CN103203026A - The applications of gene Grp75 in the preparation of drugs for the treatment of liver fibrosis - Google Patents
The applications of gene Grp75 in the preparation of drugs for the treatment of liver fibrosis Download PDFInfo
- Publication number
- CN103203026A CN103203026A CN2012100114126A CN201210011412A CN103203026A CN 103203026 A CN103203026 A CN 103203026A CN 2012100114126 A CN2012100114126 A CN 2012100114126A CN 201210011412 A CN201210011412 A CN 201210011412A CN 103203026 A CN103203026 A CN 103203026A
- Authority
- CN
- China
- Prior art keywords
- grp75
- cell
- cells
- gene
- liver
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of molecular biology, relating to the applications of Grp75 in the preparation of drugs for the treatment of oxidative damages of liver cells and liver fibrosis by using gene transfection techniques. According to the invention, based on that Grp75 is an important chaperone in cytoplasm and mitochondria, wherein the 1-23 loci of the N-terminal thereof is a mitochondrial transmembrane signal, can help a protein to be correctly folded, assist the transport of the protein, and has the characteristics such as removal of ROS and antiapoptosis, experiments of cytoprotective effects of Grp75 on H2O2-induced oxidative stress in cells, and protective effects on CCL4-induced hepatic fibrosis as a pathological basis in animal models are carried out. When an injury occurred in the liver cells, the GRP75 gene is transfected in the cells, and the expressions of Grp75 protein are upregulated respectively at a cells level and a whole level; and results show that the effect of the treatment of liver fibrosis can be achieved through the effects of anti-oxidative damage and inhibition of hepatocyte apoptosis of the Grp75 protein. The Grp75 gene of the present invention can be used for preparing drugs for the treatment of liver fibrosis.
Description
Technical field:
The invention belongs to biology field, relate to the new purposes of Grp75 gene, be specifically related to the purposes of applying gene rotaring dyeing technology Grp75 in preparation treatment hepatocyte oxidative damage and liver fibrosis medicine.
Background technology:
Hepatic fibrosis is liver to the wound healing reaction of hepatic injury due to a variety of causes, shows as connective tissue proliferation and deposition in the liver.Modern study shows, common multiple urgency, and chronic hepatopathy is virus type hepatitis for example, fatty liver, most of case such as alcoholic liver all shows as hepatic fibrosis in early days, if can not in time find and effectively inhibition, may further develop becomes liver cirrhosis and even hepatocarcinoma, directly jeopardizes patient's life.Show that according to the study the normal liver cell damage is regarded as activating the initially signal of hepatic fibrosis, along with hepatocellular lasting impaired, apoptosis, hepatic fibrosis will constantly aggravate.Therefore, stop or delay the generation of hepatic fibrosis, expection can be cured most chronic hepatopathys.
The research report, hepatocellular oxidative damage be the early stage pathological process of hepatic fibrosis, hepatic fibrosis is the chronic disease that the fibrous connective tissue hypertrophy causes in the liver, in process of hepatic fibrosis, the activation of stellate cells, be its notable attribute, and hepatocellular oxidative damage and the apoptosis initiating agent that takes place of hepatic fibrosis often.Glucose regulated protein 75 (being called for short Grp75) is Cytoplasm and Intramitochondrial a kind of important molecular chaperones; under stressed conditions such as scarce sugar, radiation; Grp75 presents mileometer adjustment and reaches; to play protected protein matter; assist protein (particularly mitochondrial protein) transhipment, improve cell to the effect of stress toleration.Grp75 passes through to reduce the generation of ROS and lipid peroxide when sugar deficiency injury, and increases ATP level protection cell.(YanLIU, WenLIU, XiaodongSONG, JiZUO.Effect of Grp75 over expression on intracellular ATP level, mitochondrialmembrane potential and ROS accumulation following glucose deprivation in PC12cells[J] .Molecular and Cellular Biochemistry 2005, (268): 45-51; Zuo J, Xia Bl, Massa SM, et al.GRP75 is upregulated in ischemic brain.[J] .J.Neurochem.1996,67:S33A.) GRP75 can pass through prevention Bax conformational change simultaneously, delay Cyt C discharges and presses down, apoptosis paths such as regulation and control Raf/Mek/Erk approach, thus play inhibitory action to lacking the apoptosis that sugar etc. stress cause.C end 312~352 amino acid residue places of p53 albumen have the Grp75 binding signal, and combination takes place for Grp75 and p53, can suppress p53 and be displaced to mitochondrion and nuclear, have suppressed the mitochondrial apoptotic pathway of p53 mediation then respectively and have transcribed the dependency apoptosis pathway.So Grp75 can suppress apoptosis by multiple mechanism of action, and cell injury is played a protective role.(Wadhwa?R,Takano?S,Kaur?K,Deocaris?CC,Pereira-Smith?OM,Reddel?RR,Kaul?SC.Upregulation?of?mortalin/mthsp70/Grp75?contributes?to?human?careinogenesis.Int?J?Cancer.2006?Jun?15;118(12):2973-80.)
Grp75 has constitutive character to express in multiple tissues such as heart, brain, lung, spleen, and when cell injury took place, chaperone Grp75 can irritability raise, and plays cell protective effect, suppresses the apoptosis process.Yet Grp75 does not but have constitutive character to express (Li Hua in hepatic tissue, Yang Zengjie, Xia Beili, left side Drain. the expression characterization .[J of glucose regulated protein 75]. Fudan Journal (medical science version), 2001,28 (5): 382), how when damage takes place in hepatocyte, we change the gene of GRP75 over to, make the Grp75 up-regulated expression respectively on cell and integral level, further produce its anti-oxidative damage effect and have caused relevant area research person's concern with the effect that suppresses hepatocellular apoptosis.
Summary of the invention:
The purpose of this invention is to provide the new purposes of Grp75 gene, be specifically related to the purposes of Grp75 gene in preparation treatment hepatic fibrosis medicine.Relate in particular to injury protection effect that Grp75 causes hepatocellular hydrogen peroxide and Grp75 to by CCL
4The therapeutical effect of the hepatic fibrosis of inducing.
Concrete, the present invention adopts 7702 cells to carry out cell experiment, by adding H
2O
2DMED culture medium (400umol/ml) is set up the hepatocyte model of oxidative, is giving the cell survival rate influence of oxidative damage with mtt assay detection normal group and Grp75 rise group; Detect AST with Lai Shifa, serological index such as ALT are with fluorescent probe labelling ROS and its variation of fluorescence microscope of mitochondrion transmembrane potential;
Employing is with CCL
4Intraperitoneal injection is made the rat liver fibrosis model, change the Grp75 gene over to animal, identify to confirm Grp75 up-regulated expression in liver, with AST in mitochondrial function in pathology, the tissue (ATP generation, CytoC) and the serum, the variation of ALT, the therapeutical effect of the animal pattern of observation Grp75;
Experimental result shows that raising Grp75 can alleviate the cellular oxidation damage by the chondriosome protective effect, suppresses hepatocellular apoptosis, thereby slows down the process of hepatic fibrosis development, reaches the therapeutic effect to hepatic fibrosis.
More specifically purpose of the present invention is achieved through the following technical solutions:
1. set up the cellular oxidation damage model, comprising: 7702 cell routines are cultivated; Add H
2O
2Set up 7702 cellular oxidation damage models; Identify 7702 cell H with the MTT colorimetry
2O
2Model of oxidative;
2.Grp75 gene changes 7702 cells over to, comprising: make up Grp75 and raise plasmid; The liposome transfection method changes the Grp75 gene over to 7702 cells; Western blot detects GRP75 expression in the cell;
3.Grp75 transgenic protection cellular oxidation damage, comprising:
Cell culture and grouping; Reitman-frankel method detects AST in the cell, ALT level; With fluorescent probe mark method detection line plastochondria active oxygen (Reactive oxygen species, generation ROS); With fluorescent probe mark method detection line mitochondrial membrane potential (mitochondria membrane potential, MMP); With the luciferin enzyme process detect adenosine triphyosphate in the cell (adenosine triphophate, ATP);
4. the animal Liver Fibrosis Model is set up, and preferably sets up CCL4 in the embodiments of the invention and induces the rat liver fibrosis model;
5.GRP75 the therapeutic transgene rat liver fibrosis, comprising:
Make up Grp75 and raise plasmid; Change plasmid over to rat with transfection reagent; SABC and Western blot observe the expression after GRP75 changes rat over to;
6.Grp75 the therapeutic transgene effect is observed, comprising:
The animal liver tissue pathology section examination; AST, serological index such as ALT detect; ATP mitochondrion adenosine triphyosphate (adenosine triphophate) detects; Western blot detects cytochrome C and expresses.
The invention provides the purposes of Grp75 gene in preparation treatment hepatic fibrosis medicine; Especially Grp75 injury protection effect that hepatocellular hydrogen peroxide is caused and Grp75 are to by CCL
4The therapeutical effect of the hepatic fibrosis of inducing.
The present invention is based on Grp75 is Cytoplasm and Intramitochondrial a kind of important molecular chaperones, its N end 1-23 site is the mitochondrial film signal of wearing, help albumen correctly to fold, assist the transhipment of protein, have the characteristics such as effect of removing ROS, anti-apoptotic, carried out the H of Grp75
2O
2The cellular oxidation of inducing stress cytoprotection test, and CCL
4Hepatic fibrosis under inducing is the protective effect test of the animal model of pathologic basis; when damage takes place in hepatocyte; the gene of GRP75 is changed over to; make its up-regulated expression at cell and integral level respectively; the result shows, can reach the effect for the treatment of hepatic fibrosis by the anti-oxidative damage effect of Grp75 albumen and the effect of inhibition hepatocellular apoptosis.
For the ease of understanding, below will the present invention be described in detail by concrete drawings and Examples.It needs to be noted, instantiation and accompanying drawing only are in order to illustrate, obviously those of ordinary skill in the art can illustrate according to this paper, within the scope of the invention the present invention is made various corrections and change, and these corrections and change are also included in the scope of the present invention.
Description of drawings:
Fig. 1 is that mtt assay detects the normal group cell, damage group cell, and Grp75 high expressed group cell, the cell that damages behind the Grp75 high expressed is respectively organized the cell viability of cell.
Fig. 2 is the normal group cell, damage group cell, Grp75 high expressed group cell, the variation of the cell mitochondrial transmembrane potential of damaging behind the Grp75 high expressed.
Fig. 3 is that protein immunoblotting detects the expression of cytochrome C in endochylema.
Fig. 4 is that protein immunoblotting method detects animal transgenic effect.
Fig. 5 is with Grp75 expression behind the immunohistochemistry observation animal transgenic.
Fig. 6 is that the difference of four treated animals on pathology is observed in HE dyeing.
Fig. 7 is the differential expression that protein immunoblotting method detects liver cytochrome C.
Fig. 8 is that animal livers is organized the mitochondrial ATP testing result.
The specific embodiment:
Embodiment 1 cell experiment
The foundation of 1 cellular oxidation damage model and evaluation
1.1 cell and main agents:
7702 cells are available from Chinese Academy of Sciences's cell, and tetrazolium bromide (Methylthiazolyldiphenyl-tetrazolium bromide, MTT), available from amresco company, dimethyl sulfoxide (DMSO) is available from merck company, high glucose medium (DMEM) is available from invitrogen company, H
2O
2Give birth to the worker available from Shanghai.
1.2 experimental procedure:
Take the logarithm 7702 cells of trophophase are made single cell suspension, with 5 * 10
4The cell density of individual/ml is inoculated in 96 well culture plates, 6 every group multiple holes, each two groups in normal group cell and GRP75 rise group cell, 200 37 ℃ of μ l culture fluid, 5%CO
2Cultivate in the incubator after 12 hours, add 400uM H
2O
2Continue to cultivate 2 hours, carrying out MTT subsequently detects, namely discard cells and supernatant, wash once with culture medium, every hole adds 20ulMTT (5mg/ml) solution, puts back to and continues in the incubator to cultivate 4 hours, after supernatant is abandoned in suction, add 150 μ l DMSO dissolution precipitations, vibrate after 10 minutes, detect the 492nm place on the microplate reader and measure the OD value.
MTT detects cell motility rate result and shows: 7702 cells are at 400uM H
2O
2Under the damage condition, motility rate reduces; Compare with matched group, the cell viability of Grp75 high expressed group does not have obvious change, and the cell of transfection Grp75 is at H
2O
2Damage back cell motility rate obviously raises (as shown in Figure 1) than the damage group,
2.Grp75 transfectional cell
2.1 main agents: PCRMIX, gel reclaims test kit, and plasmid is taken out test kit (day root company), T4 ligase carrier (TAKARA) for a short time
2.2EGFP-N2/Grp75 expression plasmid makes up
Left side primer ' 5 ' TAAGGATCCATGATAAGCGCCAGCAGA ' 3 BamH1
The right primer ' 5 ' GGCGGTACCTTACTGTTTCTCTTCCTTC ' 3 Kpn1
The target gene PCR amplimer that has the restriction site of BamH1 Kpn1
2.3 expression vector plasmid amplification, extraction and evaluation
With laboratory existing C-myc/Grp75 plasmid be template with BamH1, Kpn1 is that primer carries out pcr amplification, reaction system is:
The 1ul template
10um?BamH1?primer
10um?Kpn1?primer
5ul?10X?Taq?buffer
4ul?dNTP?mix
0.5ul?Taq
DdH
2O mends to 50ul
Products therefrom separates the back of purifying by agarose gel electrophoresis to be preserved,
With EGFP-N2 plasmid BamH1 and Kpn1 double digestion, purified product also reclaims, PCR gained Grp75 sequence is connected into EGFP-N2 with dna ligase, and after the plasmid after will recombinating subsequently was transformed into and passes through blue white macula screening in the competent cell, picking colony checked order.
2.4Grp75 cell transfecting and evaluation
Preceding 24 hours things of transfection are inoculated 0.5-2X10 in 500ul nonreactive complete medium
5Individual cell left standstill 5 minutes with the DMEM culture medium dilution 0.8ug plasmid DNA of 50ul, 50ul dilution 2ul LIP2000 transfection reagent, mix transfection reagent and plasmid DNA diluent, leave standstill and transfection composite joined 100ul/ hole in the 24 orifice plate cells in 20 minutes, orifice plate is placed 37 ℃, cultivated 18 hours in 5% CO2 gas incubator, renew bright culture medium in 6 hours in transfection.The cell of gained with 0.2mg/mlG418 screening changed in 3~5 days screening liquid after 9 days the picking monoclonal cultivate.Gained cell extraction albumen carries out Western blot to be identified.
3. change the effect of the cellular oxidation injury protection of Grp75 over to
3.1 mitochondria activity oxygen detects
3.1.1 main agents:
H
2DCFDA (ROS detectable) is available from invitrogen company, and high glucose medium (DMEM) is available from invitrogen company.
3.1.2. experimental procedure:
Take the logarithm 7702 cells of trophophase are with 8 * 10
5The cell density of individual/ml is inoculated in 24 well culture plates that are placed with circular slide, 3 every group multiple holes, 500 μ l culture fluid, 37 ℃, 5%CO
2Cultivate in the incubator after 12 hours, add 400uM H
2O
2Continue to cultivate 2 hours ROS in detecting cell.Be about to the interior culture fluid of 24 orifice plates and discard, wash cell three times with serum-free DMEM, adding 500 μ l working solution concentration is the H of 10mM
2DCFDA was hatched 20 minutes in 37 ℃ of cell culture incubators.With serum-free cell culture medium washed cell three times, with the 488nm excitation wavelength, the 525nm emission wavelength detects the ROS value in fluorescence microplate reader.
Fluorescence method detection of active oxygen result shows:
The fluorescence intensity of damage group ROS is apparently higher than the normal control group; And Grp75 high expressed group is through H
2O
2Effect after, fluorescence intensity ratio normal group and matched group are high slightly, and obviously organize lowly than damage, this expression Grp75 can effectively control the generation of intracellular reactive oxygen.Table 1 is ROS fluorescence intensity testing result.
Table 1
* represent and normal group is compared P<0.05 * * and compared P<0.01 with normal group
Experimental result is represented with meansigma methods and the standard deviation of four independent experiments, is checked comparing difference with t.P<0.05 thinks to have significant difference.All The data SPSS softwares are analyzed.
3.2 mitochondrial membrane potential detects
3.2.1. main agents:
JC-1 (MMP detectable) is available from green skies biotech firm, and high glucose medium (DMEM) is available from invitrogen company.
3.2.2 experimental procedure:
Take the logarithm 7702 cells of trophophase are with 8 * 10
5The cell density of individual/ml is inoculated in 24 well culture plates that are placed with circular slide, and cultivate after 12 hours in the 500 μ l culture fluid, 37 ℃, 5%CO2 incubator in 3 every group multiple holes, adds 400uM H again
2O
2Continue to cultivate 2 hours MMP in detecting cell.Be about to the interior culture fluid of 24 orifice plates and discard, wash cell three times with serum-free DMEM, the JC-1 and the 250 μ l that add the certain working solution concentration of 250 μ l have blood meida, hatch 20 minutes in 37 ℃ of cell culture incubators.With JC-1 dyeing buffer washed cell three times, under fluorescence microscope, observe.
The mitochondrial membrane potential testing result shows:
With JC-1 probe mark cell mitochondrial transmembrane potential, when mitochondrial membrane potential was higher, JC-1 accumulated in the mitochondrial substrate (matrix), formed polymer (J-aggregates), can produce red fluorescence; When mitochondrial membrane potential was low, JC-1 can not accumulate in the mitochondrial substrate, and this moment, JC-1 was monomer (monomer), can produce green fluorescence.By shown in Figure 2, the damage group is not sent red fluorescence substantially, and this expression mitochondrial membrane potential descends obviously, and Grp75 rise group is at process H
2O
2It is obvious to handle the back red fluorescence, more weak with matched group, and the decline of the mitochondrial membrane potential of this expression Grp75 can effectively suppress.
3.3 mitochondrial ATP detects
3.3.1. main agents:
ATP detectable, ATP detectable diluent, ATP standard solution (0.5mM), ATP detect lysate (ATP detection kit) available from the biological company limited in the green skies.
3.3.2 experimental procedure:
Take the logarithm 7702 cells of trophophase are with 8 * 10
524 well culture plates that the cell density of individual/ml is inoculated in, cultivate after 12 hours in the 500 μ l culture fluid, 37 ℃, 5%CO2 incubator in 4 every group multiple holes, is adding 400uM H
2O
2Continue to cultivate 2 hours ATP in detecting cell.Be about to that culture medium discards in 24 holes, wash twice with PBS, add 50 μ lATP lysates, obtain testing sample after centrifugal.Get 100 μ l ATP testing liquid in detector tube, treat 3-5 minute after, add 50 μ l testing samples, with the RLU value (calculating the concentration of ATP in the sample according to standard curve) of luminous photometer luminometer working sample.
ATP content detection result shows:
With the influence (as shown in Figure 3) of ATP level in the cell of mitochondrial ATP detection technique detection Grp75, the result shows that damage group mitochondrion level obviously reduces than normal group, and Grp75 rise group is at H
2O
2Processing under ATP level and damage organize apparent in view higherly, show that Grp75 can regulate the generation of mitochondrial ATP, thereby reduce cell injury.
Table 2 is mitochondrial ATP horizontal detection results.
Table 2
*Expression with normal group is compared P<0.05
*Compare P<0.01 with normal group
3.4 the detection of the burst size of mitochondrial cytochrome C
3.4.1 main agents: acrylamide (traditional Chinese medicines group), sodium lauryl sulphate (traditional Chinese medicines group), (pH6.8) 0.5mmol/LTris-HCL (SIGMA), (pH8.8) 1.5mmol/LTris-HCL (SIGMA), TEMED, Tween20 (traditional Chinese medicines group), Grp75 primary antibodie (CST), two is anti-, BSA, ECL developer
3.4.2 experimental procedure:
Cell culture is in the 10ml culture bottle, wait to grow to certain density after, normal group cell and Grp75 rise group cell are got one bottle of adding respectively and are contained 400umol/LH
2O
2Culture medium continue to cultivate 2 hours.The above-mentioned cell extraction protein of respectively organizing carries out the SDS-PAGE electrophoresis, and half dry type changes the film instrument and changes 15 minutes (source current≤0.8mA/cm of film
2).By dilution in 1: 100,37 ℃ were shaken and hatch 1 hour the antibody of cytochrome C gently with PBS.4 ℃ are spent the night.TTBS adds two anti-working solutions (1: 1000) after washing film, and room temperature is shaken and hatched 45 minutes.Press ECL test kit description exposure imaging.
The immunoblotting testing result shows: the level of cytochrome C obviously rises in the damage group cell cytosol, the content of cytochrome C seldom in the Grp75 transgenic group endochylema, and the horizontal basically identical of cytochrome C of the cytochrome C level of normal group cell and Grp75 rise group illustrates that Grp75 can suppress the release of cytochrome C (as shown in Figure 3).
3.5 the detection of glutamate pyruvate transaminase (ALT) content in the cell
3.5.1 main agents:
Glutamate pyruvate transaminase substrate liquid, 2,4 dinitrophenyl hydrazine liquid, 0.4mol/L sodium hydroxide solution, 2umol/ml Sodium Pyruvate titer, 0.1mol/L phosphate buffer
3.5.2 operating procedure:
Cell concentration is approximately 1X10
6Cell clean three times with PBS after trypsinization collect in the 2mlEP pipe cell ultrasonication; Under the rotating speed of 3500-4000rpm centrifugal 10 minutes, collect supernatant as testing sample.In measuring the hole, add 37 ℃ of preheatings of 25ul substrate liquid.Measure sample of the every absorption in hole, suction nozzle is stretched in the orifice plate bottom liquid, inhale repeatedly and played behind the mixing 37 ℃ of water-baths or vapour bath 30 minutes; Sample of the every absorption of control wells stretches into suction nozzle in the orifice plate bottom liquid, inhales repeatedly and plays behind the mixing 37 ℃ of water-baths or vapour bath 20 minutes.Add behind the 0.4mol/L caustic lye of soda 250ul gently level and shake 96 orifice plate mixings, room temperature was placed 15 minutes, the 510nm wavelength, microplate reader is surveyed each hole OD value, with absolute OD value (measuring hole OD-control wells OD), look into standard curve, try to achieve corresponding ALT unit of activity (Ka Menshi unit)
3.6 glutamic oxaloacetic transaminase, GOT is measured in the cell
3.6.1 use reagent:
Glutamic oxaloacetic transaminase, GOT substrate liquid, 2,4 dinitrophenyl hydrazine liquid, 0.4mol/L sodium hydroxide solution, 2umol/ml Sodium Pyruvate titer, 0.1mol/L phosphate buffer.
3.6.2 operating procedure:
Trypsinization was collected in the 2mlEP pipe after the cell that cell concentration is approximately 1X106 cleaned three times with PBS, with after the cell ultrasonication under the rotating speed of 3500-4000rpm centrifugal 10 minutes, collect supernatant and in measuring the hole, add 37 ℃ of preheatings of 25ul substrate liquid as testing sample.Measure sample of the every absorption in hole, suction nozzle is stretched in the orifice plate bottom liquid, inhale repeatedly and played behind the mixing 37 ℃ of water-baths or vapour bath 30 minutes; Sample of the every absorption of control wells stretches into suction nozzle in the orifice plate bottom liquid, inhales repeatedly and plays behind the mixing 37 ℃ of water-baths or vapour bath 20 minutes.Add behind the 0.4mol/L caustic lye of soda 250ul gently level and shake 96 orifice plate mixings, room temperature was placed 15 minutes, the 510nm wavelength, microplate reader is surveyed each hole OD value, with absolute OD value (measuring hole OD-control wells OD), look into standard curve, try to achieve corresponding ALT unit of activity (Ka Menshi unit)
Reitman-frankel method detects hepatocyte AST, the generation of ALT, and testing result shows, by raising the expression of Grp75, suppresses to damage the AST that brings, the rising of these two kinds of clinical diagnosing hepatism indexs of ALT by hydrogen peroxide.
Table 3 hepatocyte AST, the generation of ALT
*Expression with normal group is compared P<0.05
*Compare P<0.01 with normal group
Embodiment 2 zooperies
1. set up rat CCL
4Induce Liver Fibrosis Model
1.1 animal and reagent
CCL
4Glycerol; Normal saline.
SPF level Wistar rat is used in experiment.
1.2 grouping
Experiment uses SPF level Wistar rat feeding in 22 ℃ of room temperatures, the Animal House of relative humidity 55%, and 12 hours circadian rhythms, ad lib and drinking-water begin experiment after 1 week that conformed.Rat is divided into 12 of matched groups, 12 of model group, 12 of GRP75 transgenic groups, 12 of GRP75 rise+damage groups at random.All indexs detect all carries out after 12 hours in fasting.All rat control volumes focus on 100-150g.
1.3 experimental procedure
Give the 10%CCL of lumbar injection with the glycerol dilution with the normal rat (model group) of raising 5 days
4, 1ml/kg dosage is injected, and is weekly, totally 8 weeks.The matched group injecting normal saline
2.GRP75 the transgenic rat model is set up and is identified
2.1 animal and reagent
Experiment SPF level Wistar rat, jetPEI-in vivo transfection reagent box (available from Polyplus company), Grp75 antibody (available from CST company); The Grp75 primary antibodie is available from CST company, and two anti-developers are available from green skies company.
2.2 experimental procedure
2.2.1 make up the EGFP-N2/Grp75 plasmid
Same cell experiment
2.2.2 transgenic animal preparation
Experiment uses SPF level Wistar rat feeding in 22 ℃ of room temperatures, the Animal House of relative humidity 55%, and 12 hours circadian rhythms, ad lib and drinking-water begin experiment after 1 week that conformed.The GRP75 plasmid is mixed back adding 1ml5% glucose solution with jetPEI-in vivo transfection reagent with the concentration of 6.25ug/ul make injection reagent, go into rat with 200ug/kg dosage tail vein injection.Transgenic group rat changes 48 hours at plasmid and gives the 10%CCL4 of lumbar injection with the glycerol dilution later on, and 1ml/kg dosage is injected, and is weekly, totally 8 weeks.The matched group injecting normal saline
2.2.3Western the blot method is identified transgenic animal
48 hours post-tensioning necks are put to death 4 animals and are used as evaluation.Open the abdominal cavity and get all animals liver, homogenate adds the lysate room temperature to leave standstill 20 minutes 7500g centrifugal after 5 minutes on ice with homogenizer to take by weighing the 200mg hepatic tissue, and supernatant is the albumen that extracts.Western blot method checks its protein level to observe the transgenic effect.
2.2.4 SABC detects, and GRP75 expresses in each treated animal liver
Paraffin section de-waxing is to water, and 3%H202 incubated at room 5~10 minutes is to eliminate the activity of endogenous peroxydase.Distilled water flushing, PBS soaked 5 minutes, 5~10% normal goats serum (PBS dilution) sealing, incubated at room 10 minutes.The serum deprivation that inclines is not washed, and drips primary antibodie or the primary antibodie working solution of proper proportion dilution, hatches for 37 ℃ to spend the night in 1~2 hour or 4 ℃.The PBS flushing, 5 minutes * 3 times.Drip the biotin labeling two anti-(1%BSA-PBS dilution) of proper proportion dilution, hatched 10~30 minutes for 37 ℃; Or drip second filial generation biotin labeling two anti-working solutions, 37 ℃ or incubated at room 10~30 minutes.The PBS flushing, 5 minutes * 3 times.Drip the Radix Cochleariae officinalis enzyme labelling strepto-avidin (PBS dilution) of proper proportion dilution, hatch PBS flushing in 10~30 minutes, 5 minutes * 3 times, chromogenic reagent for 37 ℃.Tap water fully washes, and redyes mounting.Western blot testing result shows: CCL4 modeling after the plasmid that Grp75 raises cooperates transfection reagent with tail vein injection targeting importing liver, get liver organization subsequently and detect the transgenic effect with protein immunoblotting method, compare with normal group, transgenic rat Grp75 expresses obviously and raises (as shown in Figure 4), has confirmed the up-regulated expression (as shown in Figure 5) of Grp75 in the transgenic rat hepatic tissue simultaneously with SABC.
3.GRP75 the effect of therapeutic transgene hepatic fibrosis test
3.1 the pathology hepatic tissue section is observed
3.1.1 main agents: paraffin, ethanol, dimethylbenzene, paraformaldehyde
3.1.2 experimental procedure:
Get each treated animal, conventional treatment is got hepatic tissue, is immersed in the formaldehyde fixed agent that 4% usefulness pH7.4PBS is made into, and room temperature 24 was changed liquid totally 3 days for a short time.Open baking oven, paraffin is melted in homoiothermic to 62 ℃.Ethanol gradient dehydration (30%, 50%, 70%, 80%, 90%, 95%, 100% * 2) was changed 50% ethanol+30 minutes 100% dimethylbenzene of 50% dimethylbenzene every 30 minutes, and the tissues observed piece is to transparent constantly.Put into 50% paraffin+50% dimethylbenzene that baking oven has melted in advance, 30 minutes.100% paraffin twice, each 2 hours.Solidifying 4 ℃ in the 100% paraffin carton deposits standby.Thawing paraffin is smeared at the bottom of piece after repairing piece, is attached on the wooden unit compacting.After the section, section is lain on the flat board, bright finish up., the paraffin slice is put in (40 ℃ of water temperatures) on the water surface with bright finish down, makes its stretching, extension.The paraffin thin slice being attached on the slide of anticipating 40 ℃ of bakings spends the night.
Dimethylbenzene twice is immersed in the section of toasting, each 5-10 minute, immerse in 95% ethanol twice then, each 1-3 minute, immerse 80% ethanol distilled water immersion one minute after 1 minute at last.Subsequently plectrum is immersed and dyeed according to circumstances in the haematoxylin dye liquor 5-15 minute, the flowing water flushing is immersed in the eosin stain again, washing back dehydration mounting
Hepatic pathology fabric analysis result shows: hepatic pathology tissue slice HE coloration result: damage group interstice is bigger, produce cavity shape structure in the tissue, the gap is close with normal group between the tissue of Grp75 transgenic group, damage with CCL4 again behind the Grp75 transgenic, though pathology section examination display organization gap is bigger than normal group and transgenic group, but than damage group obviously little (as shown in Figure 6), the result confirms that Grp75 can be alleviated hepatic fibrosis in morphology.
3.2. the generation of mitochondrial ATP in the animal livers
3.2.1 main agents:
ATP detectable, ATP detectable diluent, ATP standard solution (0.5mM), ATP detect lysate (ATP detection kit) available from the biological company limited in the green skies.
3.2.2 experimental procedure:
Get Mus, conventional treatment, get hepatic tissue, place the ice-cold sucrose solution of 0.25mol/L of 10 times of volumes, with low speed homogenate 30s in the interior cut refiner, 1000r/ minute centrifugal 10 minutes, get 2/3 supernatant, be dissolved in again in the ice-cold sucrose solution of 0.25mol/L, the vibration mixing, 18000r/ minute centrifugal 20 minutes, the gained precipitation was mitochondrion.Get 100 μ l ATP testing liquid in detector tube, treat 3-5 minute after, add 50 μ l testing samples, with the RLU value (calculating the concentration of ATP in the sample according to standard curve) of luminous photometer luminometer working sample.
Carry out the detection that ATP generates in the liver organization, by extracting the rat liver mitochondrion is carried out the detection that middle ATP generates, the result shows that ATP generates obviously reduction in the CCL4 damage back, and transgenic animal are handled the basic and normal control winding nearly (as shown in Figure 8) of back ATP growing amount at CCL4.
3.3 immunoblotting detects the expression test of animal somatic cell pigment C
3.3.1 main agents:
Acrylamide (traditional Chinese medicines group), sodium lauryl sulphate (traditional Chinese medicines group), 0.5mmol/L Tris-hour CL (pH6.8) (SIGMA), 1.5mmol/LTris-hour CL (pH8.8) (SIGMA), TEMED, Tween20 (traditional Chinese medicines group), Grp75 primary antibodie (CST), two is anti-, BSA, ECL developer
3.3.2 experimental procedure
Get Mus, conventional treatment is got hepatic tissue, place the ice-cold sucrose solution of 0.25mol/L of 10 times of volumes, with low speed homogenate 30s in the interior cut refiner, extract protein, carry out the SDS-PAGE electrophoresis, half dry type changes the film instrument (source current≤0.8mA/cm2) that changeed film 15 minutes.By dilution in 1: 100,37 ℃ were shaken and hatch 1 hour the antibody of cytochrome C gently with PBS.4 ℃ are spent the night.TTBS adds two anti-working solutions (1: 1000) after washing film, and room temperature is shaken and hatched 45 minutes.Press ECL test kit description exposure imaging.The expression that protein immunoblotting method detects cytochrome C in the liver organization shows, the expression of CytoC is obviously low in the liver organization of normal control treated animal and Grp75 transgenic animal, and CytoC amount in damage back significantly increases, transgenic animal through CCL4 damage back with damage the apparent in view reduction of treated animal (as shown in Figure 7).
3.4 organize ALT, AST detects
3.4.1 main agents:
Glutamate pyruvate transaminase substrate liquid, 2,4 dinitrophenyl hydrazine liquid, 0.4mol/L sodium hydroxide solution, 2umol/ml Sodium Pyruvate titer, 0.1mol/L phosphate buffer
3.4.2 experimental procedure:
Getting after the rat serum and collecting supernatant in centrifugal 10 minutes is that testing sample adds in 96 orifice plates (every group multiple Kong Weiliu) and measures and add 37 ℃ of preheatings of 25ul substrate liquid in hole.Measure sample of the every absorption in hole, inhale repeatedly and played behind the mixing 37 ℃ of water-baths or vapour bath 30 minutes.Sample of the every absorption of control wells is inhaled repeatedly and was played behind the mixing 37 ℃ of water-baths or vapour bath 20 minutes.Add behind the 0.4mol/L caustic lye of soda 250ul gently level and shake 96 orifice plate mixings, room temperature was placed 15 minutes, the 510nm wavelength, microplate reader is surveyed each hole OD value, with absolute OD value (measuring hole OD-control wells OD), look into standard curve, try to achieve corresponding ALT unit of activity (Ka Menshi unit).
Get the serum of respectively organizing laboratory animal and detect the level of AST and ALT with reitman-frankel method, the result shows that damage group AST and ALT are normal, and matched group obviously rises, and Grp75 transgenic group then can effectively reduce CCL
4The AST that damage causes, the variation of ALT level.
Table 4 rat blood serum AST and ALT detect
*Expression with normal group is compared P<0.05
*Compare P<0.01 with the damage group.
Claims (5)
1.Grp75 the purposes of gene in preparation treatment hepatic fibrosis medicine.
2. by the described purposes of claim 1, it is characterized in that described hepatic fibrosis is the damage that hepatocellular hydrogen peroxide causes.
3. by the described purposes of claim 1, it is characterized in that described hepatic fibrosis is the hepatic fibrosis of being induced by CCL4.
4. by the described purposes of claim 1, it is characterized in that the rise of described Grp75 improves the hepatocyte oxidative damage.
5. by the described purposes of claim 1, it is characterized in that described Grp75 suppresses hepatocellular apoptosis by regulating the liver cell mitochondria function.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012100114126A CN103203026A (en) | 2012-01-14 | 2012-01-14 | The applications of gene Grp75 in the preparation of drugs for the treatment of liver fibrosis |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012100114126A CN103203026A (en) | 2012-01-14 | 2012-01-14 | The applications of gene Grp75 in the preparation of drugs for the treatment of liver fibrosis |
Publications (1)
Publication Number | Publication Date |
---|---|
CN103203026A true CN103203026A (en) | 2013-07-17 |
Family
ID=48750574
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2012100114126A Pending CN103203026A (en) | 2012-01-14 | 2012-01-14 | The applications of gene Grp75 in the preparation of drugs for the treatment of liver fibrosis |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103203026A (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108785655A (en) * | 2018-06-20 | 2018-11-13 | 军事科学院军事医学研究院环境医学与作业医学研究所 | A kind of application of the glucose regulated protein 75 in preparing anti-heat stress damage medicine |
CN110237235A (en) * | 2019-06-04 | 2019-09-17 | 徐州医科大学 | Application of the clonorchis sinensis recombinant protein c sHscB in cholestatic liver fibrosis therapeutic agent |
CN110721320A (en) * | 2018-06-28 | 2020-01-24 | 复旦大学 | Nano gene medicine for liver related diseases and its preparing method and use |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1947711A (en) * | 2005-10-12 | 2007-04-18 | 复旦大学 | Application of glutamine for preparing medicine for treating and preventing cellular sugar deficiency injury |
-
2012
- 2012-01-14 CN CN2012100114126A patent/CN103203026A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1947711A (en) * | 2005-10-12 | 2007-04-18 | 复旦大学 | Application of glutamine for preparing medicine for treating and preventing cellular sugar deficiency injury |
Non-Patent Citations (4)
Title |
---|
JI-YE SONG等: "Acute liver toxicity by carbon tetrachloride in HSP70 knock out mice", 《EXPERIMENTAL AND TOXICOLOGIC PATHOLOGY》 * |
QIUKAI E等: "Over-expression of GRP75 inhibits liver injury induced by oxidative damage", 《ACTA BIOCHIM BIOPHYS SIN》 * |
张莉莉 等: "葡萄糖调节蛋白75 基因对H2O2 诱导的C6 胶质瘤细胞氧化应激性损伤有保护作用", 《南京医科大学学报(自然科学版)》 * |
葡萄糖调节蛋白75的表达特性: "李华 等", 《复旦学报(医学科学版)》 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108785655A (en) * | 2018-06-20 | 2018-11-13 | 军事科学院军事医学研究院环境医学与作业医学研究所 | A kind of application of the glucose regulated protein 75 in preparing anti-heat stress damage medicine |
CN108785655B (en) * | 2018-06-20 | 2022-01-04 | 军事科学院军事医学研究院环境医学与作业医学研究所 | Application of glucose regulatory protein 75 in preparation of heat stress injury resistant medicine |
CN110721320A (en) * | 2018-06-28 | 2020-01-24 | 复旦大学 | Nano gene medicine for liver related diseases and its preparing method and use |
CN110237235A (en) * | 2019-06-04 | 2019-09-17 | 徐州医科大学 | Application of the clonorchis sinensis recombinant protein c sHscB in cholestatic liver fibrosis therapeutic agent |
CN110237235B (en) * | 2019-06-04 | 2023-03-28 | 徐州医科大学 | Application of clonorchis sinensis recombinant protein CsHscB in cholestatic liver fibrosis treatment drug |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Fan et al. | Chloroquine inhibits cell growth and induces cell death in A549 lung cancer cells | |
Li et al. | Baicalein ameliorates ulcerative colitis by improving intestinal epithelial barrier via AhR/IL-22 pathway in ILC3s | |
Park et al. | Reactive oxygen species mediated ginsenoside Rg3-and Rh2-induced apoptosis in hepatoma cells through mitochondrial signaling pathways | |
Song et al. | Puerarin protects against cadmium-induced proximal tubular cell apoptosis by restoring mitochondrial function | |
CN103502465B (en) | Use the method for the L-Derived from D-Glucose analyte detection cancerous cell of fluorescent labeling and the developer of the cancerous cell containing this derivant | |
Cao et al. | Heme oxygenase-1-modified bone marrow mesenchymal stem cells combined with normothermic machine perfusion to protect donation after circulatory death liver grafts | |
Feng et al. | Old targets, new strategy: Apigenin-7-O-β-d-(-6 ″-p-coumaroyl)-glucopyranoside prevents endothelial ferroptosis and alleviates intestinal ischemia-reperfusion injury through HO-1 and MAO-B inhibition | |
CN106399309B (en) | A kind of long non-coding RNA and its application in diagnosis/treatment T2DM | |
CN106928246A (en) | A kind of compound and preparation method thereof and purposes | |
CN103203026A (en) | The applications of gene Grp75 in the preparation of drugs for the treatment of liver fibrosis | |
Fu et al. | Apoptosis of human gastric carcinoma cells induced by Euphorbia esula latex | |
Hu et al. | Differential mechanistic investigation of protective effects from imperatorin and sec-O-glucosylhamaudol against arsenic trioxide-induced cytotoxicity in vitro | |
CN109337863A (en) | A kind of external model construction method that predictive compound is viral to fatty liver | |
Lin et al. | Bone marrow mesenchymal stem cells ameliorated kidney fibrosis by attenuating TLR4/NF-κB in diabetic rats | |
Chen et al. | High glucose promotes prostate cancer cells apoptosis via Nrf2/ARE signaling pathway. | |
Chen et al. | Hydrogen alleviates neuronal injury and neuroinflammation induced by microglial activation via the nuclear factor erythroid 2-related factor 2 pathway in sepsis-associated encephalopathy | |
CN108685921A (en) | A kind of application of the quinoline of N isosteres iridin in medicines resistant to liver cancer | |
CN104337803A (en) | Application of xerophilusin B in preparation of products for inhibiting tumor growth | |
Wisnoskey et al. | Maitotoxin-induced cell death cascade in bovine aortic endothelial cells: divalent cation specificity and selectivity | |
CN105943523A (en) | Application of dendrophenol in preparing medicines for inhibiting proliferation of cervical carcinoma cells and for inducing autophagic apoptosis of cervical carcinoma cells | |
Xiao et al. | Periplaneta americana extract alleviates steatohepatitis in a mouse model by modulating HMGB1-mediated inflammatory response | |
CN110090209A (en) | Application of the formoononetin in treatment nonalcoholic fatty liver | |
Lee et al. | Anatomical discrimination of the differences between torn mesentery tissue and internal organ-surface primo-vessels | |
CN108451965A (en) | A kind of radix paeoniae rubra terpene glycoside composition and preparation method thereof with function of resisting myocardial ischemia | |
CN108339113A (en) | Applications of the E3 ubiquitin ligases RNF14 in preparing treatment fatty liver and relevant disease drug |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130717 |