CN110226087A - Chemiluminescent indicator used in the detection method of organism substance, this method - Google Patents
Chemiluminescent indicator used in the detection method of organism substance, this method Download PDFInfo
- Publication number
- CN110226087A CN110226087A CN201880008839.6A CN201880008839A CN110226087A CN 110226087 A CN110226087 A CN 110226087A CN 201880008839 A CN201880008839 A CN 201880008839A CN 110226087 A CN110226087 A CN 110226087A
- Authority
- CN
- China
- Prior art keywords
- protein
- organism substance
- organism
- detection method
- substance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/72—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving blood pigments, e.g. haemoglobin, bilirubin or other porphyrins; involving occult blood
- G01N33/728—Bilirubin; including biliverdin
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/76—Chemiluminescence; Bioluminescence
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
- G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
- G01N33/542—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/582—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/645—Specially adapted constructive features of fluorimeters
- G01N21/6452—Individual samples arranged in a regular 2D-array, e.g. multiwell plates
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/08—Hepato-biliairy disorders other than hepatitis
- G01N2800/085—Liver diseases, e.g. portal hypertension, fibrosis, cirrhosis, bilirubin
Abstract
The present invention provides a kind of detection method that can be easy the organism substance quantitative determined.A kind of detection method, it is the detection method of the organism substance in sample, it includes: mixing makes the substrate of fusion protein (C) and the chemiluminescence protein (B) for being fused into combination with the protein (A) and chemiluminescence protein (B) of organism substance in Xiang Suoshu sample；And, observe the luminous signal from the sample, the protein (A) is connect in a manner of it can carry out Resonance energy transfer with the protein (B), the protein (A) is that the protein (A1) of capable of emitting fluorescence or the protein (A2) in combination with the organism substance as autofluorescence molecule, the protein (B) can use the fluorescence or autofluorescence that its luminous energy excites the protein (A) in the state of being combined with the organism substance.
Description
Technical field
This disclosure relates to chemiluminescent indicator used in a kind of detection method and this method of organism substance.
Background technique
As the method for the organism substance in detection sample, the method using fluorescin can be enumerated.For example, patent is literary
It offers 1 and proposes following scheme: then playing the UnaG of fluorescent characteristic using the non-binding type bilirubin for being combined as organism substance
Albumen or its variant, to detect non-binding type bilirubin.
Bilirubin refers to the decomposition product of the heme of the construct as hemoglobin.Bilirubin has fat-soluble
Non-binding type bilirubin (also referred to as indirect bilirubin) and water-soluble mating type bilirubin (also referred to as bilirubin direct).Non- knot
During mould assembly bilirubin is discharged in blood or urinates with the reduction of liver function.The indirect bilirubin of high concentration causes nuclear icterus
(bilirubin encephalopathy).
Currently, the measurement of bilirubin is mainly using heavy nitrogen as the quantitative colorimetr of representative.In blood test, usually survey
Determine total bilirubin (bilirubin direct and indirect bilirubin total) and bilirubin direct, calculates its difference, it is red as indirect gallbladder
Element.
Existing technical literature
Patent document
Patent document 1:WO 2014/133158
Summary of the invention
The technical problems to be solved by the invention
The fluorescin of organism substance is combined to carry out the detection of the organism substance, quantitative feelings using as UnaG
Under condition, the excitation light source for observation is needed.In addition, due to exciting a wavelength to survey light for a wavelength, it is difficult to carry out sometimes
Quantitative determination.
Therefore, the disclosure provides a kind of detection side that can be easy the organism substance quantitative determined in a mode
Method and chemiluminescent indicator.
Technical teaching for solving the problem was
A kind of disclosure detection method involved in one or more embodiments is the organism substance in sample
Detection method is (hereinafter also referred to as the detection method of the disclosure.), it includes:
Into the sample, mixing is fused into the protein (A) of combinable organism substance and chemiluminescence protein (B)
The substrate of fusion protein (C) and the chemiluminescence protein (B)；And
The luminous signal from the sample is observed,
The protein (A) is connect in a manner of it can carry out Resonance energy transfer with the protein (B),
The protein (A) is the protein (A1) of capable of emitting fluorescence or can in the state of being combined with the organism substance
It is combined as the protein (A2) of the organism substance of autofluorescence molecule,
The protein (B) can use the fluorescence or autofluorescence that its luminous energy excites the protein (A).
The disclosure a kind of chemiluminescent indicator involved in other one or more embodiments, for containing make can
In conjunction with the chemiluminescence instruction for the fusion protein (C) that the protein (A) and chemiluminescence protein (B) of organism substance are fused into
Agent, wherein
The protein (A) is connect in a manner of it can carry out Resonance energy transfer with the protein (B),
The protein (A) is the protein (A1) of capable of emitting fluorescence or can in the state of being combined with the organism substance
It is combined as the protein (A2) of the organism substance of autofluorescence molecule,
The protein (B) can use the fluorescence or autofluorescence that its luminous energy excites the protein (A).
The disclosure a kind of carrier or transformant involved in other one or more embodiments, can express fusion egg
White (C).
A kind of disclosure method of discrimination involved in other one or more embodiments, it includes: it is based on this public affairs
The luminous signal data that the detection method opened obtains differentiate the organism material concentration in sample.
Invention effect
According to the disclosure, in a mode, can provide one kind can be easy the organism substance quantitative determined
Detection method.
Detailed description of the invention
Fig. 1 shows the changes for the fusion protein for having carried out C-terminal/N-terminal defect variation various UnaG and NLuc
Learn luminescent spectrum.UnaG (C Δ 0)+NLuc (N Δ 1) indicates maximum FRET efficiency.
Fig. 2 indicates chemiluminescence spectra when being inserted into various variations in joint sequence.With wild type chemiluminescence gallbladder
The sequence (GT) of red pigment indicator is compared, and the variant for being replaced into DD sequence shows maximum FRET efficiency change.
The titration curve of Fig. 3 expression wild type chemiluminescence bilirubin indicator.The average value that 3 times independently measure is marked
It draws, is fitted using Xi Er formula.KdValue is 3.05nM.
Fig. 4 indicates compatibility (dissociation constant, K of the bilirubin relative to the freeze-drying sample saved at room temperaturedValue)
Variation.
Fig. 5 indicates the bilirubin of the wild type chemiluminescence bilirubin indicator and various concentration that are shot with smart phone
Chemiluminescence picture on 96 orifice plates of solution.
Fig. 6 indicates the one of the result of the determination of bilirubin using UnaG (C Δ 0)-NLuc (N Δ 1) fusion protein in embodiment 2
Example, the A of Fig. 6 indicate that chemiluminescence spectra, the B of Fig. 6 are to indicate (the detection of UnaG (C Δ 0)-NLuc (N Δ 1) fusion protein solution
Reagent) dilution rate and the peak value obtained by luminous intensity rate value (530nm/460nm) relationship coordinate diagram.
Fig. 7 indicates an example of the result of the determination of bilirubin using UnaG albumen in comparative example 1, and the A of Fig. 7 indicates fluorescence light
Spectrum, the B of Fig. 7 is the seat of the relationship of the concentration for indicating UnaG protein solution (detection reagent) and the fluorescence intensity of peak value (530nm)
It marks on a map.
Specific embodiment
The disclosure be based on following opinion: by when detecting organism substance in conjunction with the organism substance and issue it is glimmering
On the protein of light, chemical photoprotein is merged in a manner of it can cause Resonance energy transfer, from without the use of for observing
Excitation light source, further, it is possible to use the measurement light of dual wavelength, can be easy to carry out quantifying for the organism substance.
The detection method of the disclosure includes in one or more embodiments: will make the albumen in combination with organism substance
The fusion protein (C) that matter (A) and chemiluminescence protein (B) are fused into is used as chemiluminescent indicator, is detected in sample
Organism substance.
[organism substance and sample]
The test object of detection method as the disclosure can enumerate the organism substance in organism sample.As organism
Sample, it is preferably liquid for the sample containing the organism substance for being originated from biology.As such organism sample, do not have
There is special limitation, can enumerate for example: the body fluid samples such as whole blood, serum, blood plasma and urine.In addition, the organism sample in the present invention
It can according to need and be diluted and/or pre-treatment etc..The detection method of the disclosure can of course be by above-mentioned " organism sample "
Sample in addition is set as measure object.The standard sample of the organism substance of such as test object can be enumerated, i.e. for measurement
Control sample.Can enumerate for example as organism substance for the substance for being incorporated into aftermentioned protein (A): biology is intracorporal low
Molecular compound, catabolite, nucleic acid, sugar, peptide, protein, cell or microorganism etc..
[in combination with the protein (A) of organism substance]
As " in combination with the protein (A) of organism substance " of the disclosure, in one or more embodiments, can enumerate:
The protein (A1) of capable of emitting fluorescence and the combinable life as autofluorescence molecule in the state of being combined with organism substance
The protein (A2) of object substance.
As the protein (A1) of fluorescence capable of emitting in the state of being combined with organism substance, implement in one or more
In mode, it can enumerate in apoprotein for unstressed configuration, when being combined as the organism substance of ligand and becoming holoprotein
Fluorescent protein.As one or more embodiments of the protein (A1), UnaG albumen can be enumerated.In addition,
The one or more embodiments of others as the protein (A1), can enumerate smURFP, IFP and iRFP.
UnaG albumen, which has, specifically to be combined with indirect bilirubin, is shone into using the exciting light of cyan green property
Matter (Kumagai et al., Cell 2013,153,1602-1611).UnaG and indirect bilirubin have high binding ability
(dissociation constant=98pM).The sequence information of UnaG be referred to UniProtKB/Swiss-Prot:P0DM59.1 or
GenBank:AB763906.1 (moment of in August, 2016).It, can be into if using UnaG albumen as the protein (A1)
The detection of row such as indirect bilirubin.
SmURFP is the abbreviation of small ultra red fluorescent protein (small exceedingly popular albumen), is and work
For hemoglobin metabolin biliverdin in conjunction with and the protein of the fluorescence that is displayed in red (Rodriguez et al.,
Nature Methods,2016,13,763-769)。
IFP is the abbreviation of infrared-fluorescent protein (IR fluorescence albumen), to show in conjunction with biliverdin
Show the protein (Shu X, et al., Science 2009,324 (5928), 804-8-7) of red fluorescence.
IRFP is the abbreviation of near-infrared fluorescent protein (near-infrared fluorescent albumen), is and biliverdin
In conjunction with and protein (Filonov GS, et al., Nat Biotech 2011,29 (8), the 757- of the fluorescence that are displayed in red
761)。
If using these smURFP, IFP or iRFP as the protein (A1), the inspection of such as biliverdin can be carried out
It surveys.
It can be UnaG albumen or the variant of smURFP, IFP or iRFP as the protein (A1).As UnaG
The variant of albumen or smURFP, IFP or iRFP can be able to maintain that when the bilirubin or biliverdin for being combined as ligand
And it makes a variation as missing, additional, displacement etc. occur in the range of holoprotein then fluorescent characteristic.Amino acid as variation
Quantity, be not particularly limited, in one or more embodiments, 1~4,1~3,1~2 or 1 can be enumerated, Huo Zheke
Enumerate display at least 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more,
The range of the amino acid sequence of 97% or more, 98% or more, 99% or more or 99.5% or more homology.As variation
Non-limiting example, can enumerate in fusion protein (C) with protein (B) merge part (C-terminal or N-terminal) lack
It loses.
Refer in combination with the protein (A2) of the organism substance as autofluorescence molecule by combining the autofluorescence
Molecule and fluorescent protein.As the autofluorescence molecule, flavin mononucleotide (FMN) can be enumerated.As can tie
Close autofluorescence molecule (FMN) protein (A2), in one or more embodiments, can enumerate FbFP, iLOV albumen and
Mini-SOG albumen.
FbFP is Flavin mononucleotide (FMN)-based fluorescent protein (flavine but nucleosides
Acidic group fluorescin) abbreviation, for fluorescin (Drepper T., the et al., Nat of the cyan receptor from bacterium
Biotech.2007,25(4)443-445)。
ILOV albumen is to change the light, oxygen or voltage-sensing that are originated from plant cyan receptor image assesment
The fluorescin of (LOV, light-oxygen-electroreception) structural domain and protein (Chapman S., et that fluorescent characteristic is improved
al.,PNAS 2008,105(50)20038-43)。
Mini-SOG albumen is the abbreviation of mini Singlet Oxygen Generator (mini singlet oxygen generator), is
Fluorescin (Shu X., et al., the PLoS Biol.2011,9 of image assesment 2 from arabidopsis (Arabidopsis)
(4))。
The protein (A2) can be had occurred in the range of in combination with the autofluorescence molecule missing, add,
Or the variant of the variations such as displacement.The quantity of amino acid as variation can enumerate above-mentioned range.
[chemiluminescence protein (B)]
Chemiluminescence protein (B) can use the fluorescence or autofluorescence of its luminous energy elicitor protein matter (A).Using this
It merges fusion protein (C) made of chemical photoprotein (B) and is used as detection reagent, therefore, according to the detection method of the disclosure,
The quantitative determination of organism substance can be carried out without using the excitation light source for observation.As chemiluminescence protein (B),
The donor that can become the Resonance energy transfer that can use the fluorescence that Resonance energy transfer excites the protein (A) can be enumerated
Photoprotein (luciferase).From that can determine that context of detection considers according to illuminant colour, the preferably described protein (A) shines
Color is different from the illuminant colour of the protein (B).
The known Resonance energy transfer is fluorescence resonance energy transfer (FRET) or bioluminescence resonance energy transfer
(BRET).The protein (B) can according to the absorbing wavelength of the protein (A1) or be incorporated into the protein (A2) from
The absorbing wavelength of body fluorescent molecule and select.As the protein (B), well known photoprotein, such as firefly can be enumerated
Luciferase, aequorin, bacterial luciferase and their variant.
In the case that the protein (A) is UnaG, as the protein (B), in one or more embodiments,
It can enumerate using coelenterazine compound as the luciferase of luminous substrate.As one or more embodiments of the luciferase,
NLuc can be enumerated.
The protein (B) can be the variant of well known luciferase.As the variant of luciferase, Ke Yi
It is able to maintain that and is made a variation by the way that missing, additional, displacement etc. occurs in the range of the luminous characteristic of combination fluorescein.As variation
The quantity of amino acid, is not particularly limited, and in one or more embodiments, can enumerate 1~4,1~3,1~2 or 1,
Or display at least 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% can be enumerated
Above, the range of the amino acid sequence of 97% or more, 98% or more, 99% or more or 99.5% or more homology.As change
Different non-limiting example, can enumerate in protein (C) with protein (A) merge part (C-terminal or N-terminal) lack
It loses.
[connector]
In the fusion protein (C), the protein (A) can be by connector with the protein (B) in conjunction with.The connector can
It is selected by such a way that the efficiency of the Resonance energy transfer from the protein (B) Xiang Suoshu protein (A) is raised.It is connect as this
The length of head can enumerate 1~10,1~5,2~4 or 2~3 amino acid residues in one or more embodiments.
The protein (A) be UnaG in the case where, as connector, in one or more embodiments, can enumerate GT,
DD, GTG or GTGG etc., in these connectors, from the aspect of luminous efficiency, preferably DD, GTG or GTGG, more preferable GTG.
The protein (A) in the fusion protein (C) does not limit especially with the sequence of the protein (B) merged
Fixed, the end N side can be the protein (A), or the protein (B).The fusion protein (C) is in one or more
It can be in N-terminal or C-terminal fusion tag albumen in embodiment.
Since the fusion protein (C) has above-mentioned composition, in the life of the substrate as the protein (A)
In the case that the fluorescein of object substance and the substrate as the protein (B) exists simultaneously, the protein (A) is shown
The amount of the tendency of illuminant colour, the organism substance of the substrate as the protein (A) is fewer, and the protein (B) shines
The tendency of color is stronger.Therefore, if detection/measurement of organism substance can be carried out using the fusion protein (C).
[detection method]
Therefore, the detection method of the disclosure be sample in organism substance detection method comprising:
Into the sample, mixing is fused into the protein (A) of combinable organism substance and chemiluminescence protein (B)
The substrate of fusion protein (C) and the chemiluminescence protein (B)；And
The luminous signal from the sample is observed,
The protein (A) is connect in a manner of it can carry out Resonance energy transfer with the protein (B),
The protein (A) is the protein (A1) of capable of emitting fluorescence or can in the state of being combined with the organism substance
It is combined as the protein (A2) of the organism substance of autofluorescence molecule,
The protein (B) can use the fluorescence or autofluorescence that its luminous energy excites the protein (A).
In the sample of object when the substrate of addition fusion protein (C) and protein (B), sample carries out luminous.With its hair
Optical signal is index, can differentiate the presence or absence of the organism substance for being incorporated into protein (A).Substantially, if the organism object
Matter exists, then illuminant colour becomes the illuminant colour of protein (A), if it is not present, becomes the illuminant colour of protein (B).
The detection method of the disclosure can carry out in one or more embodiments under room temperature or environment temperature.As
To the time of observation after the substrate of the fusion protein (C) and the protein (B) is mixed, implement in one or more
In mode ,~several minutes or so or several seconds~1 minute or so can be enumerated the several seconds.Described in the detection method of the disclosure
Above-mentioned fusion protein (C) can be used in fusion protein (C).
In addition, the detection method of disclosure illuminant colour of sample in one or more embodiments relies on the organism object
The concentration of matter and change.The concentration of the organism substance more improves, and the illuminant colour of sample gets over the luminous color change from protein (B)
For the illuminant colour of protein (A).I.e., it is possible to luminous strength ratio and life to protein (A) and protein (B) in luminous signal
The concentration of object substance establishes association.
Therefore, which can quantitatively be measured regardless of sample size by luminous signal according to the detection method of the disclosure
The concentration of substance.From the aspect of it can be quantitative determined, the molar concentration of the fusion protein (C) added into sample is preferred
In the concentration domain of Kd or so.
In one or more embodiments, the detection method of the disclosure may include quantitatively to be calculated by the luminous signal of sample
The process of the concentration of organism substance.
[indicator]
The disclosure is related to a kind of fusion protein (C) in other modes.
In addition, the chemiluminescent indicator that fusion protein (C) can be used as the organism substance uses.Therefore, the disclosure exists
A kind of chemiluminescent indicator involved in other modes, to contain the protein (A) and change made in combination with organism substance
Learn the chemiluminescent indicator for the fusion protein (C) that photoprotein (B) is fused into, wherein the protein (A) and the egg
White matter (B) is connected in a manner of it can carry out Resonance energy transfer, and the protein (A) is to be combined with the organism substance
The protein (A1) of capable of emitting fluorescence or the protein in combination with the organism substance as autofluorescence molecule under state
(A2), the protein (B) can use the fluorescence or autofluorescence that its luminous energy excites the protein (A).
In addition, the chemiluminescent indicator can use in the detection method of the disclosure, therefore, the disclosure is in others side
The chemiluminescent indicator used in a kind of detection method in the disclosure involved in formula, and application thereof.
The fusion protein (C) both can be the weight made using gene recombination technology in one or more embodiments
Histone matter, or the protein synthesized by chemical synthesis.As the recombinant protein using gene recombination technology
Production, in one or more embodiments, can enumerate using using containing encoding fusion protein (C) gene expression carry
Body conversion host and the method made or the method made in cell-free system.The fusion protein (C) can use label
Albumen etc. is purified.
[nucleic acid]
The disclosure is related to a kind of nucleic acid of fusion protein (C) disclosed in code book in a mode.In the disclosure, nucleic acid can be lifted
The transcription product of single-stranded or double-stranded DNA and these DNA in synthetic DNA, cDNA, genomic DNA and Plasmid DNA out.
[expression cassette]
Expression cassette of the disclosure one kind involved in a mode containing the nucleic acid of fusion protein (C) disclosed in code book.In the table
Up in box, in the nucleic acid, Expression modulation series of operations corresponding with the host cell of importing it is concatenated.It is adjusted as expression
Sequence is saved, promoter, enhancer, transcription terminator etc. can be enumerated, in addition, the montage letter of initiation codon, introne can be enumerated
Number and terminator codon etc..
[carrier]
Disclosure one kind involved in a mode can express the carrier of the fusion protein (C) of the disclosure.The disclosure is in others side
In formula, the carrier of the disclosure is the expression vector of nucleic acid or expression cassette with the disclosure in one or more embodiments.
The carrier of the disclosure can be selected suitably, using expression vector system corresponding with the cell to be expressed (host).As can be with
The carrier utilized in the carrier of the disclosure, as non-limiting one or more embodiments, can enumerate plasmid, sticking grain,
YACS, virus (such as adenovirus, retrovirus, episome EBV etc.) carrier and phage vector.
[transformant]
A kind of disclosure transformant for the fusion protein (C) for expressing the disclosure involved in a mode.The disclosure is at one or more
A kind of transformant of nucleic acid or carrier with the disclosure involved in a embodiment.The transformant of the disclosure is in one or more
It can be made by by the nucleic acid, expression cassette or vector introduction of the disclosure in host in embodiment.As host, can lift
Out: zooblast, plant cell, insect cell and microorganism etc..
[method of discrimination]
The concentration method of discrimination of organism substance of the disclosure in a kind of sample involved in other modes, it includes based on using
The luminous signal data that the detection method of the disclosure obtains differentiate the step of concentration of the organism substance in sample.
As described above, the luminous strength ratio of protein (A) and (B) in the luminous signal obtained with the detection method of the disclosure can
With the concentration dependent on the organism substance in sample.Therefore, can as detection used in fusion protein (C) information and hair
The concentration of optical signal differentiation organism substance.
The luminous signal data can be with color detectors such as the color cameras of mobile terminal (smart phone etc.) easily
It is taken into, receives transmission, therefore, can easily hold the concentration of organism substance.
The disclosure is further to non-limiting one or more embodiments below.
[1] a kind of detection method is the detection method of the organism substance in sample, it includes:
Into the sample, mixing is fused into the protein (A) of combinable organism substance and chemiluminescence protein (B)
The substrate of fusion protein (C) and the chemiluminescence protein (B)；And
The luminous signal from the sample is observed,
The protein (A) is connect in a manner of it can carry out Resonance energy transfer with the protein (B),
The protein (A) is the protein (A1) of capable of emitting fluorescence or can in the state of being combined with the organism substance
It is combined as the protein (A2) of the organism substance of autofluorescence molecule,
The protein (B) can use the fluorescence or autofluorescence that its luminous energy excites the protein (A).
[2] detection method according to [1], wherein the protein (A1) is that can send out in the state of being combined with bilirubin
The UnaG albumen or its variant of fluorescence out, the organism substance of test object are bilirubin.
[3] detection method according to [1], wherein the protein (A1) is that can send out in the state of being combined with biliverdin
Out fluorescence, IFP, iRFP, smURFP and their variant, the organism substance of test object is biliverdin.
[4] detection method according to any one of [1]~[3], wherein the protein (A2) is in combination with flavine monokaryon
Thuja acid, protein in the group being made of FbFP, iLOV albumen, mini-SOG albumen and their variant, detection
The organism substance of object is flavin mononucleotide.
[5] a kind of chemiluminescent indicator contains the protein (A) and chemiluminescence protein made in combination with organism substance
(B) fusion protein (C) being fused into, wherein
The protein (A) is connect in a manner of it can carry out Resonance energy transfer with the protein (B),
The protein (A) is the protein (A1) of capable of emitting fluorescence or can in the state of being combined with the organism substance
It is combined as the protein (A2) of the organism substance of autofluorescence molecule,
The protein (B) can use the fluorescence or autofluorescence that its luminous energy excites the protein (A).
[6] chemiluminescent indicator according to [5] is used for detection method described in any one of [1]~[4].
[7] a kind of carrier or transformant can express the fusion protein (C) of any one of [1]~[4] defined.
[8] the concentration method of discrimination of the organism substance in a kind of sample, it includes: based on described in any one of [1]~[4]
The obtained luminous signal data of detection method, differentiate the concentration of the organism substance in sample.
Hereinafter, illustrating the disclosure in further detail by embodiment, but these embodiments are embodiment illustrated, this public affairs
It opens and is not limited to these examples.
Embodiment
[embodiment 1]
1. fusion protein (chemiluminescent indicator) is gene constructed
Using being attached with BamHI restriction enzyme position in N-terminal, be attached with the primer below at KpnI restriction enzyme position in C-terminal
The end the C defect variant of wild type UnaG is expanded.
Forward primer:CGCGGATCCGGGTGGTTCTGGTATGG sequence number 1
Reverse primer0:(C Δ 0) GCTGGTACCTTCCGTCGCCCTCCG sequence number 2
Reverse primer1:(C Δ 1) GCTGGTACCCGTCGCCCTCCGGTA sequence number 3
Reverse primer2:(C Δ 2) GCTGGTACCCGCCCTCCGGTAGCT sequence number 4
Reverse primer3:(C Δ 3) GCTGGTACCCCTCCGGTAGCTGCG sequence number 5
Reverse primer4:(C Δ 4) GCTGGTACCCCGGTAGCTGCGCAC sequence number 6
Using being attached with KpnI restriction enzyme position in N-terminal, be attached with the below of EcoRI restriction enzyme position in C-terminal
Primer expands the N-terminal defect variant of wild type NLuc.
Forward primer 1:(N Δ 1) GCCGGTACCGTCTTCACACTCGAAGATTTCG sequence number 7
Forward primer 2:(N Δ 4) GCCGGTACCCTCGAAGATTTCGTTGGGGAC sequence number 8
Forward primer 3:(N Δ 5) GCCGGTACCGAAGATTTCGTTGGGGACTGGC sequence number 9
Reverse primer:ATGAATTCTTACGCCAGAATGCGTTCGCACAG sequence number 10
The DNA fragmentation expanded in polymerase chain reaction (PCR) is extracted using phenol chloroform method.The DNA fragmentation of UnaG
Restriction enzyme treatment is carried out using BamHI and KpnI.The DNA fragmentation of NLuc carries out restriction enzyme treatment with KpnI and EcoRI.Agarose
After gel electrophoresis, purified (QIAEX2, QIAGEN) after band being cut out from gel.By each segment of purifying and utilization
BamHI, EcoRI have carried out the pRSET of restriction enzyme treatmentBCarrier connection after converting JM109 (DE3) strain, is that 10cm is trained
It supports and cultivates a night at 37 DEG C on the LB agar medium of ware production.
2. screening
The agar medium that bacterium colony is grown is placed in room temperature, be added near being cooled to room temperature in 1% low melting-point agarose gel
Middle addition has the solution 4mL of 10 μM of ultimate density of bilirubin, is flowed on agar medium, solidifies at room temperature.Then, from
10 μM of coelenterazine-h solution are added on gel, is shot, is taken using the reflective camera at a glance (Sony α 7) for being set to camera bellows immediately
Obtain the color image of bacterium colony.Green channel (UnaG's shines) and blue channel (NLuc's shines) image making ratio by RGB image
Rate image picks up the high bacterium colony of rate value.Then, by the bacterium colony picked up on 96 orifice plates ,+10 μM of bilirubin of LB culture medium+
It is cultivated 60 hours at 23 DEG C in 100 μ g/mL ampicillins.10 μM of coelenterazine are added in culture solution, utilize
Sepectrophotofluorometer (FV7000) or microplate reader measure chemiluminescence spectra.With wavelength 450nm standardization, with wavelength 525nm
Relative value (rate value) based on screened.
Screen the protein for merging C-terminal defect variant UnaG and N-terminal defect variant NLuc in the site KpnI.
As a result, the combination (hereinafter referred to as " UnaG (C Δ 0)-NLuc (N Δ 1) fusion protein " of UnaG (C Δ 0) and NLuc (N Δ 1).)
Show maximum fluorescence resonance energy transfer (FRET) efficiency (Fig. 1).The alkali of UnaG (C Δ 0)-NLuc (the N Δ 1) fusion protein
Motif is classified as sequence number 11, and amino acid sequence is sequence number 12.
3. the optimization of the joint sequence of fusion protein
2 residues (GT) as the sequence of UnaG and the connector of NLuc are replaced into random sequence using inverse PCR method.It uses
Primer below.
Forward primer:NNKNNKGTCTTCACACTCGAAGATTTC sequence number 13
Reverse primer:TTCCGTCGCCCTCCGGTAGCTG sequence number 14
After the overall length amplification containing carrier sequence, template plasmid is handled and being handled with restriction enzyme DpnI,
After connection, JM109 (DE3) strain is converted, is to cultivate a night at 37 DEG C on the LB agar medium of 10cm culture dish production.With
The bacterium colony of the method screening expression described in above-mentioned 2.
4. the insertion of the joint sequence to fusion protein
After the sequence (GT) of the connector of UnaG and NLuc, joint sequence is inserted into using inverse PCR method.Use primer below.
Forward primer (G): GGCGTCTTCACACTCGAAGATTTC sequence number 15
Forward primer (GG): GGCGGCGTCTTCACACTCGAAGATTTC sequence number 16
Forward primer (GGS): GGCGGCAGCGTCTTCACACTCGAAGATTTC sequence number 17
Reverse primer:GGTACCTTCCGTCGCCCTC sequence number 18
By the overall length containing carrier sequence by after PCR amplification, and being handled with restriction enzyme DpnI by template plasmid into
Row processing after connection, converts JM109 (DE3) strain, is to cultivate at 37 DEG C on the LB agar medium of 10cm culture dish production
One night.With the bacterium colony of the method screening expression described in above-mentioned 2.
It is optimized by the joint sequence carried out using random variation insertion, compared with the joint sequence (GT) of wild type,
(DD) sequence shows the variation (Fig. 2) of big FRET efficiency.In turn, the chemiluminescence bilirubin that research is added with flexible coupling refers to
Show the FRET efficiency of agent, as a result, (GTG) sequence shows maximum FRET efficiency.
5. the purifying of protein
To be transformed into UnaG (C Δ 0)-NLuc (the N Δ 1) fusion protein in JM109 (DE3) strain 200mL LB culture medium+
It is cultivated 60 hours in 100 μ g/mL Carvenisillin solution, at 23 DEG C.After collecting bacterium, using Freund crush method by large intestine bar
Bacterium is broken, using using the affinity chromatograph method of Ni-NTA column (QIAGEN) to be purified.In turn, in order to remove excessive miaow
Azoles uses solvent resistant column (PD-10, GE HealthCare).Protein concentration is measured using Bradford method.
6. being freeze-dried the production of sample
The 500 μ L of UnaG (C Δ 0)-NLuc (N Δ 1) fusion protein of purifying is put into and is managed in 15mL falcon, is made using liquid nitrogen
It freezes.Thereafter, using freeze drying plant, the powder of protein solution is obtained.Powder saves at room temperature.
7. the measurement of titration curve
Relative to UnaG (C Δ 0)-NLuc (N Δ 1) fusion protein mixing 0.01nM, 0.05nM of ultimate density 5nM, 0.1nM,
5 μM of coelenterazine-h of bilirubin (BR) solution and ultimate density of 0.5nM, 1nM, 2.5nM, 5nM or 10nM, are divided using multichannel
Device (PMA-12, creek pine photoelectricity system) or microplate reader measure luminescent spectrum.Fig. 3 is illustrated in by the one of its result.Plotting 3 times independent
The average value of measurement is fitted using Xi Er formula.KdValue is 3.05nM.
In addition, keeping activity during what kind of degree after freeze-drying sample production to study, saving at room temperature
Water is dissolved in and the solution that is formed for sample is freeze-dried every a few days, utilizes the method measurement bilirubin described in above-mentioned 7
Compatibility.Its result is learnt: although compatibility slightly reduces, keep active (Fig. 4).
8. utilizing the measurement of smart phone
On 96 porous plates by the bilirubin solution of ultimate density 10nM, 20nM, 30nM, 40nM, 50nM, 100nM or 250nM and
5 μM of coelenterazine-h of ultimate density are mixed with the fusion protein of ultimate density 50nM, using being equipped on iPhone (registrar
Mark) 6 instrument (Manual-Custom exposure camera), measured using ISO1500, the time for exposure 0.5 second.
Color camera is carried out to the bilirubin solution of the fusion protein and various concentration made on porous plate
As a result, successfully measuring solution since bilirubin concentration is relied on is the situation (Fig. 5) of green from blue variation.Such as Fig. 5 institute
Show, is the illuminant colour (cyan) of chemiluminescence protein when bilirubin is 0nM.As bilirubin concentration increases, change as UnaG
Illuminant colour (green).When illustrating an example of the situation of the variation of color using RGB, illuminant colour be 0nM (56,133,204),
10nM(79,157,215)、20nM(96,169,209)、30nM(101,164,194)、40nM(119,179,189)、50nM
(123,169.156)、100nM(154,187,111)、250nM(158,191,107)。
If there is correlation as Fig. 5, then bilirubin concentration can be calculated by light-emitting data (illuminant colour).
[embodiment 2]
Relative to certain density bilirubin luminous substrate (coelenterazine-h) solution, by stoste, 2 times of dilutions, 4 times of dilutions or 8
Diluted UnaG (C Δ 0)-NLuc (N Δ 1) fusion protein solution is mixed again, utilizes multi-pass light splitter (PMA-12, creek
Loose photoelectricity system) measurement luminescent spectrum, by obtained luminous intensity calculate the emission wavelength (530nm) of UnaG luminous intensity and
The rate value (530nm/460nm) of the luminous intensity of the emission wavelength (460nm) of NLuc.Fig. 6 is illustrated in by the one of its result.Figure
In 6, the A of Fig. 6 is the coordinate diagram for indicating chemiluminescence spectra, and the B of Fig. 6 is to indicate that UnaG (C Δ 0)-NLuc (N Δ 1) merges egg
The coordinate diagram of the relationship of the dilution rate and rate value (530nm/460nm) of white solution (detection reagent).
[comparative example 1]
On 96 orifice plates (black) be added UnaG protein solution (8.25nM, 16.5nM, 31.5nM, 62.5nM, 125nM or
250nM) each 50 μ L is subsequently added into each 50 μ L of 400nM bilirubin solution.It is shone using micro- microplate reader (SH-9000, corona society system)
It penetrates after the exciting light of the wavelength of 450nm, obtains fluorescence spectrum.Fig. 7 is illustrated in by the one of its result.In Fig. 7, the A of Fig. 7 is table
Show the coordinate diagram of fluorescence spectrum, the B of Fig. 7 is the concentration for indicating UnaG protein solution (detection reagent) and the emission wavelength of UnaG
The coordinate diagram of the relationship of the fluorescence intensity of (530nm).
In comparative example 1, as shown in the A and B of Fig. 7, although the concentration of the bilirubin as test object is identical, glimmering
Luminous intensity changes because of the concentration of detection reagent.Determine that is, it can be said that comparative example 1 (using the method for having UnaG albumen) not can be carried out
The measurement of amount.
In contrast, in the embodiment 2 measured using UnaG (C Δ 0)-NLuc (N Δ 1) fusion protein, although strong light
Degree is different due to the concentration of detection reagent, and still, the waveform of spectrum is certain (A of such as Fig. 6), as shown in the B of Fig. 6, regardless of detection
The concentration of reagent, the peak ratio value (530nm/460nm) relative to identical bilirubin concentration are roughly the same.It therefore, can be with
Say, by using UnaG (C Δ 0)-NLuc (N Δ 1) fusion protein, can carry out the measurement unrelated with the concentration of detection reagent,
I.e. quantitative measurement.
Sequence number 1: forward primer
Sequence number 2: reverse primer
Sequence number 3: reverse primer
Sequence number 4: reverse primer
Sequence number 5: reverse primer
Sequence number 6: reverse primer
Sequence number 7: forward primer
Sequence number 8: forward primer
Sequence number 9: forward primer
Sequence number 10: reverse primer
The base sequence of sequence number 11:UnaG (C 0)-NLuc (N 1) fusion protein
The amino acid sequence of sequence number 12:UnaG (C 0)-NLuc (N 1) fusion protein
Sequence number 13: forward primer
Sequence number 14: reverse primer
Sequence number 15: forward primer
Sequence number 16: forward primer
Sequence number 17: forward primer
Sequence number 18: reverse primer
Sequence table
<110>National University Corporation Osaka University (Osaka University)
<120>detection method of organism substance, chemiluminescence refers to used in chemiluminescent indicator this method for it
Show agent
<130> H4531
<150> JP 2017-013463
<151> 2017-01-27
<160> 18
<170> PatentIn version 3.5
<210> 1
<211> 26
<212> DNA
<213>artificial sequence
<220>
<223>forward primer
<400> 1
cgcggatccg ggtggttctg gtatgg 26
<210> 2
<211> 24
<212> DNA
<213>artificial sequence
<220>
<223>reverse primer 0
<400> 2
gctggtacct tccgtcgccc tccg 24
<210> 3
<211> 24
<212> DNA
<213>artificial sequence
<220>
<223>reverse primer 1
<400> 3
gctggtaccc gtcgccctcc ggta 24
<210> 4
<211> 24
<212> DNA
<213>artificial sequence
<220>
<223>reverse primer 2
<400> 4
gctggtaccc gccctccggt agct 24
<210> 5
<211> 24
<212> DNA
<213>artificial sequence
<220>
<223>reverse primer 3
<400> 5
gctggtaccc ctccggtagc tgcg 24
<210> 6
<211> 24
<212> DNA
<213>artificial sequence
<220>
<223>reverse primer 4
<400> 6
gctggtaccc cggtagctgc gcac 24
<210> 7
<211> 31
<212> DNA
<213>artificial sequence
<220>
<223>forward primer 1
<400> 7
gccggtaccg tcttcacact cgaagatttc g 31
<210> 8
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>forward primer 2
<400> 8
gccggtaccc tcgaagattt cgttggggac 30
<210> 9
<211> 31
<212> DNA
<213>artificial sequence
<220>
<223>forward primer 3
<400> 9
gccggtaccg aagatttcgt tggggactgg c 31
<210> 10
<211> 32
<212> DNA
<213>artificial sequence
<220>
<223>reverse primer
<400> 10
atgaattctt acgccagaat gcgttcgcac ag 32
<210> 11
<211> 948
<212> DNA
<213>artificial sequence
<220>
<223> UnaG(C 0)-NLuc(N 1)
<400> 11
ggtggttctg gtatggtcga gaaatttgtt ggcacctgga agatcgcaga cagccataat 60
tttggtgaat acctgaaagc tatcggagcc ccaaaggaat taagcgatgg tggggatgcc 120
acgacgccga cattgtacat ctcccagaag gacggagaca aaatgacagt gaaaatagag 180
aatggacctc ctacgttcct tgacactcaa gtaaagttca aattagggga ggagttcgac 240
gaatttcctt ctgatcgaag aaaaggcgta aaatctgtcg tgaacttggt gggagagaag 300
ctggtgtacg tacaaaagtg ggacggcaag gagacgacgt atgtccgaga gataaaggac 360
ggtaaactgg tcgtgacact tacgatggga gacgtcgtgg ctgtgcgcag ctaccggagg 420
gcgacggaag gtaccgtctt cacactcgaa gatttcgttg gggactggcg acagacagcc 480
ggctacaacc tggaccaagt ccttgaacag ggaggtgtgt ccagtttgtt tcagaatctc 540
ggggtgtccg taactccgat ccaaaggatt gtcctgagcg gtgaaaatgg gctgaagatc 600
gacatccatg tcatcatccc gtatgaaggt ctgagcggcg accaaatggg ccagatcgaa 660
aaaattttta aggtggtgta ccctgtggat gatcatcact ttaaggtgat cctgcactat 720
ggcacactgg taatcgacgg ggttacgccg aacatgatcg actatttcgg acggccgtat 780
gaaggcatcg ccgtgttcga cggcaaaaag atcactgtaa cagggaccct gtggaacggc 840
aacaaaatta tcgacgagcg cctgatcaac cccgacggct ccctgctgtt ccgagtaacc 900
atcaacggag tgaccggctg gcggctgtgc gaacgcattc tggcgtaa 948
<210> 12
<211> 313
<212> PRT
<213>artificial sequence
<220>
<223> UnaG(C 0)-NLuc(N 1)
<400> 12
Gly Gly Ser Gly Met Val Glu Lys Phe Val Gly Thr Trp Lys Ile Ala
1 5 10 15
Asp Ser His Asn Phe Gly Glu Tyr Leu Lys Ala Ile Gly Ala Pro Lys
20 25 30
Glu Leu Ser Asp Gly Gly Asp Ala Thr Thr Pro Thr Leu Tyr Ile Ser
35 40 45
Gln Lys Asp Gly Asp Lys Met Thr Val Lys Ile Glu Asn Gly Pro Pro
50 55 60
Thr Phe Leu Asp Thr Gln Val Lys Phe Lys Leu Gly Glu Glu Phe Asp
65 70 75 80
Glu Phe Pro Ser Asp Arg Arg Lys Gly Val Lys Ser Val Val Asn Leu
85 90 95
Val Gly Glu Lys Tyr Val Gln Lys Trp Asp Gly Lys Glu Thr Thr Tyr
100 105 110
Val Arg Glu Ile Lys Asp Gly Lys Leu Val Val Thr Leu Thr Met Gly
115 120 125
Asp Val Val Ala Val Arg Ser Tyr Arg Arg Ala Thr Glu Gly Thr Val
130 135 140
Phe Thr Leu Glu Asp Phe Val Gly Asp Trp Arg Gln Thr Ala Gly Tyr
145 150 155 160
Asn Leu Asp Gln Val Leu Glu Gln Gly Gly Val Ser Ser Leu Phe Gln
165 170 175
Asn Leu Gly Val Ser Val Thr Pro Ile Gln Arg Ile Val Leu Ser Gly
180 185 190
Glu Asn Gly Leu Lys Ile Asp Ile His Val Ile Ile Pro Tyr Glu Gly
195 200 205
Leu Ser Gly Asp Gln Met Gly Gln Ile Glu Lys Ile Phe Lys Val Val
210 215 220
Tyr Pro Val Asp Asp His His Phe Lys Val Ile Leu His Tyr Gly Thr
225 230 235 240
Leu Val Ile Asp Gly Val Thr Pro Asn Met Ile Asp Tyr Phe Gly Arg
245 250 255
Pro Tyr Glu Gly Ile Ala Val Phe Asp Gly Lys Lys Ile Thr Val Thr
260 265 270
Gly Thr Leu Trp Asn Gly Asn Lys Ile Ile Asp Glu Arg Leu Ile Asn
275 280 285
Pro Asp Gly Ser Leu Leu Phe Arg Val Thr Ile Asn Gly Val Thr Gly
290 295 300
Trp Arg Leu Cys Glu Arg Ile Leu Ala
305 310
<210> 13
<211> 27
<212> DNA
<213>artificial sequence
<220>
<223>forward primer
<220>
<221> misc_feature
<222> (1)..(2)
<223>n is a, c, g or t
<220>
<221> misc_feature
<222> (3)..(3)
<223>k is g or t
<220>
<221> misc_feature
<222> (4)..(5)
<223>n is a, c, g or t
<220>
<221> misc_feature
<222> (6)..(6)
<223>k is g or t
<400> 13
nnknnkgtct tcacactcga agatttc 27
<210> 14
<211> 22
<212> DNA
<213>artificial sequence
<220>
<223>reverse primer
<400> 14
ttccgtcgcc ctccggtagc tg 22
<210> 15
<211> 24
<212> DNA
<213>artificial sequence
<220>
<223>forward primer
<400> 15
ggcgtcttca cactcgaaga tttc 24
<210> 16
<211> 27
<212> DNA
<213>artificial sequence
<220>
<223>forward primer
<400> 16
ggcggcgtct tcacactcga agatttc 27
<210> 17
<211> 30
<212> DNA
<213>artificial sequence
<220>
<223>forward primer
<400> 17
ggcggcagcg tcttcacact cgaagatttc 30
<210> 18
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>reverse primer
<400> 18
ggtaccttcc gtcgccctc 19
Claims (8)
1. a kind of detection method is the detection method of the organism substance in sample, it includes:
The substrate of fusion protein (C) and chemiluminescence protein (B) is mixed into the sample, the fusion protein (C) is to make
The fusion protein (C) being fused into combination with the protein (A) and chemiluminescence protein (B) of organism substance；And
The luminous signal from the sample is observed,
The protein (A) is connect in a manner of it can carry out Resonance energy transfer with the protein (B),
The protein (A) is the protein (A1) of capable of emitting fluorescence or can in the state of being combined with the organism substance
It is combined as the protein (A2) of the organism substance of autofluorescence molecule,
The protein (B) can use the fluorescence or autofluorescence that its luminous energy excites the protein (A).
2. detection method according to claim 1, wherein
The protein (A1) is the UnaG albumen or its variant of capable of emitting fluorescence in the state of being combined with bilirubin,
The organism substance of test object is bilirubin.
3. detection method according to claim 1, wherein
The protein (A1) be in the state of being combined with biliverdin capable of emitting fluorescence, selected from by IFP, iRFP, smURFP,
And the protein in the group of their variant composition,
The organism substance of test object is biliverdin.
4. detection method according to claim 1, wherein
The protein (A2) be in combination with flavin mononucleotide, selected from by FbFP, iLOV albumen, mini-SOG albumen and
The protein in group that their variant is constituted,
The organism substance of test object is flavin mononucleotide.
5. a kind of chemiluminescent indicator, containing fusion protein (C), the fusion protein (C) is to make in combination with organism object
The fusion protein (C) that the protein (A) and chemiluminescence protein (B) of matter are fused into, wherein
The protein (A) is connect in a manner of it can carry out Resonance energy transfer with the protein (B),
The protein (A) is the protein (A1) of capable of emitting fluorescence or can in the state of being combined with the organism substance
It is combined as the protein (A2) of the organism substance of autofluorescence molecule,
The protein (B) can use the fluorescence or autofluorescence that its luminous energy excites the protein (A).
6. chemiluminescent indicator according to claim 5, wherein the chemiluminescent indicator is used for claim 1
Detection method described in any one of~4.
7. a kind of carrier or transformant can express the fusion protein (C) of any one of Claims 1 to 4 defined.
8. a kind of concentration method of discrimination of the organism substance in sample, it includes: it is based on any one of Claims 1 to 4
The luminous signal data that the detection method obtains differentiate the concentration of the organism substance in sample.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2017013463 | 2017-01-27 | ||
| JP2017-013463 | 2017-01-27 | ||
| PCT/JP2018/002587 WO2018139614A1 (en) | 2017-01-27 | 2018-01-26 | Method of detecting biological material, and chemiluminescent indicator used therein |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110226087A true CN110226087A (en) | 2019-09-10 |
Family
ID=62979615
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201880008839.6A Pending CN110226087A (en) | 2017-01-27 | 2018-01-26 | Chemiluminescent indicator used in the detection method of organism substance, this method |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US11372007B2 (en) |
| EP (1) | EP3575779A4 (en) |
| JP (1) | JP7014437B2 (en) |
| CN (1) | CN110226087A (en) |
| WO (1) | WO2018139614A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113219033A (en) * | 2021-04-30 | 2021-08-06 | 福州大学 | Correction-free quantitative measurement method of electrochemical aptamer sensor |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP7137842B2 (en) * | 2017-02-03 | 2022-09-15 | 国立大学法人大阪大学 | Device and judgment system using it |
| JP2020076673A (en) * | 2018-11-08 | 2020-05-21 | 国立大学法人埼玉大学 | Fluorescent probe and rapid fluorescence measuring method using probe |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002068459A2 (en) | 2001-02-21 | 2002-09-06 | Clontech Laboratories, Inc. | Non aggregating fluorescent proteins and methods for using the same |
| WO2004020980A2 (en) * | 2002-08-27 | 2004-03-11 | University Of Georgia Research Foundation, Inc. | Assays for the detection of biliverdin in birds and reptiles |
| AU2013204332B2 (en) | 2012-04-16 | 2015-07-16 | Commonwealth Scientific And Industrial Research Organisation | Methods and systems for detecting an analyte or classifying a sample |
| JP6751294B2 (en) | 2012-12-12 | 2020-09-02 | プロメガ コーポレイションＰｒｏｍｅｇａ Ｃｏｒｐｏｒａｔｉｏｎ | Recognition of cell target binding by bioactive agents using intracellular bioluminescence resonance energy transfer |
| WO2014133158A1 (en) * | 2013-02-28 | 2014-09-04 | 独立行政法人理化学研究所 | Novel polypeptide exhibiting fluorescent properties and use thereof |
| WO2015007317A1 (en) | 2013-07-18 | 2015-01-22 | Ecole polytechnique fédérale de Lausanne (EPFL) | Means and methods for bioluminescence resonance energy transfer (bret) analysis in a biological sample |
| JP6707472B2 (en) * | 2014-07-04 | 2020-06-10 | パリ サイエンス エ レトレ‐カルチエ ラティン | Tag that activates and shifts fluorophores (FAST) |
| EP3279333B1 (en) | 2015-03-30 | 2019-09-18 | National University Corporation Kobe University | Measurement method for unbound bilirubin in blood sample |
| US10501502B2 (en) * | 2016-11-22 | 2019-12-10 | The Regents Of The University Of California | Allophycocyanin alpha-subunit evolved labeling proteins (smURFPs) |
-
2018
- 2018-01-26 JP JP2018564671A patent/JP7014437B2/en active Active
- 2018-01-26 WO PCT/JP2018/002587 patent/WO2018139614A1/en unknown
- 2018-01-26 CN CN201880008839.6A patent/CN110226087A/en active Pending
- 2018-01-26 EP EP18744560.6A patent/EP3575779A4/en not_active Withdrawn
- 2018-01-26 US US16/481,167 patent/US11372007B2/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113219033A (en) * | 2021-04-30 | 2021-08-06 | 福州大学 | Correction-free quantitative measurement method of electrochemical aptamer sensor |
Also Published As
| Publication number | Publication date |
|---|---|
| US20190353671A1 (en) | 2019-11-21 |
| JPWO2018139614A1 (en) | 2019-12-19 |
| EP3575779A1 (en) | 2019-12-04 |
| EP3575779A4 (en) | 2019-12-04 |
| US11372007B2 (en) | 2022-06-28 |
| JP7014437B2 (en) | 2022-02-01 |
| WO2018139614A1 (en) | 2018-08-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9945860B2 (en) | Nicotinamide adenine dinucleotide indicators, methods of preparation and application thereof | |
| Shao et al. | A Covalent Reporter of β‐Lactamase Activity for Fluorescent Imaging and Rapid Screening of Antibiotic‐Resistant Bacteria | |
| CN110226087A (en) | Chemiluminescent indicator used in the detection method of organism substance, this method | |
| CN111164426B (en) | Carbohydrate sensor | |
| JP5570803B2 (en) | Fluorescent protein and pH measurement method | |
| EP2141230B1 (en) | Fluorescent labeled fused protein for assaying adenosine triphosphate | |
| Oliveira Paiva et al. | Practical observations on the use of fluorescent reporter systems in Clostridioides difficile | |
| EP3578978B1 (en) | Device and determination system using same | |
| EP3622292B1 (en) | Genetically encoded potassium ion indicators | |
| Van Genechten et al. | Fluorescent toys ‘n’tools lighting the way in fungal research | |
| JP2011212008A (en) | FLUORESCENT PROTEIN AND METHOD FOR MEASURING pH | |
| US8852882B2 (en) | Biosensors and their use | |
| Delgado-Galván et al. | Red fluorescent protein (DsRFP) optimization for Entamoeba histolytica expression | |
| Dippel | Development of bioluminescent sensors for interrogating cyclic di-nucleotide signaling | |
| Oliveira Paiva et al. | Practical observations on the use of fluorescent reporter systems in C. difficile | |
| Oliveira Paiva | New tools and insights in physiology and chromosome dynamics of Clostridioides | |
| CN117106097A (en) | RNA-protein complex and application thereof | |
| Paiva et al. | Shedding light on Clostridioides difficile: practical observations on the use of fluorescent reporter systems | |
| TWI412589B (en) | Mutant blue fluorescent protein and method of using the same for fluorescence resonance energy transfer and blue fluorescent fish | |
| JP2014018191A (en) | Luciferase derived from pyrocoelia matsumurai | |
| WO2013087922A1 (en) | Methods for producing engineered fluorescent proteins for enhanced fret, products and uses thereof | |
| KR20080021018A (en) | Isolated aqdecay photoprotein and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190910 |
|
| WD01 | Invention patent application deemed withdrawn after publication |