phe Cys Thr Leu Pro Ser Asn Lys Arg Gln Cys

50 55 60

Trp Asn Cys Asn Arg Pro Val Arg Asp Asn Glu Phe Phe Cys Glu Cys

65 70 75 80

Gly Lys Ile Gln Pro Val Glu Arg Asp Trp Thr Tyr Phe Glu Val Leu

85 90 95

Gly Tyr Gly Glu Pro Thr Val His Ile Asp Leu Ala Asp Leu Ala Gln

100 105 110

Arg Met Arg Glu Met Gln Lys Arg Leu His Pro Asp Lys Phe Ser Arg

115 120 125

Ala Thr Pro Tyr Glu Gln Glu Leu Ala Ala Asp Ala Ala Thr Phe Val

130 135 140

Asn Arg Ala Tyr Ala Met Leu Glu Gln Pro Glu Ser Arg Phe Ala Tyr

145 150 155 160

Phe Leu Ser Leu His His Pro Ser Glu Asp Ala Ser Pro Asn Thr Asp

165 170 175

Ile Leu Asp Pro Asp Phe Leu Thr Glu Met Leu Glu Leu Asn Glu Glu

180 185 190

Ile Glu Glu Phe Ser Glu Leu Leu Thr Ala Val Lys Glu Lys Arg His

195 200 205

Glu Ala Ser Lys Leu Ser Val Leu Leu Lys Glu Leu Leu His Arg Ile

210 215 220

Ser Gln Asp Leu Met Thr Arg Ala Lys Leu Val Thr Ala Leu Asp Glu

225 230 235 240

Ala Arg Trp Lys Asp Ala Gln Ala Leu Leu Asn Lys Cys Arg Tyr Leu

245 250 255

Ser Arg Thr Phe Asp Arg Leu Lys Glu Tyr Glu Leu Asp Trp Arg Arg

260 265 270

Val Gly Ile Thr Val Asp Ile Pro Pro His

275 280

Claims (6)

1. The application of the clonorchis sinensis recombinant protein CsHscB in preparing cholestatic hepatic fibrosis treatment medicines, wherein the coding gene sequence of the clonorchis sinensis recombinant protein CsHscB is shown as SEQ ID NO: 1. as shown.

2. The application of the clonorchis sinensis recombinant protein CsHscB according to claim 1, wherein the clonorchis sinensis recombinant protein CsHscB comprises CsHscB protein and His tag protein.

3. The application of the clonorchis sinensis recombinant protein CsHscB in the preparation of the cholestatic hepatic fibrosis treatment drug according to claim 2, wherein the recombinant protein CsHscB is characterized in that: the amino acid sequence of the CsHscB protein is shown as SEQ ID NO: 2. as shown.

4. The use of the clonorchis sinensis recombinant protein CsHscB of claim 2 in the preparation of a medicine for treating cholestatic liver fibrosis, wherein: the amino acid sequence of the His tag protein is the amino acid sequence corresponding to the His tag protein coding sequence on the Pet-28a (+) plasmid: HHHHHHHH.

5. The application of the clonorchis sinensis recombinant protein CsHscB in the preparation of the cholestatic hepatic fibrosis treatment drug according to claim 2, wherein the recombinant protein CsHscB is characterized in that: the N-terminus of the His-tag protein is linked to the C-terminus of the CsHscB protein.

6. The use of the clonorchis sinensis recombinant protein CsHscB of claim 2 in the preparation of a medicine for treating cholestatic liver fibrosis, wherein: the CsHscB protein and the His tag protein are connected through a connecting peptide.

Images