CN110237235A - Application of the clonorchis sinensis recombinant protein c sHscB in cholestatic liver fibrosis therapeutic agent - Google Patents

Abstract

The present invention relates to field of biotechnology, specifically clonorchis sinensis recombinant protein c sHscB(abbreviation rCsHscB) and its application in cholestatic liver fibrosis therapeutic agent, CsHscB albumen has amino acid sequence shown in SEQ NO:2, the present invention is after extensive and in-depth study, it was found that the albumen has obvious therapeutic action to cholestatic liver fibrosis, it can obviously improve the pathological changes such as liver function index and inflammatory cell infiltration, bile duct proliferation, the liver fibrosis of bile duct week with cholestatic liver fibrosis animal by the protein for treatment；Meanwhile the present invention can be substantially reduced inflammatory factor (such as IL-6, MCP-1) level in cholestatic liver fibrosis animal model；Therefore the cholestatic liver fibrosis therapeutic agent field provided by the present invention containing rCsHscB albumen has high application prospect and value.

Description

Clonorchis sinensis recombinant protein c sHscB is in cholestatic liver fibrosis therapeutic agent In application

Technical field

The invention belongs to field of biotechnology, and in particular to clonorchis sinensis recombinant protein c sHscB is in cholestatic liver Application in treatment of fibrosis drug.

Background technique

Cholestatic liver fibrosis is a kind of by bile flow stagnation or liver cell and the transhipment of bile duct cell bile secretion Failure, or due to outside liver free bile flow drain passage be obstructed caused by cellular damage and inflammation, eventually lead to liver fibrosis. Different from non-Biliary hepatic fibrosis, Biliary hepatic fibrosis makes fast progress, and with fine around bile duct abnormality proliferation and bile duct Dimensionization.It is clinically still dissatisfied to the drug therapy curative effect of intrahepatic cholestasis.Although treatment cholestatic liver fiber at present The drug of change is ursodesoxycholic acid, but the phenomenon that the drug is strong and unresponsive to some patientss there are toxic side effect.In order to improve The quality of life of patient reduces case fatality rate, and there is an urgent need to find effective anti-cholestatic liver fibrosis newtype drug.

The basic research for being established as cholestatic liver fibrosis, the treatment of cholestatic liver fibrosis animal model are ground The drug research studied carefully and screen prevention and treatment cholestatic liver fibrosis provides an approach.Chronic DDC(3,5- Diethoxycarbonyl-1,4-dihydrocollidine, 3,5- di ethoxy carbonyl-Isosorbide-5-Nitrae-dihydro-uracil) feeding is A kind of cholestatic liver fibrosis model of heteroplasia object induction, which is mainly small with the feed feeding containing 0.1% DDC Mouse can cause the secretion of porphyrin substance to increase after DDC feeding, form porphyrin embolism, make bile duct epithelial cell and liver cell It is abnormal hyperplasia, degeneration necrosis, and vascular adhesion molecule, osteopontin (OPN), tumor necrosis factor α (TNF-α) etc. is made to exist Expression in bile duct epithelial cell increases, and ultimately forms bile duct week fibrosis.

The molecular chaperones (Molecular chaperones HscB, CsHscB) in clonorchis sinensis source, through biological information Credit analysis is the discovery that co- molecular chaperones (Co-chaperone Hsc20) family member, mainly contains in this family Small heat shock protein family member, since it can prevent unfolded protein denaturation and promote the protein of aggregation molten Renaturation is solved, therefore especially important when cell is subjected to high temperature or other stress, thus many molecular chaperones are in vivo all It is to be come out for the first time with heat shock protein (Heat shock protein, Hsp) form is identified.That wherein studies is most clear that Hsp70-DnaK system, DnaK can adjust the work of Hsp70 by the atpase activity of enhancing Hsp70 as Co-chaperone Property.However, clonorchis sinensis CsHscB albumen is as one of Hsp family member, in the immune of body branch testis fluke infection to China The mechanism of action in the occurrence and development such as regulation and pathology damage is not clear.

Summary of the invention

Technical problem to be solved by the present invention lies in providing a kind of clonorchis sinensis recombinant protein c sHscB, China's branch testis Fluke recombinant protein c sHscB can be used for treating liver fibrosis, and the specific liver fibrosis type is that cholestatic liver is fine Dimensionization.

The purpose of the present invention is what is be accomplished by the following way: by constructing prokaryotic expression carrier pET-28a-CsHscB, Expression and purity clonorchis sinensis recombinant protein c sHscB(hereinafter referred to as rCsHscB).

Specifically, application of the rCsHscB in cholestatic liver fibrosis therapeutic agent.

It is described as rCsHscB of the present invention in the application in cholestatic liver fibrosis therapeutic agent RCsHscB contains CsHscB albumen and His label protein；

The coding gene sequence of the rCsHscB is as shown in SEQ ID NO: 1.

Optimization side as application of the rCsHscB of the present invention in cholestatic liver fibrosis therapeutic agent Case: the amino acid sequence of the rCsHscB albumen is as shown in SEQ ID NO: 2.

Optimization side as application of the rCsHscB of the present invention in cholestatic liver fibrosis therapeutic agent Case: the amino acid sequence of the His label protein is ammonia corresponding to His label protein coded sequence on Pet-28a (+) plasmid Base acid sequence: HHHHHH.

Optimization side as application of the rCsHscB of the present invention in cholestatic liver fibrosis therapeutic agent Case: the N-terminal of the His label protein and the C-terminal of the CsHscB albumen link.

Optimization side as application of the rCsHscB of the present invention in cholestatic liver fibrosis therapeutic agent Case: it is connected between the CsHscB albumen and His label protein by link peptide.

A kind of drug for treating cholestatic liver fibrosis, contains rCsHscB as claimed in claim 2.

Also contain pharmaceutically acceptable carrier in the cholestatic liver fibrosis therapeutic agent.

The pharmaceutically acceptable carrier refers to suitable for people and/or animal and without excessively bad side reaction (such as poison Property, stimulation and allergy) there is the substance of reasonable benefit/risk ratio.

Further, the pharmaceutically acceptable carrier is for sending rCsHscB of the invention to animal or people Acceptable solvent, suspending agent or excipient pharmaceutically or on food.Carrier can be liquid or solid.

Further, the pharmaceutically acceptable carrier is various pharmaceutically common auxiliary materials and/or excipient, packet It includes (but being not limited to) carbohydrate (such as lactose, dextrose and saccharose), starch (such as cornstarch and potato starch), cellulose and its spreads out Biological (such as sodium carboxymethylcellulose, ethyl cellulose and methylcellulose), tragacanth gum powder, malt, gelatin, talcum, solid Lubricant (such as stearic acid and magnesium stearate), calcium sulfate, vegetable oil, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil And cupu oil, polyalcohol (such as propylene glycol, glycerol, D-sorbite, mannitol and polyethylene glycol), alginic acid, emulsifier is (such as Tween, Emulsifier EL-60), wetting agent (such as NaLS), colorant, flavoring agent, tablet agent, stabilizer, antioxygen Agent, preservative, apirogen water, isotonic salting liquid and phosphate buffer etc.；The carrier can improve the steady of formula as needed Qualitative, active and biological effectiveness etc..

The present invention is as carrying out preparation in cholestatic liver fibrosis drug in use, the rCsHscB is as only One effective component or the rCsHscB as one of effective component, can with one or more pharmaceutically acceptable carriers or Excipient is mixed and made into the pharmaceutical dosage form of different way of administration.

Further, the form of the pharmaceutical preparation is tablet, capsule, powder, granule, syrup, solution, takes orally Liquid, spirit, tincture, aerosol, powder spray, injection, injection sterile powder or suppository.Above-mentioned preparation type can be by Understand according to the related definition in pharmacy (sixth version, People's Health Publisher, Cui Fude), the preparation of above-mentioned preparation can be according to The method of related preparations in pharmacy (sixth version, People's Health Publisher, Cui Fude) is prepared.

Compared with prior art, the invention has the following beneficial effects:

The present invention after extensive and in-depth study, has found that rCsHscB has cholestatic liver fibrosis for the first time and significantly controls Treatment effect finds rCsHscB in preparation for treating the new application in cholestatic liver fibrosis for the first time.

Detailed description of the invention

Fig. 1, it is shown as clonorchis sinensis recombinant protein c sHscB(rCsHscB) the PCR result of target gene.Note: M is DNAmarker, swimming lane 1 are rCsHscB pcr amplified fragment.

Fig. 2, it is shown as pET-28a-CsHscB plasmid sequence comparison result；Note: the survey of Query:pET-28a-CsHscB Sequence result;Sbjct:GAA34393.2 target gene.

Fig. 3, it is shown as various concentration IPTG induction rCsHscB expression SDS-PAGE electrophoresis；Note: M is expressed as protein Marker；Wherein,

1-4 is respectively 1.0,0.6,0.2,0(mM) the precipitating extract of IPTG inducing expression product；

5-8 is respectively 1.0,0.6,0.2,0(mM) the supernatant extracting solution of IPTG inducing expression product.

Fig. 4, it is shown as rCsHscB purifying SDS-PAGE electrophoresis；Note: M is expressed as protein Marker；Wherein,

1-2 is respectively Binding buffer protein eluate；

3-6 is respectively 100,200,400,500(mM) imidazoles protein eluate.

Fig. 5, it is shown as Western blot detection rCsHscB；Note: M is protein marker；Wherein, 1 is mono- for anti-His Clonal antibody.

Fig. 6, be shown as rCsHscB improve DDC induction cholestatic liver fibrosis in liver substantially see.

Fig. 7, cholestatic liver fibrosis hepatic pathology variation (the H&E dye for being shown as rCsHscB improvement DDC induction Color).Black arrow indicates bile duct epithelial cell hyperplasia and inflammatory cell infiltration.

Fig. 8, it is shown as Collagen fiber deposition situation in rCsHscB improvement DDC induction cholestatic liver fibrosis (Masson dyeing) A: each group mouse liver Collagen fiber deposition situation B:Masson dye image is analyzed as a result, with corresponding group Than *p< 0.05, * * *p<0.001。

Fig. 9, it is shown as liver function index in rCsHscB improvement DDC induction cholestatic liver fibrosis.A:ALT；B: AST, with corresponding group ratio, * * *p<0.001。

Figure 10, it is shown as hydroxyproline content in rCsHscB reduction DDC induction cholestatic liver fibrosis.With it is corresponding Group ratio, *p< 0.05, * * *p<0.001。

Figure 11, fibrosis GAP-associated protein GAP and mRNA in rCsHscB reduction DDC induction cholestatic liver fibrosis are shown as Horizontal expression.A:Western blot detects the expression B of fibrosis GAP-associated protein GAP in murine liver tissue: related In the semi-quantitative analysis C:qRT-PCR detection murine liver tissue of albumencol1The variation of mRNA expression, with corresponding group Than * * *p<0.001。

Figure 12, the hyperplasia for being shown as bile duct epithelial cell in rCsHscB reduction DDC induction cholestatic liver fibrosis (CK19).The semi-quantitative analysis of the distribution B:CK19 expression of CK19 in A:DDC model each group murine liver tissue, with corresponding group Than * *p< 0.01, * * *p<0.001 。

Figure 13, the hyperplasia for being shown as hepatic parenchymal cells in rCsHscB reduction DDC induction cholestatic liver fibrosis.A: The semi-quantitative analysis of the distribution B:Ki67 expression of Ki67 in DDC model each group murine liver tissue, with corresponding group ratio, *p< 0.05, * * *p<0.001。

Figure 14, it is shown as osteopontin (OPN) content in rCsHscB reduction DDC induction cholestatic liver fibrosis.A: The semi-quantitative analysis of the distribution B:OPN expression of OPN in DDC model each group murine liver tissue, with corresponding group ratio, *p< 0.05, * * *p<0.001。

Figure 15, the expression for being shown as proinflammatory cytokine in rCsHscB reduction DDC induction cholestatic liver fibrosis.A ~ B is respectively the expression variation of ELISA detection DDC model IL-6, MCP-1.C ~ D is respectively qRT-PCR detection DDC modeltnfa、il1bMRNA level in-site express variation, with corresponding group ratio, *p< 0.05, * *p< 0.01, * * *p<0.001。

Figure 16, it is shown as the activation that rCsHscB inhibits the hepatic stellate cells of TGF-β induction.Note: figure A and B is rCsHscB Influence after processing LX-2 cell to α-SMA protein expression；It is right after rCsHscB processing LX-2 cell for scheming CACTA2Gene table The influence reached；Wherein TGF-β 1 is 15 ng/ml；RSG Rosiglitazone is 1 μM；RCsHscB is 40 μ g/ml；Corresponding group Than *p<0.05。

Specific embodiment

Below with reference to embodiment, the present invention will be further described.

The preparation of embodiment 1, clonorchis sinensis recombinant protein c sHscB

One, recombinant expression carrier is constructed

Design of primers

It is soft using Primer premier 5 referring to clonorchis sinensis Henan Strain gene order (GenBank:DF143487.1) Part design specific primer is for expanding clonorchis sinensis CsHscB protein coding gene full sequence.

The restriction enzyme site (GGATCC) of restriction enzyme BamH I is introduced in upstream primer P1, upstream primer P1, sequence is such as Under: 5 '-CAGCAAATGGGTCGCGGATCCATGTCATTTCGTCTCGCACCA-3 '.

The restriction enzyme site (CTCGAG) of restriction enzyme Xho I is introduced in downstream primer P2, downstream primer P2, sequence is such as Under: 5 '-GTGGTGGTGGTGGTGCTCGAGTTAATGCGGAGGAATATCAACTGT-3 '.

Upstream primer P1 and downstream primer P2 among the above is synthesized by upper marine growth Sheng Gong Co., Ltd.

The extraction of clonorchis sinensis polypide total serum IgE, concrete operations are as follows:

(1) clonorchis sinensis adult several are collected, is fully ground in the mortar of pre-cooling, 1ml Trizol is added；

(2) it is gently mixed by inversion, is stored at room temperature 5min；

(3) 4 DEG C, 12000g is centrifuged 5min；

(4) it takes the rnase-free EP of upper strata aqueous phase Yu Yixin to manage, abandons precipitating；

(5) 200 μ l chloroforms (0.2 times of RNAiso plus volume) is added into supernatant, is sufficiently suspended and uniformly (is acutely vortexed It is creamy white to solution), it is stored at room temperature 5min；

(6) 4 DEG C, 12000g is centrifuged 15min；

(7) it takes the rnase-free EP of supernatant Yu Yixin to manage again, abandons precipitating；

(8) 0.5ml isopropanol (0.5 ~ 1.0 times of RNAiso plus volume) is added into above-mentioned supernatant again；

(9) it is stored at room temperature 10min；

(10) 4 DEG C, 12000g is centrifuged 10min；

(11) precipitating is taken, supernatant is abandoned；

(12) 75% alcohol (RNAiso plus volume equivalent) that 1ml pre-cooling is added into precipitating cleans mRNA；

(13) 4 DEG C, 7500g is centrifuged 5min；

(14) precipitating is stayed, supernatant is abandoned, repeated washing is primary；

(15) dry 5 ~ 10min in air at room temperature, 50 ~ 100 μ l of addition, RNAase-free ddH2O sufficiently dissolve, and obtain total core Sour RNA.

(16) integrity detection of RNA: 1 μ l total nucleic acid RNA is extracted into stoste, 5 μ l, RNAase-free ddH is added₂O, After 1 μ l of sample-loading buffer mixing is added, carry out 1% agarose gel electrophoresis (condition 180V, electrophoresis 10min), gel imaging system Observation.

(17) concentration and purity detecting of the total nucleic acid RNA extracted

With NanoDrop Lite spectrophotometer measurement concentration of specimens and A260/A280 ratio, the concentration and purity of RNA are detected； The RNA that A260/A280 ratio is 1.8 ~ 2.0 is selected to be used as reverse transcription.

Reverse transcription synthesizes cDNA

Step (1) total nucleic acid RNA adds PolyA to react: 3.0 μ g, total nucleic acid RNA；1.0 μl ,Oligo dT Primer(50µ M)；1.0 μl ,dNTP Mixture(10µM)；Nuclease free water complements to 10 μ l；It is placed in 65 DEG C of water-baths again and is incubated for 5min, It is immediately placed on cooled on ice (extremely important), obtains 10 μ l reaction products.

Step (2) reverse transcription: following each component is added after collecting wall built-up drop in brief centrifugation: 10 μ l above-mentioned steps (1) Reaction product；4.0 μl,5×PrimeScriptII Buffer；0.5 μl,RNase Inhibitor(40U/μl)；1.0 μ l,PrimeScriptII Rtase (200U/μl)；Nuclease free water supplies total volume to 20 μ l.

Step (3) is mixed gently with pipettor, and of short duration centrifugation (time 10s) is placed on warm bath 50min in 50 DEG C of water-baths.

Step (4) be subsequently placed in it is another be heated to 95 DEG C of water-baths in advance, water-bath 5min terminates reaction.

Step (5) sets cooled on ice to room temperature again, finally obtains cDNA, carries out subsequent experimental or -80 DEG C of freezen protectives.

The PCR amplification of target gene

(1) 50 μ l, PCR reaction system include: 1.0 μ l, cDNA obtained above；10.0 μl ,Phusion HF(5x)；5.0 μl,dNTPs (2mM) ；2.5 μ l, upstream primer P1；2.5 μ l, downstream primer P2；0.5 μ l, high-fidelity DNA polymerase；Nothing Ribozyme water complements to 50 μ l.

(2) above-mentioned 50 μ l, PCR reaction system are mixed gently, carries out machine amplification after of short duration centrifugation (time 10s), expanded Increasing parameter is 98 DEG C of initial denaturations 2min, 98 DEG C of denaturation 5s, 68 DEG C of annealing 30s, 72 DEG C of extension 1min, and totally 30 circulations, last follow 72 DEG C of heat preservation 5min after ring finally obtain the PCR nucleic acid amplification product I containing HscB base sequence, and save in 4 DEG C.

Agarose gel electrophoresis identifies the PCR nucleic acid amplification product I containing CsHscB base sequence

(1) 1.0%(W/V is prepared) Ago-Gel: 1g electrophoresis grade agarose is weighed, addition fills 0.5 × TAE electrophoretic buffer In the conical flask of 100ml, microwave stove heating 30s is completely dissolved agarose；When gel is cooled to 50 DEG C, biotin 5 is added μ l, falls glue after shaking up, place 15min in room temperature, keep gelling solid.

(2) electrophoresis: taking the above-mentioned PCR nucleic acid amplification product I containing HscB base sequence, 5 μ l, with 1 μ l, 6 × sample-adding Buffer (is purchased from TIANGEN Biotech (Beijing) Co., Ltd.), is added in gel well after mixing；Core is added simultaneously Sour standard items (Marker is purchased from TIANGEN Biotech (Beijing) Co., Ltd.) do reference, by 3 ~ 4V/cm pressure stabilizing electrophoresis 30min.

(3) it observes: after electrophoresis, being observed under ultraviolet lamp and preservations of taking pictures, see Fig. 1, the segment is located at nucleic acid in display Between 800bp and 1000bp, about 852bp's standard molecular weight (Marker) is consistent with expected purpose clip size.

The purifying and recycling of PCR nucleic acid amplification product I containing CsHscB base sequence

(1) under long-wave ultra violet lamp, the above-mentioned gel (100 mg) containing target fragment is cut, is put into 1.5ml EP pipe and weighs；

(2) the PCR nucleic acid amplification containing HscB base sequence is purified according to OMEGA company PCR product QIAquick Gel Extraction Kit specification Product I, hereinafter referred to as: the PCR product I containing HscB base sequence；

(3) DNA fragmentation (4 μ l) after purification, 1% agarose gel electrophoresis, observation recycling result are taken.

(4) DNA fragmentation for taking step 3 to obtain serves the sequencing of marine growth engineering technology Co., Ltd, and sequencing sequence is The coding gene sequence of rCsHscB, as shown in SEQ ID NO:1.

Gene cloning (T/A clone) and identification

(1) pEASY-T1 Simpe Cloning Vector is reacted with the connection of CsHscB

Cloning reaction system is as follows: 4.0 μ l, the PCR product I containing HscB base sequence；1.0 μl,pEASY-T1 Simpe Cloning Vector；It is gently mixed, reacts at room temperature 10min；Connection product i.e. pEASY-T1-CsHscB plasmid is finally obtained, And the centrifuge tube equipped with the connection product is placed on ice after the completion of reaction.

The conversion and identification of plasmid

(1) the connection product i.e. pEASY-T1-CsHscB plasmid that takes 5 μ l is added to containing 50 μ l, competent cell DH-5 α In centrifuge tube, gently rotates to mix content, 30min is placed in ice；

(2) centrifuge tube is placed in 90s in 42 DEG C of water-baths, does not shake test tube；

(3) quickly centrifuge tube is transferred in ice bath, cooling 2 ~ 3min；

(4) 400 μ l, LB liquid medium are added into centrifuge tube again, then centrifuge tube is transferred on 37 DEG C of shaking tables, incubate 60min makes cell recovery；

(5) 13000r/min is centrifuged 30s at room temperature, removes part supernatant, cell is resuspended using remaining partially liq, uniformly Be coated on is in the LB solid medium of 50 μ g/ml kalamycin resistances containing concentration；

LB solid culture based formulas in the step is as follows: the LB solid medium containing 1.5% agar, wherein 1.5% agar consumption Refer to that agar accounts for the 1.5% of the quality of LB solid medium, after LB solid medium is melted, 50mg/ is added at 50 DEG C Ml kanamycins makes kanamycins to final concentration of 50 μ g/ml；

(6) it is inverted plate, is cultivated in 37 DEG C, after 12 ~ 16h, bacterium colony occurs；

(7) LB liquid medium that the single white colony of picking is seeded to 5ml, concentration containing kanamycin is 50 μ g/ml, transfer To 37 DEG C of shaking tables, 200r/min overnight incubation；Obtain the bacterium solution containing pEASY-T1-CsHscB plasmid；

(8) it collects the fresh bacterium solution sample containing pEASY-T1-CsHscB plasmid of 2ml and serves the limited public affairs of marine growth engineering technology Department's sequencing.Sequencing sequence is as shown in SEQ ID NO:1.

Genetic fragment is subcloned into pET-28a(+) expression vector and identification

(1) plasmid is extracted according to the small extraction reagent kit specification of Tiangeng high purity plasmid；

(2) using pEASY-T1-CsHscB plasmid as template, carry out PCR amplification, the reaction system of amplification is as follows: (1) 50 μ l, PCR reaction system includes: 1.0 μ l pEASY-T1-CsHscB plasmid obtained above；10.0 μl ,Phusion HF(5x)； 5.0 μl ,dNTPs (2mM)；2.5 μ l, upstream primer P1；2.5 μ l, downstream primer P2；0.5 μ l, high-fidelity DNA polymerization Enzyme；Nuclease free water complements to 50 μ l.

Above-mentioned 50 μ l, PCR reaction system are mixed gently, upper machine amplification, Amplification are 98 DEG C after of short duration (10s) centrifugation Initial denaturation 2min, 98 DEG C of denaturation 5s, 68 DEG C of annealing 30s, 72 DEG C of extension 1min, totally 30 circulations, keep the temperature for 72 DEG C after last recycles 5min obtains the PCR nucleic acid amplification product II containing HscB base sequence eventually, and saves in 4 DEG C.

Agarose gel electrophoresis identifies the PCR nucleic acid amplification product II containing CsHscB base sequence:

(1) 1.0%(W/V is prepared) Ago-Gel

1g electrophoresis grade agarose is weighed, is added in the conical flask for filling 0.5 × TAE electrophoretic buffer 100ml, microwave stove heating 30s is completely dissolved agarose；When gel is cooled to 50 DEG C, 5 μ l of biotin is added, falls glue after shaking up, places in room temperature 15min keeps gelling solid.

(2) electrophoresis

The above-mentioned PCR nucleic acid amplification product II containing HscB base sequence, 5 μ l are taken, (is purchased from 1 μ l, 6 × sample loading buffer TIANGEN Biotech (Beijing) Co., Ltd.), it is added in gel well after mixing；Nucleic acid standards are added simultaneously (Marker is purchased from TIANGEN Biotech (Beijing) Co., Ltd.) does reference, by 3 ~ 4V/cm pressure stabilizing electrophoresis 30min.

(3) it observes

It after electrophoresis, is observed under ultraviolet lamp and preservation of taking pictures, shows that the segment is located at nucleic acid standard molecular weight (Marker) Between 800bp and 1000bp, about 852bp is consistent with expected purpose clip size.

The purifying and recycling of PCR nucleic acid amplification product II containing CsHscB base sequence:

(1) under long-wave ultra violet lamp, the above-mentioned gel (100 mg) containing target fragment is cut, is put into 1.5ml EP pipe and weighs；

(2) the PCR nucleic acid amplification containing HscB base sequence is purified according to OMEGA company PCR product QIAquick Gel Extraction Kit specification Product II, hereinafter referred to as: the PCR product II containing HscB base sequence；

(3) DNA fragmentation (4 μ l) after purification, 1% agarose gel electrophoresis, observation recycling result are taken.

(3) One Step Cloning kit specification is only praised according to promise by the PCR product containing HscB base sequence II and pET-28a(+) double enzyme digestion product carry out recombining reaction, obtain the recombinant plasmid containing CsHscB genetic fragment, name For pET-28a-CsHscB.Supreme marine growth engineering technology Co., Ltd is sent to be sequenced digestion products, sequence is compared through Blast, It was found that the sequence similarity 100% announced with ncbi database, as shown in Figure 2.

Two, recombinant bacterium is constructed

1. recombinant plasmid pET-28a-CsHscB conversion expression bacterium

(1) take the pET-28a-CsHscB plasmid of 5 μ l be added to containing 50 μ l, BL-21 bacterium solution centrifuge tube in, gently rotate with Content is mixed, 30min is placed in ice；

(2) centrifuge tube is then placed in 90s in 42 DEG C of water-baths, does not shake test tube；

(3) quickly centrifuge tube is transferred in ice bath, cooling 2 ~ 3min；

(4) 400 μ l, LB liquid medium are added into centrifuge tube again, then centrifuge tube is transferred on 37 DEG C of shaking tables, incubate 60min makes cell recovery；

(5) 13000r/min is centrifuged 30s at room temperature, removes part supernatant, cell is resuspended using remaining partially liq, uniformly Be coated on is in the LB solid medium of 50 μ g/ml kanamycins containing concentration；

LB solid medium among the above refers to: the LB solid medium containing 1.5% agar, wherein 1.5% agar refers to that agar accounts for The 1.5% of the quality of LB solid medium；

After LB solid medium is melted, 50mg/ml kanamycins is added at 50 DEG C, trains kanamycins in LB solid Supporting the concentration in base is 50 μ g/ml, obtains the LB solid medium containing concentration for 50 μ g/ml kanamycins；

(6) it is inverted plate, is cultivated in 37 DEG C, after 12 ~ 16h, bacterium colony occurs；

(7) LB liquid medium that the single white colony of picking is seeded to 5ml, concentration containing kanamycins is 50 μ g/ml, is transferred to 37 DEG C of shaking tables, 200r/min overnight incubation；Obtain the bacterium solution containing pET-28a-CsHscB plasmid, abbreviation BL21-pET-28a- CsHscB bacterium solution；The encoding amino acid sequence of BL21-pET-28a-CsHscB bacterium solution recombinant protein, the i.e. amino of CsHscB albumen Acid sequence is as shown in SEQ ID NO:2.

Empty plasmid pEt-28a is converted into BL-21 according to same method, obtains control bacterium BL21-pET-28a bacterium solution.

Expression in Escherichia coli

(1) it expands thallus: picking them separately BL21-pET-28a bacterium solution and BL21-pET-28a-CsHscB bacterium solution is cloned；

Specific cloning process are as follows: first it is placed in 5ml, the LB liquid medium that concentration containing kanamycins is 50 μ g/ml, 37 DEG C, 200r/ Min shakes overnight incubation；

The LB liquid medium that the bacterium solution for taking 5ml to be incubated overnight again is inoculated into 500ml, concentration containing kanamycins is 50 μ g/ml, 37 DEG C, 200r/min shaking culture to OD600 ≈ 0.6；

(2) inducing expression: collecting non-Induced cultures and save in refrigerator, remaining addition isopropyl-beta D-thio pyrans half Lactoside (Isopropyl β-D-1-Thiogalactopyranoside, IPTG) shakes to 1mmol/L in 16 DEG C, 120r/min Shake culture 10h；

(4) prepared by crude protein: at 4 DEG C, 12000r/min, 5min are centrifuged thallus, weigh precipitating thallus object weight in wet base, every gram of precipitating bacterium 5 ~ 10ml, Binding buffer are added in body object to be resuspended；Ice-bath ultrasonic is crushed 10min, 4 DEG C, 12000r/min, 5min from The heart collects supernatant, and through 0.22 μm of filter filtering to remove impurity particle object, thick rCsHscB is made；

Wherein, the constituent of Binding buffer is as follows: 500 mM, NaCl, 10 mM, Na₂HPO₄•12H₂O, 10 mM, NaH₂PO4•2H₂O, 20 mM, imidazoles.As shown in figure 3, induced through various concentration IPTG, in SDS-PAGE glue respectively in bacterium solution RCsHscB, about 36KDa are detected in cleer and peaceful thallus, as shown in Figure 3.

Purifying and identification in Escherichia coli

(1) thick rCsHscB purifying

According to the operating procedure of KTA design tomographic system, make HisTrap FF column material with Binding buffer first Balance then by prepared thick rCsHscB in conjunction with HisTrap FF column material, then is washed with a large amount of Binding buffer The foreign protein of de- non-specific binding, reusing the imidazoles of various concentration, (concentration is 100 mM, 200 mM, 400 mM, 500 MM) Elution buffer elutes destination protein, and successively collects eluent and percolation liquid, obtains purifying rCsHscB；

Elution buffer formula is as follows: 500mM, NaCl；10mM,Na2HPO4•12H2O；10 mM,NaH2PO4•2H2O； 100 ~ 500 mM, imidazoles.

(2) SDS-PAGE

Sample preparation: drawing suitable purifying rCsHscB and percolation liquid, addition final concentration 1 × albumen sample-loading buffer, 100 DEG C heating 5min, at room temperature 12000r/min be centrifuged 1min；

PAGE glue preparation: first plus 5ml separation gel (concentration 12.5%), after solidification plus 3ml concentration glue (concentration 4%), and being inserted into comb, Comb is pulled out after solidification, cleans well with Running buffer；

Loading: thick rCsHscB, purifying rCsHscB distinguish 20 μ l of loading, and stay protein Marker on a well；

Electrophoresis: voltage is risen to 120V, electrophoresis about 1.5h until indicator reaches two glue intersections by 60V electrophoresis about 45min (migrating to bromophenol blue to the about 1cm of distance separation glue bottom)；

Dyeing, camera shooting: unloading blob of viscose, carries out coomassie brilliant blue staining 1h, with destainer decoloration about 2h, is shone with gel imaging system Mutually record.

After purification, product observes the band of expression (see figure 4) of rCsHscB, protein molecular after SDS-PAGE is separated Measuring size is about 36KDa, in the same size with prediction.

Identification in Escherichia coli

RCsHscB is identified using Western blot technology

(1) it transferring film: installs after wet rotary device with 80mA, on 1.5h electrotransfer protein to pvdf membrane；

(2) close: separation pvdf membrane passes through the TBST room temperature containing 5% skim milk and closes 5h；

(3) primary antibody reacts: adding the anti-histidine tag of mouse (His-tag) IgG(1:1000), 4 DEG C of overnight incubations；

(4) secondary antibody reacts: after washing film (10min/ times, wash 4 times) through TBST, the sheep anti-mouse igg with horseradish peroxidase-labeled (1:2000) is incubated for 2h；

(6) result and record are observed: after washing film (10min/ times, wash 4 times) through TBST, with the colour developing of ECL luminescence reagent, exposure, being clapped According to record.

As shown in figure 5, the rCsHscB of purifying identifies there is a single item near 36KDa through Western blot Band, amalgamation and expression His label protein.

Concentration, Endotoxin removal and concentration mensuration

Concentration, replacement buffer

1. using ddH₂O rinses Amicon Ultra-15 10K ultrafiltration column；

2. the purifying rCsHscB for being no more than 15ml is added into ultrafiltration apparatus;

3. the ultrafiltration apparatus to close the lid is put into pendulum bucket rotor centrifuge, 4 DEG C, 4000g rotates 20min；

4. PBS is added into upper layer concentrate, 4000g rotates 20min；

5. repeating 2. to 4. step 2 ~ 3 time；

6. recycling concentrate.

Remove endotoxin and assay

The endotoxin after being concentrated in recombinant C sHscB is removed according to day bounties liquid phase Endotoxin removal agent specification step, and is used Its bounties terminal development process quantitative measurement of endotoxin kit detects endotoxic content in rCsHscB.

It is detected through huge legendary turtle reagent quantitative measurement of endotoxin kit, endotoxin content ﹤ 0.05EU/ml.

Determination of protein concentration

RCsHscB albumen is filtered through 0.22 μm of filter, is measured according to BCA method determination of protein concentration kit specification step The content of rCsHscB, measuring concentration is 0.8mg/ml, is sub-packed in -80 DEG C of preservations.

Embodiment 2:rCsHscB improves the cholestatic liver fibrosis of DDC induction

One, the foundation and grouping of cholestatic liver fibrosis animal model

Experimental animal: testing C57BL/6 mouse used and be purchased from Beijing Si Beifu Bioisystech Co., Ltd, female, all number 6-8 In week, 20 ~ 30 g of weight, SPF grades, purchase, which is placed in SPF grades of animal houses of Xuzhou medical university, raises, and guarantees during raising abundant Food and illumination, and ensure suitable temperature and humidity.

Experiment mice grouping

Before establishing model mice, first the experiment mice being included in is grouped, 24 mouse be chosen, according to random distribution method Principle, is divided into PBS group, rCsHscB group, DDC group and (DDC+ rCsHscB) group, and every group mouse 6.(explanation: described in full text RCsHscB refers both to clonorchis sinensis recombinant protein c sHscB).

The modeling method of the cholestatic liver fibrosis of induction

PBS group and rCsHscB group orally pour into appropriate physiological saline, mouse of the daily feeding of every mouse of DDC group containing 0.1%DDC Grain, (DDC+ rCsHscB) group be with DDC group equally processing on separately give rCsHscB treatment (1.5mg/kg weight, abdominal cavity Injection, injection is primary every three days), PBS group and rCsHscB group given in the case where normal diet the PBS of equivalent with rCsHscB.It is cutd open after modeling 4w and kills mouse.Each group mouse is observed, liver is separated, visually observes the change of mouse liver general pathology Change, discovery: PBS group and rCsHscB group mouse liver color are scarlet, and surface is smooth, and interface is clear, and matter is soft.DDC group mouse liver Extravasated blood, enlargement are obvious, and color is dark brown, and there is granular sensation on surface, and the matter of touching is tough.And (DDC+ rCsHscB) organizes mouse, liver Extravasated blood and enlargement are substantially reduced, and color is kermesinus, and surface is without granular sensation, the slightly tough (see figure 6) of quality.

Two, sample collection and processing

Collect hepatic tissue sample

4w after modeling, eyeball take blood, are put to death using disconnected cervical approach；Thoracic cavity is opened from mouse hunter's line with eye scissors, by liver group It knits exposure to open, the gall-bladder of liver is removed with scissors, removes hepatic tissue.Serum is separated, by eyeball blood refrigerated centrifuge 3500r/min, 4 DEG C of centrifugation 15min, packing, -80 DEG C of refrigerators freeze spare.

The hepatic tissue of taking-up is placed on glass blocks on ice, hepatic tissue takes one piece of (1cm of hepatic tissue at edge 4mm × 1cm × 1cm), be put into 4% paraformaldehyde solution be fixed for HE dyeing, by remaining hepatic tissue be cut into several pieces (1cm × 1cm × 1cm), it is frozen in -80 DEG C of refrigerators spare.

Dyeing

It is damaged to study hepatic pathology caused by DDC induction C57BL/6 mouse, we dye with conventional H E and carry out to liver Pathological observation.As a result as shown in fig. 7, PBS group and the independent injection group lobuli hepatis of rCsHscB group are complete, boundary is relatively clear, Liver cell structural integrity is full, does not find bile duct proliferation；And more neutrophil leucocyte, monokaryon around DDC model group central vein The inflammatory cell infiltrations such as cell, bile duct thickening become larger, and hyperplasia is obvious, have protoporphyrin embolism to be formed in bile duct, show bile duct Block and with hyperplasia.Collagenous fibres increase, it is seen that obvious fibrous septum, fibroblast assemble around bile duct, table It is bright to have liver fibrosis.And compared with DDC group, inflammatory cell infiltration in rCsHscB treatment group (DDC+rCsHscB group) liver It reduces, bile duct proliferation mitigates, and bile duct mesoporphyrin embolism number is reduced, and the fibroblast number of bile duct week aggregation is reduced.As a result Show that rCsHscB treatment can obviously reduce the hyperplasia of inflammatory cell infiltration caused by DDC and bile duct epithelial cell.

Dyeing

In order to observe each group mouse liver Collagen fiber deposition situation, we carry out Masson dyeing to each group mouse liver tissue (Masson staining kit builds up Bioengineering Research Institute purchased from Nanjing), and mouse liver group is observed with ordinary optical microscope Masson staining conditions are knitted, as a result, it has been found that: it is clearly complete normally to organize mouse (PBS group and rCsHscB group) hepatic tissue lobuli hepatis structure Whole, liver cell is arranged radially centered on central vein, collagen-free fibroplasia, portal area blood in central vein and sinus hepaticus Tube wall dye on a small quantity blue collagenous fibres distribution, see portal area and central vein area vascular wall blue.Model group (DDC group) Mouse lobuli hepatis structure disorder, collagenous fibres obviously deposit, and around the bile duct of expansion, along the tendency of bile duct, have bright Aobvious blue deposition, finds that compared with the control group, blue colored area increased significantly by Image J software analysis, prompts collagen fine Dimension deposition increases generation around bile duct (Fig. 8 A).It then takes an evident turn for the better after rCsHscB treatment, collagenous fibres is heavy around bile duct Product area is reduced, degree of fibrosis mitigation (Fig. 8 A, B,P< 0.05).

The detection of serum alt, AST

After the blood of acquisition stands solidification, 3500 r/min are centrifuged 15 min, separate serum, detect immediately.Serum alt, AST Content is measured by automatic clinical chemistry analyzer, is provided by Xuzhou clinical laboratory, affiliated hospital, medical university.

As a result as, it can be found that hepatic injury is obvious after DDC administration, serum glutamic pyruvic transminase (ALT), millet straw turn ammonia in Fig. 9 Enzyme (AST) content obviously increase (P< 0.001), and after rCsHscB treatment, compared with DDC group, ALT content (shown in Fig. 9 A) And AST content be substantially reduced (Fig. 9 A, shown in B,P< 0.001).The result shows that rCsHscB can be substantially reduced caused by DDC Hepatic injury index.

Hepatic tissue hydroxyproline (Hyp) assay

PBS group, rCsHscB group, DDC group and (DDC+ rCsHscB), which are weighed, with electronic balance organizes every mouse weight in wet base 50-100 Mg hepatic tissue is put into each test tube, (builds up bio-engineering research purchased from Nanjing according to commercialization Hydroxyproline assay kit Institute) hydroxyproline in mouse liver is detected.

Hydroxyproline is the important indicator for reflecting degree of hepatic fibrosis, and the results are shown in Figure 10: after DDC induction, Mouse Liver Dirty middle hydroxyproline be apparently higher than Normal group (P< 0.001)；After rCsHscB treatment, compared with DDC group, in mouse liver Hydroxyproline content is substantially reduced, and difference have statistical significance (P< 0.05).

Fibrosis index of correlation in murine liver tissueCol1 andα-SMA protein expression analysis

Each group murine liver tissue is taken, isolates total serum IgE with TrolzolLS reagent (Invirtogen, Karlsruhe, German), Then inverse using QuantiTectReverse Transcription kit (being purchased from Beijing Tiangeng Bioisystech Co., Ltd) It is transcribed into cDNA.According to operating guidance (Roche) using SYBR green qPCR master mix transcribe resulting cDNA come Measure the expression relative quantity of gene.Using iCycler heat circulating system and iQ5 optical system software (Roche) to the table of gene Up to being measured in real time.The experiment of RT-PCR is carried out using conventional method, is had for detecting the primer of gene expression:

col1F:CAGGGTATTGCTGGACAACGTC

col1R:GGACCTTGTTTGCCAGGTTCA

β-actin F:AACTCCATCATGAAGTGTGA

β-actin R:ACTCCTGCTTGCTGATCCAC

Hepatic tissue is cracked with RIPA, using the content of BCA detection total protein, conventional Western blot detects each group mouse liver α-SMA and β-actin primary antibody and corresponding secondary antibody is added using β-actin as internal reference in the expression of middle α-SMA albumen, It is incubated for, measures the protein expression level of α-SMA.

α-SMA is the mark of hepatic stellate cells HSC activation, we detect each group Mouse Liver with routine Western blot The expression of dirty middle α-SMA albumen.As a result, it has been found that: compared with the control group, the protein expression water of mouse α-SMA after DDC infection Dawn is aobvious to increase, and statistical difference it is significant (p< 0.001, such as Figure 11), and mouse α-SMA is substantially reduced after rCsHscB treatment (p< 0.001).

QRT-PCR the result shows that, compared with normal group, DDC model groupcol1(p< 0.001) mRNA expression increases Add；After rCsHscB treatmentcol1(p< 0.001) mRNA expression reduces (Figure 11 C, 11D).

Immunohistochemistry detects bile duct epithelial cell proliferative conditions

In order to analyze whether rCsHscB albumen can be relieved bile duct epithelial cell proliferative conditions caused by DDC, each group Mouse Liver group is taken It knits, carries out immunohistochemical staining.Hepatic tissue section boils 15 minutes in citrate buffer solution with Endogenous peroxide of putting out a fire Enzyme.15 minutes inhibition peroxidase of methanol that volume parts are 1% are incubated for the Normal Goat Serum for being 10% in volume parts (being purchased from green skies Bioisystech Co., Ltd), to prevent the combination of non-specific immunoglobulin.The monoclonal antibody used EBioscience, Inc., CA, US are purchased from for CK19, Ki67 and OPN() bile duct epithelial cell is proliferated label respectively Situation.Cell count is carried out using image pro plus6 (ipp6) software.

It was found that display, after DDC feeding 4 weeks, CK19(is shown in Figure 12 A, B； p< 0.001), Ki67(is shown in Figure 13 A, B；p< 0.001), OPN(is shown in Figure 14 A, B； p< 0.001) expression obviously increases, and after rCsHscB processing, around portal area and bile duct CK19(is shown in Figure 12 A, B in epithelial cell； p< 0.01), Ki67(is shown in Figure 13 A, B； p< 0.01), OPN(is shown in Figure 14 A, B； p< 0.05) positive expression cell is substantially reduced, and difference has statistical significance.

The expression of inflammatory factor in murine liver tissue

In order to detect inflammatory factor expression situation in each group murine liver tissue, IL- in liver tissue homogenate's liquid is had detected using ELISA 6, MCP-1, TNF-α, IL-10 content (experimental procedure is referring to kit specification), are had detected using conventional qRT-PCRtnfa、il1bRelative expression's situation of equal cytokine genes, as a result, it has been found that promoting in DDC model group murine liver tissue compared with PBS group Inflammatory cytokines IL-6(Figure 15 A； p< 0.05), MCP-1(Figure 15 B； p< 0.01),tnfa(Figure 15 C； p< 0.05),il1b (Figure 15 D； p< 0.05) level also obviously increases.After rCsHscB treatment, IL-6(Figure 15 A； p< 0.001), MCP-1(schemes 15B； p< 0.001),tnfa(Figure 15 C； p< 0.05),il1b(Figure 15 D； p< 0.05) it is substantially reduced.Show rCsHscB egg The expression of the white murine liver tissue proinflammatory factor for being able to suppress DDC induction.

QRT-PCR primer sequence is as follows, and primer is synthesized by Shanghai Jierui Biology Engineering Co., Ltd's design.

β-actin F:AACTCCATCATGAAGTGTGA

β-actin R:ACTCCTGCTTGCTGATCCAC

TnfaF:CTTGTTGCCTCCTCTTTTGCTTA

TnfaR:CTTTATTTCTCTCAATGACCCGTAG

Il1b F:TGTGTTTTCCTCCTTGCCTCTGAT

Il1bR:TGCTGCCTAATGTCCCCTTGAAT

Embodiment 3:rCsHscB can inhibit the activation of hepatic stellate cells

One, the cell culture of hepatic stellate cells LX-2

LX-2 cell is purchased from Wuhan University Of Technology Xiang Ya medical college, after conventional recovery, 0.25% pancreatin of logarithmic growth phase cell Digestion, suspension cell is inoculated in 6 cm culture dishes after counting again after centrifugation, and cell is with 4 × 10⁵The density of/mL is inoculated with.(6) Experimental group and cell processing:

After adherent 24 h of LX-2, respectively by PBS, TGF-β 1(15 ng/mL), TGF-β 1(15 ng/mL)+CsHscB(35 ug/ ML), TGF-β 1(15 ng/mL)+RSG(1 μM) it is added in culture dish, DMEM volume is added and supplies 2 ml.It is placed in 37 DEG C, 5% CO₂Continue to cultivate in incubator.1 mL Trizol is added afterwards for 24 hours, mixes, is stored in -80 °C, to be ready for use on RNA extracting； Pancreatin digestion is added, centrifugation is added PBS and rinses, is stored in -80 °C, is ready for use on protein and Total RNAs extraction.

Respectively with the expression of qRT-PCR and western-blot detection Hepatic Stellate Cell Activation marker α-SMA

It takes each group to handle cell, isolates total serum IgE with TrolzolLS reagent (Invirtogen, Karlsruhe, German), so It is reversed afterwards using QuantiTectReverse Transcription kit (being purchased from Beijing Tiangeng Bioisystech Co., Ltd) Record into cDNA.Resulting cDNA is transcribed to survey using SYBR green qPCR master mix according to operating guidance (Roche) Measure the expression relative quantity of gene.Expression using iCycler heat circulating system and iQ5 optical system software (Roche) to gene It is measured in real time.The experiment of RT-PCR is carried out using conventional method, is had for detecting the primer of gene expression:

β-actinF:GCCCTGAGGCACTCTTCCA

β-actinR:TTGCGGATGTCCACGTCA

ACTA2F:TTCATCGGGATGGAGTCTGCTGG

ACTA2R:TCGGTCGGCAATGCCAGGGT

Above-mentioned qRT-PCR primer is synthesized by Shanghai Jierui Biology Engineering Co., Ltd's design.

It is precipitated with RIPA lytic cell, using the content of BCA detection total protein, conventional Western blot detects each group α-SMA and β-actin primary antibody and corresponding is added using β-actin as internal reference in the expression of α-SMA albumen in HSCs Secondary antibody is incubated for, and measures the protein expression level of α-SMA.By Western blot and qRT-PCR detection it can be found that RCsHscB can be substantially reduced the expression of LX-2 cell α-SMA caused by TGF-β 1, and when rCsHscB concentration is 40 μ g/ When ml,ACTA2(The gene of coding for alpha-SMA albumen) expression be substantially reduced, difference have statistical significance (p< 0.05, Figure 16 C), the protein expression level of same α-SMA be significantly reduced (p< 0.05, Figure 16 A and 16B).Document shows PPAR γ's Agonist rosiglitazone (RSG) can reverse the activation of hepatic stellate cells to mitigate liver fibrosis, still select RSG conduct Positive control, it can be seen that RSG and rCsHscB can mitigate the expression of hepatic stellate cells α-SMA, explanation from Figure 16 A RCsHscB can the horizontal obvious activation for inhibiting hepatic stellate cells in vitro.

The preferred embodiment of the present invention has been described in detail above, but the invention be not limited to it is described Embodiment, those skilled in the art can also make various equivalent changes on the premise of not violating the inventive spirit of the present invention Type or replacement, these equivalent variation or replacement include in the claim of this application limited range.

Sequence table

<110>Xuzhou medical university

<120>application of the clonorchis sinensis recombinant protein c sHscB in cholestatic liver fibrosis therapeutic agent

<130> 2

<160> 2

<170> SIPOSequenceListing 1.0

<210> 3

<211> 852

<212> DNA

<213>clonorchis sinensis (clonorchis sinensis)

<400> 3

atgtcatttc gtctcgcacc atcaatcacg cgatttcgac ggatatggac gaactcactg 60

ccatcgtacc tttcaagctt ttgcctcata gcctgtcaac ctcagcatac aattttatgg 120

acacacgaaa acataaccac ccatccattc ccacgaatgt tttgcactct tccttcgaac 180

aaacgccaat gctggaattg taaccgtcca gtacgggaca acgaattttt ttgtgagtgt 240

ggtaaaattc agcctgtgga acgggattgg acttactttg aagtccttgg ttatggcgaa 300

cccacagttc atattgacct tgcagacctg gcgcagcgca tgcgtgagat gcagaaacgt 360

ttgcacccag ataaattttc ccgtgccacg ccatacgaac aagaactggc tgcagatgcc 420

gccactttcg taaatcgtgc gtatgctatg ttagaacaac ctgaaagtcg tttcgcctac 480

tttctgtccc tgcatcatcc ctcggaggac gcatcaccaa acacggacat tctggaccca 540

gacttcctaa ctgaaatgct cgagctcaat gaagagattg aggaattttc agaattgctt 600

actgcagtta aggagaaaag gcacgaggct tccaagttat ccgtattatt gaaggagttg 660

cttcatagaa tttcacagga cctaatgaca gaacgtgcca aactagtgac agctcttgat 720

gaagctaggt ggaaggatgc tcaagcttta ctcaataagt gtaggtacct ttcacggact 780

tttgatcgtc tcaaagaata tgagctggat tggcgtagag ttggtattac agttgatatt 840

cctccgcatt aa 852

<210> 4

<211> 282

<212> PRT

<213>clonorchis sinensis (clonorchis sinensis)

<400> 4

Met Ser Phe Arg Leu Ala Pro Ser Ile Thr Arg Phe Arg Arg Ile Trp

1 5 10 15

Thr Asn Ser Leu Pro Ser Tyr Leu Ser Ser Phe Cys Leu Ile Ala Cys

20 25 30

Gln Pro Gln His Thr Ile Leu Trp Thr His Glu Asn Ile Thr Thr His

35 40 45

Pro Phe Pro Arg Met Phe Cys Thr Leu Pro Ser Asn Lys Arg Gln Cys

50 55 60

Trp Asn Cys Asn Arg Pro Val Arg Asp Asn Glu Phe Phe Cys Glu Cys

65 70 75 80

Gly Lys Ile Gln Pro Val Glu Arg Asp Trp Thr Tyr Phe Glu Val Leu

85 90 95

Gly Tyr Gly Glu Pro Thr Val His Ile Asp Leu Ala Asp Leu Ala Gln

100 105 110

Arg Met Arg Glu Met Gln Lys Arg Leu His Pro Asp Lys Phe Ser Arg

115 120 125

Ala Thr Pro Tyr Glu Gln Glu Leu Ala Ala Asp Ala Ala Thr Phe Val

130 135 140

Asn Arg Ala Tyr Ala Met Leu Glu Gln Pro Glu Ser Arg Phe Ala Tyr

145 150 155 160

Phe Leu Ser Leu His His Pro Ser Glu Asp Ala Ser Pro Asn Thr Asp

165 170 175

Ile Leu Asp Pro Asp Phe Leu Thr Glu Met Leu Glu Leu Asn Glu Glu

180 185 190

Ile Glu Glu Phe Ser Glu Leu Leu Thr Ala Val Lys Glu Lys Arg His

195 200 205

Glu Ala Ser Lys Leu Ser Val Leu Leu Lys Glu Leu Leu His Arg Ile

210 215 220

Ser Gln Asp Leu Met Thr Arg Ala Lys Leu Val Thr Ala Leu Asp Glu

225 230 235 240

Ala Arg Trp Lys Asp Ala Gln Ala Leu Leu Asn Lys Cys Arg Tyr Leu

245 250 255

Ser Arg Thr Phe Asp Arg Leu Lys Glu Tyr Glu Leu Asp Trp Arg Arg

260 265 270

Val Gly Ile Thr Val Asp Ile Pro Pro His

275 280

Claims (7)

1. application of the clonorchis sinensis recombinant protein c sHscB in cholestatic liver fibrosis therapeutic agent.

2. clonorchis sinensis recombinant protein c sHscB according to claim 1 is in cholestatic liver fibrosis therapeutic agent In application in, the clonorchis sinensis recombinant protein c sHscB contains CsHscB albumen and His label protein；

The coding gene sequence of the clonorchis sinensis recombinant protein c sHscB is as shown in SEQ ID NO: 1.

3. clonorchis sinensis recombinant protein c sHscB according to claim 2 is in cholestatic liver fibrosis therapeutic agent In application, it is characterised in that: the amino acid sequence of the CsHscB albumen is as shown in SEQ ID NO: 2.

4. clonorchis sinensis recombinant protein c sHscB according to claim 2 is in cholestatic liver fibrosis therapeutic agent In application, it is characterised in that: the amino acid sequence of the His label protein be Pet-28a (+) plasmid on His label protein Amino acid sequence corresponding to coded sequence: HHHHHH.

5. clonorchis sinensis recombinant protein c sHscB according to claim 2 is in cholestatic liver fibrosis therapeutic agent In application, it is characterised in that: the N-terminal of the His label protein and the C-terminal of the CsHscB albumen link.

6. clonorchis sinensis recombinant protein c sHscB according to claim 2 is in cholestatic liver fibrosis therapeutic agent In application, it is characterised in that: between the CsHscB albumen and His label protein pass through link peptide connect.

7. a kind of drug for treating cholestatic liver fibrosis, it is characterised in that: inhaled containing magnificent branch testis as claimed in claim 2 Worm recombinant protein c sHscB.