JP2011212008A - FLUORESCENT PROTEIN AND METHOD FOR MEASURING pH - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a fluorescent protein with a wavelength of maximum fluorescent emission which changes depending on pH and in specific pH ranges, and a method by which cell functions are measured with high accuracy using the fluorescent protein.SOLUTION: The fluorescent protein is derived from an organism belonging to Phylum Cnidaria, Class Anthozoa, Order Pennatulacea, Family Veretillidae and has a wavelength of maximum fluorescent emission which changes depending on pH. The change occurs in range between pH 4 and pH 11. Moreover, a method for measuring pH in cells using the fluorescent protein is presented.

Description

  The present invention relates to a mutant of a fluorescent protein obtained by gene cloning from an organism belonging to the family Cnidaria phylumenidae, and from the sea cactus, and to a method for measuring cell function using the same.

  A green fluorescent protein GFP (Green Fluorescent Protein) derived from Aequorea victoria has been found, and the green fluorescent protein can be imaged by expressing the gene in eukaryotes such as prokaryotes such as E. coli and nematodes. It was. In addition, by fusing GFP with other proteins, it is possible to image changes in intracellular localization and expression level. Furthermore, in vivo imaging can be monitored non-invasively by expressing GFP in tissue of an animal individual. Because of these properties, GFP is used not only for general cell research, but also for applied research such as basic cancer research and therapeutic effect monitoring.

  GFP derived from Aequorea jellyfish is a 27 kD protein consisting of 238 amino acids that forms a chromophore and emits fluorescence. Wild-type GFP (wtGFP) is a protein having an excitation maximum wavelength at 395 nm in ultraviolet light (minor peak at 470 nm) and emitting green fluorescence at 509 nm. The chromophore is formed by the 64th to 69th sequence (particularly the 65th to 67th sequence) in the amino acid sequence.

  In addition, various GFP protein variants have been produced. For example, the S65T mutant in which the 65th serine in the amino acid sequence is substituted with threonine has an excitation maximum wavelength shifted to 490 nm and a longer wavelength side, and emits fluorescence several times stronger than wtGFP. Moreover, the mutant in which the 205th threonine is substituted with an aromatic amino acid can be used as a yellow fluorescent protein because the fluorescence wavelength shifts to the longer wavelength side. Furthermore, the mutant in which the 66th tyrosine is substituted with an aromatic amino acid can be used as a blue fluorescent protein because the fluorescence wavelength shifts to the short wavelength side. Since then, various GFP proteins have been modified, and so far, many mutants with brighter fluorescence, protein stability, and a device for improving solubility have been prepared.

  Clontech's EGFP (Enhanced Green Fluorescent Protein) is optimized for human codon usage in order to increase translation efficiency in mammalian cells and plants in addition to chromophore amino acid substitution (P64L, S65T, etc.) More than 190 mutations have been introduced in the base sequence. In addition, fluorescent color variants EBFP (Blue) (Y66H amino acid substitution, etc.), ECFP (Cyan) (Y66W amino acid substitution, etc.) and EYFP (Yellow) (T203Y amino acid substitution, etc.) In addition to optimization of the combined base sequence, it is available from the company as a mutant that can be observed with a fluorescent color different from that of EGFP.

  Non-Patent Document 1 introduces a mutation in Aequorea GFP (mutation that replaces the 65th serine with threonine, the 48th cysteine with serine, the 148th histidine with cysteine, and the 203rd threonine with cysteine). Thus, it is disclosed that a mutant whose fluorescence wavelength changes depending on pH is obtained. In the mutant, the tendency of the absorption spectrum changes around pH 7, and the absorption near 400 nm increases on the acidic side, and the absorption near 500 nm increases on the alkaline side. Depending on the change in the absorption spectrum, the fluorescence intensity near 460 nm increases on the acidic side from pH 7, and the fluorescence intensity near 510 nm increases on the alkaline side. Non-Patent Document 1 shows the usefulness of this property as an intracellular sensor.

Green Fluorescent Protein Variants as Rationmetric Dual Emission pH Sensors. 1. Structural Characterization and Preliminary Application. Hanson GT., McAnaney TB., Park ES., Rendell MEP., Yarbrough DK., Chu S., Xi L., Boxer SG. , Montrose MH., And Remington SJ. Biochemistry 2002, 41, 15477-15488.

  An object of the present invention is a fluorescent protein whose fluorescence maximum wavelength changes in a pH-dependent manner, the fluorescent protein in which the change occurs at a specific pH, and a highly accurate measurement method of cell function using the fluorescent protein There is to do.

  According to an embodiment of the present invention, it is a fluorescent protein derived from an organism belonging to the cnidarian genus Coleoptera Umellaidae, and whose fluorescence maximum wavelength changes in a pH-dependent manner, the change being pH 4 and pH 11 Fluorescent proteins occurring between are provided.

  In addition, a method for introducing such a fluorescent protein into a subject and measuring the pH inside the subject based on the fluorescence emitted from the fluorescent protein is provided.

  According to the present invention, a fluorescent protein having a fluorescence maximum wavelength that changes in a pH-dependent manner, wherein the change occurs between pH 4 and pH 11, an organism belonging to the family Cnidaria phytoseiidae, Camiaceae (for example, cactus) ) -Derived fluorescent protein, and a method for measuring pH with high accuracy in cells and intracellular organelles using such a fluorescent protein.

  By using this fluorescent protein, it is possible to measure two-wavelength excitation two-wavelength fluorescence or one-wavelength excitation two-wavelength fluorescence, and it is possible to measure a change in pH as a relative fluorescence intensity ratio. Therefore, the absolute difference in fluorescence intensity under different experimental conditions can be canceled and various data can be compared with each other.

Fluorescence spectrum of S147A mutant at each pH when excited at 388 nm (horizontal axis: wavelength (nm), vertical axis: fluorescence intensity (arbitrary unit)). Fluorescence spectrum of S147A mutant at each pH when excited at 450 nm (horizontal axis: wavelength (nm), vertical axis: fluorescence intensity (arbitrary unit)). Absorption spectrum of S147A mutant at each pH (horizontal axis: wavelength (nm), vertical axis: absorbance (arbitrary unit)). The figure which compared the association state of wild type cactus fluorescent protein and C154S mutant by SDS-PAGE. The figure which shows the fluorescence when wild type cactus fluorescent protein, C154S mutant, and two temperature stabilization mutants were expressed in E. coli. The analysis result by the gel filtration method of the association state of wild type cactus fluorescent protein and a temperature stabilization mutant. The figure which shows the comparison regarding the pH dependence of wild type cactus fluorescent protein and a S147A mutant. Bright field image of U2OS cells expressing wild type cactus fluorescent protein (a), fluorescent image at pH = 7 (b) and fluorescent image at pH = 4 (c), and fluorescence spectra of b and c (d) . The fluorescence image which shows the state by which the colon_bacillus | E._coli which expressed wild type cactus fluorescent protein is phagocytosed by a RAW cell. The table | surface which shows the fluorescence spectrum and fluorescence intensity ratio of the wild type cactus fluorescent protein before and behind being phagocytosed by a RAW cell. Fluorescence spectrum of S147T mutant at each pH when excited at 388 nm (horizontal axis: wavelength (nm), vertical axis: fluorescence intensity (arbitrary unit)). Fluorescence spectrum of S147T mutant at each pH when excited at 450 nm (horizontal axis: wavelength (nm), vertical axis: fluorescence intensity (arbitrary unit)). Absorption spectrum of S147T mutant at each pH (horizontal axis: wavelength (nm), vertical axis: absorbance (arbitrary unit)). The figure which shows the comparison regarding the pH dependence of a wild type cactus fluorescent protein and S147T mutant. Fluorescence spectrum of S147G mutant at each pH when excited at 388 nm (horizontal axis: wavelength (nm), vertical axis: fluorescence intensity (arbitrary unit)). The fluorescence spectrum of the S147G mutant at each pH when excited at 450 nm (horizontal axis: wavelength (nm), vertical axis: fluorescence intensity (arbitrary unit)). Absorption spectrum of S147G mutant at each pH (horizontal axis: wavelength (nm), vertical axis: absorbance (arbitrary unit)). The figure which shows the comparison regarding the pH dependence of wild type cactus fluorescent protein and a S147G mutant. Fluorescence spectrum of S147C mutant at each pH when excited at 388 nm (horizontal axis: wavelength (nm), vertical axis: fluorescence intensity (arbitrary unit)). Fluorescence spectrum of S147C mutant at each pH when excited at 450 nm (horizontal axis: wavelength (nm), vertical axis: fluorescence intensity (arbitrary unit)). Absorption spectrum of S147C variant at each pH (horizontal axis: wavelength (nm), vertical axis: absorbance (arbitrary unit)). The figure which shows the comparison regarding the pH dependence of wild type cactus fluorescent protein and S147C mutant.

<Fluorescent protein>
The present invention relates to a fluorescent protein having a fluorescence maximum wavelength that changes in a pH-dependent manner and is generated between an organism belonging to the family Cnidaria genus Coleoptera, and from which the change occurs between pH 4 and pH 11. It relates to protein.

  The fluorescent maximum wavelength of the fluorescent protein of the present invention changes depending on pH. In particular, this change occurs between pH 4 and pH 11. That is, for example, the maximum wavelength of fluorescence emitted when placed in an environment near pH 3 is different from the maximum wavelength of fluorescence emitted when placed in an environment near pH 12, for example, and can be distinguished from each other. In other words, when the fluorescent property of the fluorescent protein of the present invention is referred to as the “change point”, the point at which the fluorescence maximum wavelength changes is referred to as “fluorescence” in an environment with a pH greater than the change point, and the pH lower than the change point. Even in such an environment, it is possible to emit fluorescence having a wavelength different from that of the fluorescence. For this reason, the fluorescent protein of the present invention can be used as an indicator of pH in the environment. In particular, when the change point is on the alkaline side, the fluorescent protein of the present invention can be used mainly for measurement of pH change on the alkaline side.

  The change point is present between pH 4 and pH 11, as described above, preferably between pH 5 and pH 11, between pH 5 and pH 10, or between pH 6 and pH 10. More preferably, the point of change exists between pH 9 and pH 10, and further between pH 9.1 and pH 9.9, between pH 9.2 and pH 9.8, pH 9.3 and pH 9.7. Or between pH 9.4 and pH 9.6, or the point of change is preferably pH 9.5. The change point exists in the vicinity of pH 6, for example, between pH 5.5 and pH 6.5, between pH 5.6 and pH 6.4, between pH 5.7 and pH 6.3, and between pH 5.8 and pH 6.2. Or between pH 5.9 and pH 6.1. The change point exists between pH 7 and pH 8, and further between pH 7.1 and pH 7.9, between pH 7.2 and pH 7.8, and between pH 7.3 and pH 7.7. Or it exists between pH 7.4 and pH 7.6, or the change point is preferably pH 7.5. The change point exists near pH 9, for example, between pH 8.5 and pH 9.5, between pH 8.6 and pH 9.4, between pH 8.7 and pH 9.3, and between pH 8.8 and pH 9.2. Or between pH 8.9 and pH 9.1.

  The fluorescent protein of the present invention emits blue fluorescence at a pH lower than the pH at which the change occurs, and emits green fluorescence at a pH higher than the pH at which the change occurs.

  The fluorescent protein of the present invention is derived from an organism belonging to the family Clematozoa phytoseiidae, Uridaeidae. For example, it is derived from Cavernularia obesa (Japanese name: Cypridina) belonging to the family Clematozoa phytoseiidae. Therefore, even if it is an organism that has not yet been classified or has not yet been discovered, it is later considered to belong to the cnidarian genus Coleoptera Umiellaceae, and the fluorescent protein obtained therefrom is a fluorescent protein as described above. Any activity can be included in the present invention. As used herein, “derived from” means that in addition to a wild-type fluorescent protein possessed by an organism belonging to the family Cleoptera: Hymenoptera Umiellae, the mutant is also included.

<S147A mutation>
A preferred example of the fluorescent protein of the present invention is a fluorescent protein comprising the amino acid sequence represented by SEQ ID NO: 1. This fluorescent protein is obtained by adding a mutation for substituting a plurality of amino acids to a wild-type sea cactus fluorescent protein expressed by Caberularia obesa. Specifically, with respect to the wild-type fluorescent protein having the amino acid sequence shown in SEQ ID NO: 3, in addition to the mutation in which the change point is shifted to the alkaline side (that is, the 147th serine is replaced with alanine), Mutation to form (ie, 154th cysteine is replaced with serine) and stabilization at 37 ° C. (ie, 129th serine is glycine, 156th aspartic acid is glycine, 204th lysine is isoleucine) And 209th asparagine is substituted with tyrosine). In the present application, the fluorescent protein comprising the amino acid sequence represented by SEQ ID NO: 1 is referred to as “S147A mutant fluorescent protein”, “S147A mutant blue cactus fluorescent protein”, “S147A mutant” or the like.

  1 and 2 show the fluorescence spectra of the S147A mutant. FIG. 1 shows a fluorescence spectrum when irradiated with excitation light of 388 nm at each stage of pH 4 to 11. On the other hand, FIG. 2 shows the fluorescence spectrum when irradiated with excitation light of 450 nm at each stage from pH 8 to 11. From FIG. 1, it can be seen that when excitation light of 388 nm is irradiated, fluorescence having a fluorescence maximum wavelength near 462 nm is emitted at any measured pH. However, when the pH is different, the fluorescence intensity is also greatly different. As the pH is lowered from 11, the intensity of light at 462 nm increases, reaches a maximum at pH 5, and decreases at pH 4. Further, FIG. 2 shows that when the excitation light of 450 nm is irradiated, the fluorescence having the maximum fluorescence wavelength near 509 nm is emitted at any measured pH. However, the change in fluorescence intensity due to the difference in pH is large, and the fluorescence intensity at pH 10 and 11 is greatly increased as compared with the fluorescence intensity at pH 8 and 9. In addition, although only the measurement result in pH 8-11 is shown in the fluorescence spectrum of 450 nm excitation by FIG. 2, since fluorescence was hardly detected in the measurement in pH 4-7, the display is abbreviate | omitted.

  FIG. 3 shows the absorption spectra of the S147A mutant at each stage from pH 4 to 11. In an environment of pH 4 to 7, the fluorescent protein has a high absorption peak near 392 nm, but hardly has a peak near 502 nm. At pH 8 and 9, it has a high absorption peak in the vicinity of 392 nm, and further has a slightly high absorption peak in the vicinity of 502 nm. Under the environment of pH 10 and 11, it has a lower absorption peak at around 392 nm than at other pH, but has a high absorption peak at around 502 nm. From the results of FIGS. 1 to 3, it can be seen that the fluorescence at the 462 nm peak is emitted mainly by the excitation light at the 392 nm peak. On the other hand, the fluorescence having the 509 nm peak is emitted by the excitation light having the 502 nm peak, but is also emitted by the excitation light having the 392 nm peak.

  Further, FIG. 7 shows a comparison between the S147A mutant and the wild-type cactus fluorescent protein with respect to the pH-dependent change in fluorescence wavelength. Eight types of solutions containing fluorescent proteins were prepared for each fluorescent protein. The pH of these eight solutions is adjusted to be different between 4-11. These were arranged and irradiated with excitation light of 365 nm, and the resulting fluorescence was photographed. FIG. 7 shows the captured image in monochrome. In the figure, the wild type cactus fluorescent protein is shown as Wild CoGFP (upper), and the S147A mutant is shown as S147A Mutant (lower). According to the image obtained in color, in the wild type, the solution emits blue light at pH 4, green light at pH 6 and higher, and intermediate light at pH 5. That is, in the wild type, the fluorescence maximum wavelength changes around pH 5. On the other hand, the S147A mutant emits blue light at pH 9 and lower pH, and emits green light at pH 10 and 11. That is, in the S147A mutant, the fluorescence maximum wavelength changes between pH 9 and pH 10.

<S147T mutation>
A preferred example of the fluorescent protein of the present invention is a fluorescent protein comprising the amino acid sequence represented by SEQ ID NO: 42. This fluorescent protein is obtained by adding a mutation for substituting a plurality of amino acids to a wild-type sea cactus fluorescent protein expressed by Caberularia obesa. Specifically, the wild-type fluorescent protein having the amino acid sequence shown in SEQ ID NO: 3 has a mutation in which the change point is shifted to the alkaline side (that is, the 147th serine is replaced with threonine). Mutation to form (ie, 154th cysteine is replaced with serine) and stabilization at 37 ° C. (ie, 129th serine is glycine, 156th aspartic acid is glycine, 204th lysine is isoleucine) And 209th asparagine is substituted with tyrosine). In the present application, the fluorescent protein containing the amino acid sequence represented by SEQ ID NO: 42 is referred to as “S147T mutant fluorescent protein”, “S147T mutant cactus fluorescent protein”, “S147T mutant”, or the like.

  Figures 11a and 11b show the fluorescence spectra of the S147T mutant. FIG. 11a shows fluorescence spectra when irradiated with excitation light of 388 nm at each stage from pH 4 to 11. FIG. On the other hand, FIG. 11b shows the fluorescence spectrum when irradiated with excitation light of 450 nm at each stage from pH 4 to 11. From FIG. 11a, when the excitation light of 388 nm was irradiated, a spectrum composed of a peak near 460 nm and a peak near 507 nm was obtained at each pH. However, from pH 4 to pH 7, the peak around 460 nm showed stronger fluorescence intensity, and from pH 8 to pH 11 the peak around 507 nm showed stronger fluorescence intensity. Moreover, according to FIG. 11b, when the excitation light of 450 nm was irradiated, a main peak was obtained in the vicinity of 507 nm at any measured pH. However, the change in fluorescence intensity due to the difference in pH was large, and the fluorescence intensity decreased as the pH decreased.

  FIG. 11 c shows the absorption spectrum of the S147T mutant at each stage from pH 4 to 11. At pH 4 to 7, two main peaks were obtained around 389 nm and 499 nm. In particular, at pH 4 and 5, the peak near 389 nm has a larger absorption than the peak near 499 nm, the absorption at those peaks is about the same at pH 6, and the absorption at the peak near 499 nm is larger at pH 7. Furthermore, from pH 8 to pH 11, the absorption peak near 389 nm almost disappeared, and a large absorption was observed near 499 nm. From the results of FIGS. 11a to 11c, it can be seen that the fluorescence at the 460 nm peak is emitted mainly by the excitation light having the peak near 389 nm. On the other hand, it can be seen that the fluorescence having a peak at 507 nm is emitted mainly by excitation light having a peak near 499 nm, but is also emitted by excitation light having a peak near 389 nm.

  Furthermore, FIG. 12 shows a comparison between the S147T mutant and the wild-type cactus fluorescent protein with respect to the pH-dependent change in fluorescence wavelength. Eight types of solutions containing fluorescent proteins were prepared for each fluorescent protein. The pH of these eight solutions is adjusted to be different between 4-11. These were arranged and irradiated with excitation light of 365 nm, and the resulting fluorescence was photographed. FIG. 12 shows the captured image in monochrome. In the figure, the wild type cactus fluorescent protein is indicated as Wild CoGFP (upper), and the S147T mutant is indicated as S147T Mutant (lower). According to the image obtained in color, in the wild type, the solution emits blue light at pH 4, green light at pH 6 and higher, and intermediate light at pH 5. That is, in the wild type, the fluorescence maximum wavelength changes around pH 5. On the other hand, the S147T mutant emits blue light at pH 4 and 5, emits green light at pH 7 or higher, and emits intermediate light near pH 6. That is, in the S147T mutant, the fluorescence maximum wavelength changes around pH 6.

<S147G mutation>
A preferred example of the fluorescent protein of the present invention is a fluorescent protein comprising the amino acid sequence represented by SEQ ID NO: 46. This fluorescent protein is obtained by adding a mutation for substituting a plurality of amino acids to a wild-type sea cactus fluorescent protein expressed by Caberularia obesa. Specifically, with respect to the wild-type fluorescent protein having the amino acid sequence shown in SEQ ID NO: 3, in addition to the mutation in which the change point is shifted to the alkaline side (that is, the 147th serine is replaced with glycine), Mutation to form (ie, 154th cysteine is replaced with serine) and stabilization at 37 ° C. (ie, 129th serine is glycine, 156th aspartic acid is glycine, 204th lysine is isoleucine) And 209th asparagine is substituted with tyrosine). In the present application, the fluorescent protein comprising the amino acid sequence represented by SEQ ID NO: 46 is referred to as “S147G mutant fluorescent protein”, “S147G mutant cactus fluorescent protein”, “S147G mutant” or the like.

  Figures 13a and 13b show the fluorescence spectra of the S147G mutant. FIG. 13a shows the fluorescence spectrum when irradiated with excitation light of 388 nm at each stage from pH 4 to 11. FIG. On the other hand, FIG. 13 b shows the fluorescence spectrum when irradiated with excitation light of 450 nm at each stage from pH 4 to 11. From FIG. 13a, it can be seen that when 388 nm excitation light is irradiated, pH 4 to pH 9 has a high peak mainly in the vicinity of 460 nm. On the other hand, at pH 10 and 11, although there is a peak near 460 nm, a slightly higher peak is seen near 506 nm. However, the fluorescence intensity at pH 10 and 11 is generally small compared with other pH values. According to FIG. 13 b, it can be seen that when the excitation light of 450 nm is irradiated, it has a main peak around 506 nm at pH 5 to 11. However, the change in fluorescence intensity due to the difference in pH is large, high intensity is shown at pH 10 and 11, and the fluorescence intensity decreases as the pH decreases.

  FIG. 13 c shows the absorption spectrum of the S147G mutant at each stage from pH 4 to 11. In an environment of pH 4 to 6, the fluorescent protein has a high absorption peak around 394 nm, but has almost no peak around 495 nm. pH 7 to 9 have absorption peaks near both 394 nm and 495 nm, but as pH increases, the peak near 394 nm decreases and the peak near 495 nm increases. At pH 10 and 11, the peak around 394 nm has almost disappeared and has a large peak around 495 nm. From the results of FIGS. 13a to 13c, it can be seen that the fluorescence at the peak near 460 nm is emitted mainly by the excitation light at the peak near 394 nm. On the other hand, it can be seen that the peak fluorescence near 506 nm is emitted by the excitation light having a peak near 495 nm, but is also emitted by the excitation light having a peak near 394 nm.

  Further, FIG. 14 shows a comparison between the S147G mutant and the wild-type cactus fluorescent protein with respect to the pH-dependent change in fluorescence wavelength. Eight types of solutions containing fluorescent proteins were prepared for each fluorescent protein. The pH of these eight solutions is adjusted to be different between 4-11. These were arranged and irradiated with excitation light of 365 nm, and the resulting fluorescence was photographed. FIG. 14 shows the captured image in monochrome. In the figure, the wild type cactus fluorescent protein is indicated as Wild CoGFP (upper), and the S147G mutant is indicated as S147G Mutant (lower). According to the image obtained in color, in the wild type, the solution emits blue light at pH 4, green light at pH 6 and higher, and intermediate light at pH 5. That is, in the wild type, the fluorescence maximum wavelength changes around pH 5. On the other hand, the S147G mutant emits blue light at pH 7 or lower and emits green light at pH 8 or higher. That is, in the S147G mutant, the fluorescence maximum wavelength changes between pH 7 and pH 8.

<S147C mutation>
A preferred example of the fluorescent protein of the present invention is a fluorescent protein comprising the amino acid sequence represented by SEQ ID NO: 50. This fluorescent protein is obtained by adding a mutation for substituting a plurality of amino acids to a wild-type sea cactus fluorescent protein expressed by Caberularia obesa. Specifically, with respect to the wild-type fluorescent protein having the amino acid sequence shown in SEQ ID NO: 3, in addition to the mutation in which the change point is shifted to the alkaline side (that is, the 147th serine is replaced with cysteine), Mutation to form (ie, 154th cysteine is replaced with serine) and stabilization at 37 ° C. (ie, 129th serine is glycine, 156th aspartic acid is glycine, 204th lysine is isoleucine) And 209th asparagine is substituted with tyrosine). In the present application, the fluorescent protein comprising the amino acid sequence represented by SEQ ID NO: 50 is referred to as “S147C mutant fluorescent protein”, “S147C mutant blue cactus fluorescent protein” or “S147C mutant”.

  Figures 15a and b show the fluorescence spectra of the S147C mutant. FIG. 15a shows the fluorescence spectrum when irradiated with excitation light of 388 nm at each stage from pH 4 to 11. FIG. On the other hand, FIG. 15b shows a fluorescence spectrum when irradiated with excitation light of 450 nm at each stage of pH 4 to 11. From FIG. 15a, it can be seen that when excitation light of 388 nm is irradiated, fluorescence having a fluorescence maximum wavelength near 460 nm is emitted at any measured pH. In particular, it can be seen that a large fluorescence intensity is exhibited at pH 4 to pH 9. Further, according to FIG. 15b, it can be seen that when excitation light of 450 nm is irradiated, fluorescence having a maximum fluorescence wavelength in the vicinity of 512 nm at pH 8 to 11 is emitted. However, the change in the fluorescence intensity due to the difference in pH is large, showing the highest fluorescence intensity at pH 11, and it can be seen that the fluorescence intensity decreases as the pH decreases.

  FIG. 15c shows the absorption spectrum of the S147C mutant at each stage from pH 4 to 11. In an environment of pH 4 to 7, the fluorescent protein has a high absorption peak around 396 nm, but has almost no peak around 505 nm. At pH 8 and 9, there are absorption peaks both near 396 nm and near 505 nm. Under the conditions of pH 10 and 11, most of the peak near 396 nm disappears and has a high absorption peak near 505 nm. From the results of FIGS. 15a to 15c, it can be seen that the fluorescence at the peak near 460 nm is emitted mainly by the excitation light at the 396 nm peak. On the other hand, it can be seen that the fluorescence at the peak near 512 nm is emitted mainly by the excitation light at the 505 nm peak.

  Further, FIG. 16 shows a comparison between the S147C mutant and the wild-type cactus fluorescent protein with respect to the pH-dependent change in fluorescence wavelength. Eight types of solutions containing fluorescent proteins were prepared for each fluorescent protein. The pH of these eight solutions is adjusted to be different between 4-11. These were arranged and irradiated with excitation light of 365 nm, and the resulting fluorescence was photographed. FIG. 16 shows the captured image in monochrome. In the figure, the wild type cactus fluorescent protein is indicated as Wild CoGFP (upper), and the S147C mutant is indicated as S147C Mutant (lower). According to the image obtained in color, in the wild type, the solution emits blue light at pH 4, green light at pH 6 and higher, and intermediate light at pH 5. That is, in the wild type, the fluorescence maximum wavelength changes around pH 5. On the other hand, the S147C mutant emits blue light at pH 8 or lower, emits green light at pH 10 and 11, and shows a slightly greenish blue color at pH 9. That is, in the S147C mutant, the fluorescence maximum wavelength changes near pH 9.

<Other mutations>
The fluorescent protein of the present invention may be a mutant of a wild type cactus fluorescent protein. The S147A mutant, S147T mutant, S147G mutant, and S147C mutant are each one of such mutants. The mutant according to the present invention is a fluorescent protein whose fluorescence maximum wavelength changes in a pH-dependent manner, as long as it maintains the characteristic that the change occurs on the alkaline side, particularly between pH 4 and pH 11, It may be a mutant. Various mutations may be introduced simultaneously into one protein or gene. Here, the mutant refers to a fluorescent protein in which a mutation (for example, amino acid substitution, deletion and / or addition, etc.) has occurred in the amino acid sequence of the wild-type fluorescent protein. This mutation is a mutation of one or more amino acids in the amino acid sequence of the wild-type fluorescent protein, preferably a mutation of 1 to 20 amino acids in the amino acid sequence of the wild-type fluorescent protein, a mutation of 1 to 15 amino acids, From 1 to 10 amino acid mutations or from 1 to 5 amino acid mutations. Preferably, the amino acid sequence of the mutant is 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more with respect to the amino acid sequence of the wild-type fluorescent protein, It has 98% or more or 99% or more homology.

  Moreover, the fluorescent protein of the present invention includes a mutant in which characteristics other than the bimodal fluorescent activity are changed as described above. In particular, such a mutation is preferably a mutation that improves operability as a fluorescent protein.

  For example, the fluorescent protein according to the present invention includes mutants that can emit fluorescence having higher intensity than the wild type. This mutant can provide sufficient fluorescence intensity even when a measurement system with low sensitivity is used or when measurement is performed on cells with weak protein expression. Such a mutant can be obtained by using a conventional method in the art. For example, after a mutation is randomly introduced into a nucleic acid encoding a wild-type fluorescent protein, it is expressed in Escherichia coli or the like. It can be obtained by irradiating excitation light and selecting a strain that emits fluorescence stronger than a strain that expresses wild-type fluorescent protein.

  In addition, the fluorescent protein according to the present invention includes variants that can exist as monomers in cells. When the fluorescent protein forms a dimer, aggregation may occur in the cell or movement within the cell may be inhibited. Such a problem can be avoided by monomerization. In particular, when another protein is fused to the fluorescent protein, the influence on the original function of the other protein can be minimized. Such a monomerized mutant is introduced into the original fluorescent protein gene at random, and then monomerized and fluorescently active from a library containing such candidate mutants. It can be obtained by screening what has not been lost. Alternatively, it can be obtained by mutating an amino acid that is likely to contribute to dimer formation of a fluorescent protein, and then confirming that it has been monomerized and has not lost its fluorescent activity. The S147A mutant, the S147T mutant, the S147G mutant, and the S147C mutant each contain this mutation (the 154th cysteine is replaced with serine).

  In addition, the fluorescent protein according to the present invention includes mutants having high stability under specific conditions. Such proteins include, for example, mutants with high formation efficiency of fluorescent chromophores at a temperature suitable for culturing cells to be measured. Since wild-type fluorescent proteins are derived from the family Cactaceae, the fluorescent proteins are likely to be most stable in the living environment of the organism. When conditions such as temperature in the living environment are significantly different from experimental conditions, the stability of the fluorescent protein may be impaired. Therefore, obtaining a highly stable fluorescent protein mutant, particularly under the conditions used in the experiment, is advantageous in performing highly accurate measurement. Such mutants are obtained by randomly mutating the original fluorescent protein gene, expressing them in E. coli, etc., and selecting mutants that exhibit the desired stability under specific conditions. it can. A more specific example of such a mutant is a mutant having a higher fluorescence intensity than a wild-type fluorescent protein at a temperature suitable for culturing mammalian cells (for example, around 37 ° C.). The S147A mutant, S147T mutant, S147G mutant, and S147C mutant each contain a mutation that stabilizes at 37 ° C. (ie, the 129th serine is glycine, the 156th aspartic acid is glycine, the 204th mutant is Lysine is replaced by isoleucine and 209th asparagine is replaced by tyrosine).

<Nucleic acid>
The present invention relates to a nucleic acid comprising a base sequence encoding the fluorescent protein according to the present invention. Such a base sequence may be a base sequence derived from an organism belonging to the family Cnidaria genus Coleoptera Umiellae. “Derived” as used herein means to include a base sequence in which a mutation has occurred in a wild-type base sequence originally possessed by an organism belonging to the genus Coleoptera Uridae. The mutation herein refers to substitution, deletion and / or addition of a specific base in the base sequence. The nucleotide sequence mutation includes a mutation that does not cause a change in the encoded amino acid sequence. The nucleic acid particularly refers to DNA or RNA.

  Preferred examples of the nucleic acid of the present invention include a nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 2 (encoding S147A variant), a nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 43 (coding S147T variant), SEQ ID NO: 47 Or a nucleic acid containing the base sequence shown in SEQ ID NO: 51 (encoding S147C variant).

  The present invention also includes vectors containing these nucleic acids. The vector may contain, in addition to a nucleic acid encoding a fluorescent protein, a nucleic acid containing a sequence for regulating expression or a marker gene sequence.

<PH measurement method>
The present invention relates to a method for introducing the fluorescent protein according to the present invention into a target and measuring the pH inside the target based on the fluorescence emitted by the fluorescent protein.

  That is, in the method of the present invention, after the fluorescent protein is introduced into the target, the fluorescence emitted from the fluorescent protein is detected by irradiating the excitation light, and the pH is specified based on the wavelength of the fluorescence.

  Here, the subject may be a cell such as a bacterial cell, yeast cell, fungal cell, insect cell or mammalian cell. Furthermore, the subject may be a tissue or an individual. The cells may be fixed or alive. Fixing can be performed by a general method using formalin, methanol or the like. Moreover, the individual as a target may be an individual other than a human. Furthermore, the subject may be a solution commonly used in biological experiments. There are no particular limitations on the target cells, tissues, and individuals, and those obtained by conventional acquisition methods can be used.

  Any method common in the art for introducing proteins into cells or the like may be used to introduce fluorescent proteins into a subject. For example, when the object is a cell, the fluorescent protein may be directly injected into the cell by a microinjection method. Alternatively, it may be introduced by introducing an expression vector containing a fluorescent protein gene into a cell and appropriately expressing it. For introduction of a gene by an expression vector or the like, a calcium phosphate method, lipofection, electroporation or the like can be used. When the target is a solution, the fluorescent protein in the solution may be introduced by adding the fluorescent protein to the solution.

  Fluorescence detection can be done visually, but can be done using conventional methods or devices that can measure fluorescence at specific wavelengths. As shown in FIG. 7, it is possible to determine whether the pH is higher or lower than the pH change point by visually observing whether to emit blue fluorescence or green fluorescence by irradiating excitation light. However, it is possible to specify the pH in more detail by using the detection device regardless of visual observation. For example, it is performed by observing a cell into which a fluorescent protein has been introduced under a fluorescent microscope. As an example of such a method, the detection of fluorescence is carried out in an inverted fluorescence microscope equipped with a fluorescence cube with a filter set corresponding to 388 nm excitation-462 nm fluorescence and 498 nm excitation-509 nm fluorescence, and the fluorescence of samples at 462 nm and 509 nm peaks. Images are taken with a CCD camera. The pH can be obtained by quantifying the fluorescence intensity of the pH measurement target area in the captured image. At this time, it is also possible to acquire a fluorescent image temporally by stimulating the cells under various conditions and then capturing images at regular intervals. Furthermore, the measurement of fluorescence can measure not only wavelengths near 462 nm and 509 nm, but also fluorescence spectra. In this case, specifically, the measurement can be performed by connecting an optical fiber to the camera port of the microscope and measuring the fluorescence spectrum of the measurement target region with a spectrophotometer.

  In addition, the pH can be calculated based on a calibration curve created from the values of the fluorescence intensity at 462 nm and 509 nm for each pH and the ratio value thereof. For the calibration curve, measure the fluorescence intensity at 462 nm and the fluorescence intensity at 509 nm in advance for each pH, determine the ratio of the fluorescence intensity for each pH, and plot it on a graph with the horizontal axis representing pH and the vertical axis representing the ratio. Can be created. Thereafter, the fluorescence intensity at 462 nm and 509 nm can be measured in the subject to be measured, and the ratio can be applied to the calibration curve to identify the pH in the subject. In general, when the fluorescence activity of a fluorescent protein is measured in an independent experimental system, the value of the detected fluorescence intensity may vary even if the measurement conditions are the same as much as possible. For example, the absolute value of the detected fluorescence intensity varies depending on the state of the excitation light source used. Further, the background may rise or fall depending on the state of the cell to be measured and the state of the culture solution. In such a case, it is not appropriate to directly compare the fluorescence intensity values obtained from these experimental systems. On the other hand, if two fluorescence intensities are acquired in a single experimental system and the ratio is obtained, fluctuations in the value of the fluorescence intensity can be canceled, and the ratio obtained under the same conditions is It is considered to be almost constant between experimental systems. In addition, it is not necessary to create a calibration curve for each measurement, and it is possible to compare results obtained from independent experiments.

  The method of the present invention is not limited to the case where a fluorescent protein is introduced into a subject alone, but also includes a method of introducing a fusion protein comprising a fluorescent protein and a protein different from the fluorescent protein into the subject. For example, when the “different protein” is a protein that is originally expressed in the target cell, the fusion protein of the present invention may also be localized at a site in the cell where the protein is originally localized. is expected. In this state, by detecting the fluorescence of the fluorescent protein, it is possible to measure the pH of the specific site corresponding to the “different protein”. “Different proteins” can be selected according to the site to be measured and the purpose of the experiment. For example, a mitochondrial translocation signal (coxIV) or a Golgi translocation signal (GT) can be used.

  In the pH measurement method of the present invention, the fluorescent protein can be excited by irradiating two excitation lights having different wavelengths. Although the pH measurement method of the present invention includes measuring two fluorescences having different wavelengths, two excitation lights having different wavelengths corresponding to the two fluorescences can be used. For example, when using the S147A mutant, excitation light around 388 nm and around 450 nm can be used to generate fluorescence around 462 nm and around 509 nm (FIGS. 1 and 2). In the pH measurement method of the present invention, the fluorescent protein can be excited by irradiating with excitation light having a single wavelength. For example, when using the S147A mutant, excitation light around 388 nm can be used to generate fluorescence around 462 nm and 509 nm. By using a single excitation light, it is possible to simplify the apparatus for measurement.

  The pH measurement method of the present invention can be performed using a plurality of different fluorescent proteins of the present invention. By using a plurality of different fluorescent proteins, the pH can be measured more accurately. Moreover, the pH measurement method of the present invention can be performed not only on a single target (for example, one type of cell) but also on various types of targets (for example, two or more types of cells) at the same time. Preferably, the pH measurement method of the present invention comprises the group consisting of S147A mutant (SEQ ID NO: 1), S147T mutant (SEQ ID NO: 42), S147G mutant (SEQ ID NO: 46) and S147C mutant (SEQ ID NO: 50). Performed on single or multiple subjects using a combination of at least two fluorescent proteins selected.

[Example 1: Cloning of wild type cactus fluorescent protein gene]
After extracting and purifying wild-type fluorescent protein from sea cactus (Cavernularia obesa) and reading its partial amino acid sequence, the fluorescent protein gene was cloned by determining the gene sequence based on the sequence.

Extraction and Purification of Fluorescent Protein and Amino Acid Sequence Analysis Fifteen cactus (approximately 200 g) collected in the Shimane sea were ground in 500 ml of SDS-glycine buffer to extract a soluble protein containing a protein having fluorescence activity. The residue was removed using a centrifuge, and a solution containing a protein having fluorescence activity was extracted. Ammonium sulfate was added to this extracted solution so as to have a final concentration of 80%, and ammonium sulfate precipitation was performed. Specifically, 262 g of ammonium sulfate was added to 500 ml of the extraction solution. The obtained precipitate was redissolved in 50 ml of Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl). To this was added twice the amount of ethanol to precipitate the protein again. Further, Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl) was added to the precipitate and redissolved. 50 ml of this solution was dialyzed using a sufficient amount of Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl) and a dialysis membrane 27/32 (Sanko Junyaku Co., Ltd.). The solution after dialysis was purified by ion exchange separation using a chromatography system AKTAexplorer (GE Healthcare Bioscience) equipped with a DEAE Sepharose CL-6B column (GE Healthcare Bioscience). In this ion exchange, after sufficiently equilibrating with a low salt concentration Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl), a sample is added and a high salt concentration Tris buffer (20 mM Tris-HCl (pH 7. 0) and 1M NaCl) to increase the NaCl concentration to 0.4M. As a result, fractions having fluorescence activity were collected. Selection of the fraction containing the protein with fluorescence activity was performed using UV / BLUE CONVERTER PLATE (UVP). The obtained fraction was dialyzed using a sufficient amount of Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl) and a dialysis membrane 27/32 (Sanko Junyaku Co., Ltd.). The solution after dialysis was concentrated using ultrafiltration Amicon Ultra: molecular weight cut off 30 kDa (Nippon Millipore Corporation). Next, gel filtration was performed using Sephacryl S-200 High Resolution (GE Healthcare Bioscience) and Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl). After gel filtration, the obtained fluorescently active fraction was subjected to ion exchange separation with monoQ 5/50 (GE Healthcare Bioscience). In this ion exchange, after sufficiently equilibrating with a low salt concentration Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl), a sample is added and a high salt concentration Tris buffer (20 mM Tris-HCl (pH 7. 0) and 1M NaCl) to increase the NaCl concentration to 0.4M. As a result, a fluorescently active fraction was obtained. This active fraction was concentrated using ultrafiltration Amicon Ultra: molecular weight cut off 30 kDa (Nippon Millipore Corporation), and then Superdex 75 10/300 GL (GE Healthcare Bioscience) and Tris buffer (20 mM Tris- Gel filtration separation was performed using HCl (pH 7.0), 20 mM NaCl) to obtain a fraction having fluorescence activity. The sample was separated by SDS-polyacrylamide gel electrophoresis and analyzed for amino acid sequence. As a result of the analysis, an amino acid sequence of 22 residues (IPD YFV QSF PEG FTF ERT LSF E: SEQ ID NO: 11) could be determined.

Cloning of fluorescent protein gene For cloning of the full length fluorescent protein gene, 3'-RACE PCR was performed as follows. A mixed primer for cloning a fluorescent protein gene was prepared by the Rapid Amplification of cDNA End method (hereinafter abbreviated as RACE). Of the amino acid sequences IPD YFV QSF PEG FTF ERT LSF E (SEQ ID NO: 11) obtained by amino acid sequence analysis, attention was paid to the amino acid regions of IPDYFV and EGFTFER with few codon base combinations. Base sequences encoding these amino acid regions were predicted, and fluorescent protein-specific mixed primers (12 types in total) used for 3′-end RACE polymer chain chain reaction (hereinafter abbreviated as PCR) were prepared as follows. As primers that bind to the IPDYFV amino acid region, COGFP-TTT (5′-ATH CCN GAT TAT TTT GT-3 ′) (SEQ ID NO: 12), COGFP-TTC (5′-ATH CCN GAT TAT TTC GT-3 ′) ( SEQ ID NO: 13), COGFP-TCT (5′-ATH CCN GAT TAC TTT GT-3 ′) (SEQ ID NO: 14), COGFP-TCC (5′-ATH CCN GAT TAC TTC GT-3 ′) (SEQ ID NO: 15) COGFP-CTT (5′-ATH CCN GAC TAT TTT GT-3 ′) (SEQ ID NO: 16), COGFP-CTC (5′-ATH CCN GAC TAT TTC GT-3 ′) (SEQ ID NO: 17), COGFP-CCT (5′-ATH CCN GAC TAC TTT GT-3 ′) (SEQ ID NO: 18) and CO GFP-CCC (5′-ATH CCN GAC TAC TTC GT-3 ′) (SEQ ID NO: 19) was prepared, and COGFP-ATTAA (5′-GAA GGN TTT ACN TTT GAA was used as a primer that binds to the EGFTFER amino acid region. AG-3 ′) (SEQ ID NO: 20), COGFP-ACCAA (5′-GAA GGN TTC ACN TTC GAA AG-3 ′) (SEQ ID NO: 21), COGFP-ATTGA (5′-GAG GGN TTT ACN TTT GAG AG- 3 ′) (SEQ ID NO: 22) and COGFP-ACCGA (5′-GAG GGN TTC ACN TTC GAG AG-3 ′) (SEQ ID NO: 23). H and N in the primer indicate mixed bases.

  Twelve specific mixed primers and 3 ′ end-specific primers were prepared by predicting from the amino acid sequence of a fluorescent protein using a full-length cDNA library prepared using GeneRacer (Invitrogen) as a template and using the full-length cDNA synthesis reagent GeneRacer (Invitrogen) as a template. GeneRacer 3 ′ Primer (5′-GCT GTC AAC GAT ACG CTA CGT AAC G-3 ′) (SEQ ID NO: 24) and GeneRacer 3 ′ Nested Primer (5′-CGC TAC GTA ACG GCA TGA CAG-3 sequence) 25) was used to perform 3′-RACE PCR. GeneRacer 3 'Primer and GeneRacer 3' Nested Primer are included in the full-length cDNA synthesis reagent GeneRacer kit (Invitrogen) and used. In order to effectively amplify the fluorescent protein gene by 3'-RACE PCR, a nested PCR was carried out in which the gene amplified once by PCR was used as a template and the gene was amplified more specifically by the inner primer pair. PCR was performed according to the manual using polymerase Ex-Taq (Takara Bio Inc.).

The first PCR was performed using any of the eight types of primers (COGFP-TTT, COGFP-TTC, COGFP-TCT, COGFP-TCT, COGFP-CTT, COGFP-CTC, COGFP-CCT, COGFP-CCC) prepared in the IPDYFV amino acid region. The fluorescent protein gene was amplified with a total of 8 primer pairs of KA and GeneRacer 3 ′ Primer. 10 × Ex Taq Buffer (added with 20 mM Mg ²⁺ ) at the same final concentration, dNTP Mixture (2.5 mM each) at a final concentration of 0.2 mM, TaKaRa Ex Taq (5 U / μl) at a final concentration of 0.05 U / μl, A 20 μl PCR reaction solution was prepared with one of the 8 primers at a final concentration of 0.4 μM and a GeneRacer 3 ′ Primer at a final concentration of 0.4 μM, and 0.2 μl of the cactus full-length cDNA library solution was added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, a cycle of 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 2 minutes is performed 30 times, and finally an extension reaction at 72 ° C. for 5 minutes. Went. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% Tris acetate buffer (hereinafter abbreviated as TAE) agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation. Since gene amplification was slightly observed in the eight reaction solutions, a nested PCR reaction was performed using this PCR reaction solution as a template.

Nested PCR is the amplification of the fluorescent protein gene with four primer pairs of GeneRacer3'Nested Primer and any of the four types of primers (COGFP-ATTAA, COGFP-ACCAA, COGFP-ATTGA, COGFP-ACCGA) created in the EGFERFER amino acid region. Went. 10 × Ex Taq Buffer (added with 20 mM Mg ²⁺ ) at the same final concentration, dNTP Mixture (2.5 mM each) at a final concentration of 0.2 mM, TaKaRa Ex Taq (5 U / μl) at a final concentration of 0.05 U / μl, Make 10 μl of nested PCR reaction solution with 0.4 μM final concentration of one of the four primers and 0.4 μM final concentration of GeneRacer 3 ′ Nested Primer, and 0.2 μl using the first PCR reaction solution as a template. added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, a cycle of 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 2 minutes is performed 30 times, and finally an extension reaction at 72 ° C. for 5 minutes. Went. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation.

  As a result, as a first PCR reaction, a primer pair of COGFP-TTC and GeneRacer 3 ′ Primer was used, and as a nested PCR reaction, the obtained PCR reaction solution was used as a template for COGFP-ACCAA and GeneRacer 3 ′ Nested Primer. When this primer pair was used, remarkable gene amplification could be confirmed. The base sequence of this amplified gene was determined and used as the base sequence (SEQ ID NO: 26) on the 3′-end side of the sea cactus fluorescent protein gene.

  5'-RACE for 5 'end cloning of fluorescent proteins was performed as follows. Primers used for 5'-RACE for 5 'terminal cloning were prepared based on the 3' terminal nucleotide sequence of the cactus fluorescent protein gene obtained by a series of 3'-RACE analyses. The prepared primers for 5 ′ terminal cloning were COGFP-A-R1 (5′-GCT ATA GCC GTC TCA TGT TGC TCG T-3 ′) (SEQ ID NO: 27), COGFP-A-R2 (5′-AGC CGT). CTC ATG TTG CTC GTA GTA G-3 ′) (SEQ ID NO: 28) and COGFP-A-R3 (5′-ATG TTG CTC GTA GTA GTT GCC TTC CTC GAC-3 ′) (SEQ ID NO: 29) . COGFP-A-R1, COGFP-A-R2, and COGFP-A-R3 bind in the order close to the 5 'end, and are sequentially used as primers for the nested PCR reaction.

  GeneRacer 5 'Primer (5'-CGA CTG GAG), which is a 5'-end specific primer and 5'-end specific primer, using a full-length cDNA library prepared by using full-length cDNA synthesis reagent GeneRacer as a template 5'-RACE PCR using CAC GAG GAC ACT GA-3 ') (SEQ ID NO: 30) and GeneRacer 5' Nested Primer (5'-GGA CAC TGA CAT GGA CTG AAG GAG TA-3 ') (SEQ ID NO: 31) Went. GeneRacer 5 'Primer and GeneRacer 5' Nested Primer are included in the full-length cDNA synthesis reagent GeneRacer kit (Invitrogen) and used. In order to effectively amplify the fluorescent protein gene by 5'-RACE PCR, a nested PCR was performed in which the gene amplified once by PCR was used as a template and the gene was amplified more specifically by the inner primer pair. PCR was performed according to the manual using polymerase Ex-Taq.

As the first 5′-RACE PCR, a fluorescent protein gene was amplified using a primer pair of COGFP-A-R1 and GeneRacer 5 ′ Primer prepared based on the base sequence of the gene amplified by 3′-RACE. . 10 × Ex Taq Buffer (20 mM Mg ²⁺ added) is the same final concentration, dNTP Mixture (each 2.5 mM) is 0.2 mM final concentration, and TaKaRa Ex Taq (5 U / μl) is final concentration 0.05 U / μl. 10 μl of PCR reaction solution was prepared with COGFP-A-R1 at a final concentration of 0.4 μM, GeneRacer 5 ′ Primer at a final concentration of 0.4 μM, and 0.2 μl of a cactus full-length cDNA library solution was added. . As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, 30 cycles of 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 2 minutes are performed, and finally extension at 72 ° C. for 5 minutes is performed. Reaction was performed. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation. Since gene amplification was slightly observed in this 5′-RACE, a nested PCR reaction was performed using this PCR reaction solution as a template.

As a nested PCR, a fluorescent protein GFP gene was amplified using a primer pair of COGFP-A-R2 and GeneRacer 5 ′ Nested Primer. 10 × Ex Taq Buffer (20 mM Mg ²⁺ added) is the same final concentration, dNTP Mixture (each 2.5 mM) is 0.2 mM final concentration, and TaKaRa Ex Taq (5 U / μl) is final concentration 0.05 U / μl. 1 μl, COGFP-A-R2 to a final concentration of 0.4 μM, GeneRacer 5 ′ Nested Primer to a final concentration of 0.4 μM, 10 μl of PCR reaction solution is prepared, and 0.2 μl of the first PCR reaction solution is used as a template. added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, 30 cycles of 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 2 minutes are performed, and finally extension at 72 ° C. for 5 minutes is performed. Reaction was performed. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation.

  As a result, as a first PCR reaction, a primer pair of COGFP-A-R1 and GeneRacer 5 ′ Primer was used, and as a nested PCR reaction, the obtained PCR reaction solution was used as a template for COGFP-A-R2 and GeneRacer 5 'Significant gene amplification could be confirmed when performed using primer pairs with Nested Primer. However, since amplification of a plurality of non-specific genes was observed, a nested PCR reaction was performed again using this PCR reaction solution as a template and different primer pairs.

As a second nested PCR, a GFP gene was amplified using a primer pair of COGFP-A-R3 and GeneRacer 5 ′ Nested Primer. 10 × Ex Taq Buffer (20 mM Mg ²⁺ added) is the same final concentration, dNTP Mixture (each 2.5 mM) is 0.2 mM final concentration, and TaKaRa Ex Taq (5 U / μl) is final concentration 0.05 U / μl. 20 μl of a nested PCR reaction solution was prepared using COGFP-A-R3 at a final concentration of 0.4 μM, GeneRacer 5 ′ Nested Primer at a final concentration of 0.4 μM, and the first nested PCR reaction solution as a template. 4 μl was added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, 30 cycles of 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 2 minutes are performed, and finally extension at 72 ° C. for 5 minutes is performed. Reaction was performed. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation. As a result, remarkable gene amplification could be confirmed by a series of nested PCR reactions. The base sequence of this amplified gene was determined and used as the base sequence (SEQ ID NO: 32) on the 5 ′ end side of the sea cactus fluorescent protein gene.

  Next, full-length amplification of the fluorescent protein gene was performed as follows. Based on the nucleotide sequence at the 5 ′ end of the fluorescent protein gene derived from sea cactus obtained by the above 3′-RACE and 5′-RACE analysis, it is used for 3′-RACE for cloning of the full-length fluorescent protein gene. Primers were created. Primers for cloning the full-length GFP gene prepared were COGFP-A-Full-F3 (5′-ATT TAG GTG GCT GCG TAC AG-3 ′) (SEQ ID NO: 33), COGFP-A-Full-F4 (5 ′ -ATT TAG GTG GCT GCG TAC AGT TAA CAC-3 ') (SEQ ID NO: 34). It binds to a position close to the 3 'end in the order of COGFP-A-Full-F3 and COGFP-A-Full-F4. COGFP-A-Full-F4 is used as a primer for the nested PCR reaction.

  GeneRacer 3 ′ Primer (5′-GCT), which is a primer for cloning two kinds of full-length fluorescent protein genes and 3 ′ end-specific primer, using a full-length cDNA library prepared using GeneRacer as a full-length cDNA synthesis reagent as a template. GTC AAC GAT ACG CTA CGT AAC G-3 ′) (SEQ ID NO: 24) and GeneRacer 3 ′ Nested Primer (5′-CGC TAC GTA ACG GCA TGA CAG TG-3 ′) (SEQ ID NO: 25) RACE PCR was performed. GeneRacer 3 'Primer and GeneRacer 3' Nested Primer were used as they are included in the full-length cDNA synthesis reagent GeneRacer kit (Invitrogen). In order to effectively amplify the full-length fluorescent protein gene by 3'-RACE PCR, a nested PCR was performed in which the gene amplified once by PCR was used as a template and the gene was amplified more specifically by the inner primer pair. PCR was performed according to the manual using polymerase Ex-Taq.

As the first PCR, a fluorescent protein gene was amplified using a primer pair of COGFP-A-Full-F3 and GeneRacer 3 ′ Primer. 10 × Ex Taq Buffer (20 mM Mg ²⁺ added) is the same final concentration, dNTP Mixture (each 2.5 mM) is 0.2 mM final concentration, and TaKaRa Ex Taq (5 U / μl) is final concentration 0.05 U / μl. 1 μl, COGFP-A-Full-F3 at a final concentration of 0.4 μM, GeneRacer 3 ′ Primer at a final concentration of 0.4 μM, 10 μl of a nested PCR reaction solution is prepared, and the cactus full-length cDNA library solution is 0.2 μl. Was added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, 30 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds and 72 ° C. for 1 minute are performed, and finally, extension at 72 ° C. for 5 minutes is performed. Reaction was performed. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation. Since gene amplification was slightly observed in the first 5′-RACE, a nested PCR reaction was performed using this PCR reaction solution as a template.

The fluorescent protein gene was amplified using a primer pair of COGFP-A-Full-F4 and GeneRacer 5 ′ Nested Primer as nested PCR. 10 × Ex Taq Buffer (20 mM Mg ²⁺ added) is the same final concentration, dNTP Mixture (each 2.5 mM) is 0.2 mM final concentration, and TaKaRa Ex Taq (5 U / μl) is final concentration 0.05 U / μl. 1 μl, COGFP-A-Full-F4 to a final concentration of 0.4 μM, GeneRacer 5 ′ Nested Primer to a final concentration of 0.4 μM, 10 μl of a nested PCR reaction solution is prepared, and the first PCR reaction solution is used as a template. 2 μl was added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, 30 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds and 72 ° C. for 1 minute are performed, and finally, extension at 72 ° C. for 5 minutes is performed. Reaction was performed. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation. As a result, significant gene amplification was confirmed. The base sequence of this amplified gene was determined and used as the base sequence (SEQ ID NO: 35) on the 5 ′ end side of the full-length sea cactus fluorescent protein gene.

  From the base sequence of the obtained full-length cactus fluorescent protein, the base sequence of the open reading frame of the cactus GFP gene was predicted using the sequence information analysis software DNASIS Pro (SEQ ID NO: 4). Furthermore, this open reading frame was translated to obtain the amino acid sequence of the cactus fluorescent protein (SEQ ID NO: 3). This amino acid sequence was purified from sea cactus and contained the 22-residue sequence (SEQ ID NO: 11) obtained by amino acid analysis in a completely identical state. Therefore, it was determined to be a wild-type fluorescent protein gene derived from sea cactus. . This gene was incorporated into a pRSET vector (Invitrogen), transformed into Escherichia coli, and observed with UV / BLUE CONVERTER PLATE (UVP), which showed remarkable fluorescence activity.

[Example 2: Monomerization of sea cactus fluorescent protein]
The cysteine at position 154 in the amino acid sequence of the wild type fluorescent protein was substituted with serine by the following method. For the introduction of the mutation, QuickChange II Site-Directed Mutagenesis Kit (Stratagene) was used. Using a plasmid obtained by cloning a cactus fluorescent protein gene in pRSET-A (Invitrogen) as a template, and using Pilmer1 (CAATGTATGTCGCGACGACACTTTGG) and Primer2 (CCAAAGGTGTGTCCGATACATACATTG) (SEQ ID NO: 37) PCR reaction was performed according to the manual. After the reaction, it was treated with DpnI at 37 degrees and transformed into Escherichia coli JM109 (DE3) strain.

  The transformed bacteria were cultured, the vector was taken out, and the nucleotide sequence of the fluorescent protein gene was read with a sequencer. As a result, the sequence of SEQ ID NO: 8 was obtained, and it was confirmed that the mutation could be introduced as intended. From this gene, a fluorescent protein (SEQ ID NO: 5) in which the 154th is substituted with serine is expressed.

  Further, the transformed Escherichia coli was cultured at 28 degrees and then lysed to prepare lysate. SDS-PAGE sample buffer was added thereto, a sample was prepared without applying heat, and SDS-PAGE was performed. The result is shown in FIG. FIG. 4 shows that the dimer band that appears in the wild-type fluorescent protein (left lane) disappears in the mutant fluorescent protein (right lane). This confirmed that the fluorescent protein was monomerized.

[Example 3: Modification of chromophore formation temperature of sea cactus fluorescent protein]
Mutations were randomly introduced into the monomeric mutant fluorescent protein obtained in Example 2 and screened for mutants that stabilize chromophore formation at 37 ° C.

  For the introduction of mutation, GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) was used. Using a plasmid in which a monomerized mutant gene (the 154th cysteine is replaced with serine) as a template in pRSET-A (Invitrogen) was used as a template, Pilmer1 (ATGAGTATTCCAGGAATTCGGGCTTAACAG) (SEQ ID NO: 38) and Primer2 (TCATGGTTTAGCTATGGCCGTCTGCTGTCTCTC SEQ ID NO: 39) was added, and PCR was performed according to the manual attached to the kit. After the PCR reaction, electrophoresis was performed using 1% agarose gel, and the target PCR product was purified using Wizard SV Gel and PCR Clean-Up (Promega). After purification, PCR reaction was performed according to the manual, and after treatment with DpnI at 37 ° C., ethanol precipitation was performed. After precipitation, DNA was dissolved in a small amount of distilled water and transformed into JM109 (DE3) by electroporation using MicroPulser (BioRad). The transformed E. coli was inoculated on a 25 cm square LB (50 ng / ml ampicillin added) plate and cultured at 37 ° C. to form colonies. After colony formation, use UV / BLUE CONVERTER PLATE (UVP) to select two colonies that emit strong fluorescence (named mutant 1 and mutant 2, respectively) compared to colonies expressing wild-type fluorescent protein And cultured again. Then, the base sequence of the plasmid which they hold was determined. The respective sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10.

  Furthermore, these base sequences were converted into amino acid sequences (SEQ ID NO: 6 for variant 1 and SEQ ID NO: 7 for variant 2), and compared with the wild-type amino acid sequence. Mutant 1 was found to have 126th asparagine replaced with tyrosine, 154th cysteine replaced with serine, and 166th tyrosine replaced with phenylalanine. In variant 2, 129th serine is replaced with glycine, 154th cysteine is replaced with serine, 156th aspartic acid is replaced with glycine, 204th lysine is replaced with isoleucine, 209th asparagine Was replaced by tyrosine.

  In addition, the stability of chromophore formation at 37 ° C. of mutants 1 and 2 was compared with wild-type fluorescent protein and monomeric fluorescent protein. The wild type gene, the monomerized mutant gene prepared in Example 2, the gene of mutant 1 and the gene of mutant 2 were cloned into pRSET-A (Invitrogen), respectively, and the JM109 (DE3) strain, respectively. Transformed into. These strains were applied to plates and cultured at 37 ° C. to express fluorescent proteins. The state was observed with UV / BLUE CONVERTER PLATE (UVP), and an image was taken. FIG. 5 is an image representing it in monochrome. Although fluorescence was observed as green light in an actual image, it is shown in white in FIG. 5, and the darker the white, the higher the fluorescence intensity. It can be seen that mutants 1 and 2 fluoresce very strongly compared to the wild type and monomeric mutants. In particular, it can be seen that mutant 2 emits stronger fluorescence than mutant 1.

  Next, the association state of the fluorescent protein was examined by gel filtration chromatography. Fluorescent proteins were purified and analyzed from E. coli expressing wild type fluorescent protein and E. coli expressing mutant 2. The result is shown in FIG. In the wild type, a peak was obtained in the vicinity of 66 kDa, whereas in mutant 2, a peak was obtained in the vicinity of 37 kDa. These results suggest that the fluorescent protein of variant 2 forms a monomer while the wild-type fluorescent protein forms a dimer.

[Example 4: Production of S147A mutant]
A mutation that shifts the change point of the fluorescence maximum wavelength to the alkaline side was introduced into the gene obtained in Example 3 using Quick Change II Site-Directed Mutagenesis Kit (Stratagene). Details are described below.

  pRSET-B (Invitrogen), mutant 2 (129th serine substituted with glycine, 154th cysteine replaced with serine, 156th aspartic acid replaced with glycine, 204th lysine replaced with isoleucine, Using as a template a plasmid in which the 209th asparagine was replaced with tyrosine) template, and using S147A primer 1 (CCAAACTAGAACCGGCGGATGGATCCAATG, SEQ ID NO: 40) and S147A primer 2 (CATTGACTACTACTCGCCGGTTCTAGTTTG, SEQ ID NO: 41), attached to the kit PCR reaction was performed according to the manual. After the reaction, DpnI was added to the reaction product, treated at 37 ° C., and then transformed into E. coli JM109 (DE3) strain. The transformed E. coli was grown and the plasmid DNA was purified, and it was confirmed that the gene into which the target mutation was introduced was produced. Escherichia coli carrying this plasmid was cultured at 37 degrees to express the S147A mutant, lysed, and subjected to Ni-NTA (Qiagen) column chromatography to purify the mutant.

  When the purified S147A mutant was added to a solution having a different pH and the fluorescence color was confirmed with UV handy light (365 nm), the fluorescence color changed from blue to green between pH 9 and pH 10 (FIG. 7).

  Furthermore, an absorption spectrum and a fluorescence spectrum were measured using a spectrophotometer (HITACHI U-3010) and a fluorimeter (HITACHI F-2500) (FIGS. 1 to 3). As a result, it was found that the fluorescence maximum wavelength was mainly near 462 nm at pH 9 or less (388 nm excitation, FIG. 1), and the fluorescence maximum wavelength was around 509 nm at pH 10 or more (450 nm excitation, FIG. 2). It was also found that the absorption maximum was mainly at 395 nm at pH 9 or lower, and mainly at 509 nm at pH 10 or higher (FIG. 3).

[Example 5: Production of S147T mutant]
A mutation that shifts the change point of the fluorescence maximum wavelength to the alkaline side was introduced into the gene obtained in Example 3 using Quick Change II Site-Directed Mutagenesis Kit (Stratagene). Details are described below.

  pRSET-B (Invitrogen), mutant 2 (129th serine substituted with glycine, 154th cysteine replaced with serine, 156th aspartic acid replaced with glycine, 204th lysine replaced with isoleucine, Using the plasmid inserted with the 209th asparagine substituted with tyrosine) as a template, S147T primer 1 (CCAAACTAGAACCGACCAGTGAGTCAATG, SEQ ID NO: 44) and S147T primer 2 (CATTGACTCACTGGTCTGTTCTAGTTTG, SEQ ID NO: 45) are attached to the kit. PCR reaction was performed according to the manual. After the reaction, DpnI was added to the reaction product, treated at 37 ° C., and then transformed into E. coli JM109 (DE3) strain. The transformed E. coli was grown and the plasmid DNA was purified, and it was confirmed that the gene into which the target mutation was introduced was produced. Escherichia coli carrying this plasmid was cultured at 37 degrees to express the S147T mutant, lysed, and subjected to Ni-NTA (Quiagen) column chromatography to purify the mutant.

  When the purified S147T mutant was added to a solution having a different pH and the fluorescent color was confirmed with UV handy light (365 nm), the fluorescent color changed from blue to green at around pH 6 (FIG. 12).

  Furthermore, an absorption spectrum and a fluorescence spectrum were measured using a spectrophotometer (HITACHI U-3010) and a fluorimeter (HITACHI F-2500) (FIGS. 11a to 11c). As a result, when excited by excitation light of 388 nm, a peak mainly near 460 nm is shown at pH 6 or lower, a peak near 460 nm and a peak near 507 nm are shown at pH 7, and a peak around 507 nm is shown at pH 8 or higher. (FIG. 11a). In addition, when excited by 450 nm excitation light, a peak was mainly shown only at around 507 nm at each pH (FIG. 11b). Furthermore, when the absorption peak was observed, two major peaks were observed near 389 nm and 499 nm at pH 7 or lower, and peaks were mainly present at 499 nm above pH 8 (FIG. 11c).

[Example 6: Production of S147G mutant]
A mutation that shifts the change point of the fluorescence maximum wavelength to the alkaline side was introduced into the gene obtained in Example 3 using Quick Change II Site-Directed Mutagenesis Kit (Stratagene). Details are described below.

  pRSET-B (Invitrogen), mutant 2 (129th serine substituted with glycine, 154th cysteine replaced with serine, 156th aspartic acid replaced with glycine, 204th lysine replaced with isoleucine, Using a plasmid in which the gene of 209th asparagine was replaced with tyrosine) as a template, using S147G primer 1 (CCAAACTAGAACCGGGCAGTGAGTCAATG, SEQ ID NO: 48) and S147G primer 2 (CATTGACTACTACTCCCCGTTCTAGTTTG, SEQ ID NO: 49), attached to the kit PCR reaction was performed according to the manual. After the reaction, DpnI was added to the reaction product, treated at 37 ° C., and then transformed into E. coli JM109 (DE3) strain. The transformed E. coli was grown and the plasmid DNA was purified, and it was confirmed that the gene into which the target mutation was introduced was produced. Escherichia coli carrying this plasmid was cultured at 37 degrees to express the S147G mutant, lysed, and subjected to Ni-NTA (Qiagen) column chromatography to purify the mutant.

  When the purified S147G mutant was added to a solution having a different pH and the fluorescent color was confirmed by UV handy light (365 nm), the fluorescent color changed from blue to green in the vicinity of pH 7 (FIG. 14).

  Furthermore, an absorption spectrum and a fluorescence spectrum were measured using a spectrophotometer (HITACHI U-3010) and a fluorometer (HITACHI F-2500) (FIGS. 13a to 13c). As a result, when excited by excitation light of 388 nm, peaks mainly at around 460 nm were shown at pH 9 or lower, and peaks were shown at around 460 nm and around 506 nm at pH 10 and 11 (FIG. 13a). In addition, when excited by 450 nm excitation light, peaks were mainly observed at around 506 nm at pH 5 to 11 (FIG. 13b). Further, when the absorption peak was observed, the peak was mainly around 394 nm at pH 6 or lower, the peak was around 394 nm and 495 nm at pH 7 to 9, and the absorption peak was mainly around 495 nm at pH 10 and 11. FIG. 13c).

[Example 7: Production of S147C mutant]
A mutation that shifts the change point of the fluorescence maximum wavelength to the alkaline side was introduced into the gene obtained in Example 3 using Quick Change II Site-Directed Mutagenesis Kit (Stratagene). Details are described below.

  pRSET-B (Invitrogen), mutant 2 (129th serine substituted with glycine, 154th cysteine replaced with serine, 156th aspartic acid replaced with glycine, 204th lysine replaced with isoleucine, Using as a template a plasmid in which the 209th asparagine was replaced by tyrosine) template, and using S147C primer 1 (CCAAACTAGAACCGTGCAGTGAGTCAATG, SEQ ID NO: 52) and S147C primer 2 (CATTGACTACTACTCACGGTTCTAGTTTG, SEQ ID NO: 53), attached to the kit PCR reaction was performed according to the manual. After the reaction, DpnI was added to the reaction product, treated at 37 ° C., and then transformed into E. coli JM109 (DE3) strain. The transformed E. coli was grown and the plasmid DNA was purified, and it was confirmed that the gene into which the target mutation was introduced was produced. Escherichia coli carrying this plasmid was cultured at 37 degrees to express the S147C mutant, lysed, and subjected to Ni-NTA (Qiagen) column chromatography to purify the mutant.

  When the purified S147C mutant was added to a solution having a different pH and the fluorescent color was confirmed by UV handy light (365 nm), the fluorescent color changed from blue to green in the vicinity of pH 9 (FIG. 16).

  Furthermore, an absorption spectrum and a fluorescence spectrum were measured using a spectrophotometer (HITACHI U-3010) and a fluorimeter (HITACHI F-2500) (FIGS. 15a to 15c). As a result, when excited by excitation light of 388 nm, a peak mainly around 460 nm was shown at each pH (FIG. 13a). In addition, when excited by 450 nm excitation light, peaks were mainly observed at around 512 nm at pH 8 to 11 (FIG. 13b). Further, when the absorption peak was observed, the peak was mainly around 396 nm at pH 7 or lower, the peak was around 396 nm and 505 nm at pH 8 and 9, and the absorption peak was mainly around 505 nm at pH 10 and 11. FIG. 13c).

[Example 8: Measurement of intracellular pH in fixed cells]
In the fixed cells, the fluorescence of the wild type cactus fluorescent protein was measured.

  The cDNA of wild type cactus fluorescent protein was incorporated into a mammalian cell expression vector pCDA3.1 (Invitrogen). The prepared plasmid was introduced into U2OS cells using Lipofectamine 2000 (Invitrogen). Lipofectamine 2000 was used according to the instruction manual.

  The U2OS cells were cultured all day and night, then fixed by 3% neutral formalin fixation, and a bright field image was taken with a fluorescence microscope (IX70 manufactured by Olympus) (FIG. 8a). Thereafter, the cells were washed with a phosphate buffer (pH = 7), and fluorescence was obtained using a fluorescent cube NIBA for IB excitation (Olympus: excitation filter 470-490 nm, dichroic mirror 505 nm, fluorescence filter 510-550 nm). I took a picture. FIG. 8b is an image representing it in monochrome. The fluorescence observed in green in the actual image is shown in white in FIG. 8b. Next, the cells are washed with an acetate buffer (pH = 4), and a fluorescence image is obtained using a fluorescent cube WU for excitation U (Olympus: excitation filter 330-385 nm, dichroic mirror 400 nm, fluorescence filter 420 nm long pass). I took a picture. FIG. 8c is an image representing it in monochrome. The fluorescence observed in blue in the actual image is shown in white in FIG. 8c. From these images, it was shown that the cactus fluorescent protein of the present invention can generate fluorescence even in formalin-fixed cells, and further change its wavelength according to pH.

  Furthermore, the fluorescence spectrum at each pH was measured (FIG. 8d). A multi-channel detector PMA-11 manufactured by Hamamatsu Photonics was used for the measurement. As a result, a spectrum having a maximum wavelength at 472 nm at pH 4 and at 509 nm at pH 7 was obtained.

[Example 9: Measurement of pH in phagocytic cells]
The intracellular pH was estimated by measuring the fluorescence of the wild type cactus fluorescent protein in living cells.

  Wild-type cactus fluorescent protein cDNA was incorporated into E. coli expression vector pRSET (Invitrogen). The prepared plasmid was transformed into E. coli and cultured at 25 ° C. to express the wild type cactus fluorescent protein in E. coli. This Escherichia coli was added to a culture vessel of a mouse-derived macrophage RAW264.7 cell line and cultured overnight. In addition, it is generally known that Escherichia coli is digested by organelle lysosomes in an acidic environment in RAW cells after phagocytosis by RAW cells.

  Prior to observation with a fluorescence microscope, the culture medium was replaced with a phosphate buffer (pH = 7). Thereafter, RAW cells phagocytosing E. coli were photographed using a fluorescent cube NIBA (Olympus: excitation filter 470-490 nm, dichroic mirror 505 nm, fluorescence filter 510-550 nm) for IB excitation. FIG. 9A shows an image representing the image in monochrome. When the fluorescent cube NIBA is used, mainly only green fluorescence can be detected, but in FIG. 9a, the green fluorescence is represented in white. Furthermore, it image | photographed using the fluorescence cube WU (The Olympus company make: excitation filter 330-385 nm, dichroic mirror 400 nm, fluorescence filter 420 nm long pass) for U excitation. FIG. 9B is an image representing it in monochrome. When the fluorescent cube WU is used, fluorescence of 420 nm or more including green and blue can be detected. In FIG. 9b, both green and blue fluorescence are expressed in white.

  According to FIG. 9a, scattered light can be observed, but the RAW cell shape cannot be recognized. From the comparison with the bright-field image (not shown), it can be seen that this observed light is derived from E. coli present in the culture solution before being phagocytosed by RAW cells. From this, it was found that the fluorescent protein in E. coli present in the neutral culture medium emits green fluorescence.

  As shown in FIG. 9b, it was also observed that a lot of light gathered to form a RAW cell shape in addition to scattered light. The scattered light is light derived from E. coli in the culture solution before phagocytosis, as in FIG. 9a. On the other hand, the light forming the RAW cell shape is light derived from E. coli phagocytosed and taken into lysosomes in the RAW cell. Here, according to an actual image, scattered light was observed in green, and light forming a RAW cell shape was observed in blue. From these results, it was found that the cactus fluorescent protein emits green fluorescence in a neutral culture solution, but emits blue fluorescence when transferred into acidic lysosomes.

  Furthermore, the fluorescence spectrum of the fluorescent protein before and after phagocytosis by RAW cells in FIG. 9b is shown in FIG. A ratio was determined based on the fluorescence intensities of 458 nm and 506 nm obtained from this fluorescence spectrum, and applied to a calibration curve prepared in advance to estimate the pH in the culture solution and in the lysosome (lower table in FIG. 10). The estimated pH almost reflects the pH in the culture and the pH in the lysosome.

  From the above results, it was shown that the cactus fluorescent protein can change the wavelength of the fluorescence emitted by moving from a neutral environment to an acidic environment even in living heterogeneous cells. Furthermore, it was shown that the pH in the environment where the cactus fluorescent protein exists can be obtained satisfactorily based on the fluorescence intensity at that time.

Claims (22)

  A fluorescent protein derived from an organism belonging to the cnidarian genus Hylaeidae, which changes in the fluorescence maximum wavelength in a pH-dependent manner, and the change occurs between pH 4 and pH 11.   The fluorescent protein according to claim 1, wherein the change occurs between pH 6 and pH 10.   The fluorescent protein according to claim 1 or 2, which emits blue fluorescence at a pH lower than the pH at which the change occurs, and emits green fluorescence at a pH higher than the pH at which the change occurs.   The fluorescent protein according to any one of claims 1 to 3, wherein a fluorescence maximum wavelength at a pH lower than the pH at which the change occurs is around 509 nm, and a fluorescence maximum wavelength at a pH higher than the pH at which the change occurs is around 462 nm. .   The fluorescent protein according to any one of claims 1 to 4, wherein the change occurs between pH 9 and 10.   The fluorescent protein according to claim 5, comprising the amino acid sequence represented by SEQ ID NO: 1.   The fluorescent protein according to any one of claims 1 to 4, wherein the change occurs near pH 6.   The fluorescent protein according to claim 7, comprising the amino acid sequence represented by SEQ ID NO: 42.   The fluorescent protein according to any one of claims 1 to 4, wherein the change occurs between pH 7 and 8.   The fluorescent protein according to claim 9, comprising the amino acid sequence represented by SEQ ID NO: 46.   The fluorescent protein according to any one of claims 1 to 4, wherein the change occurs near pH 9.   The fluorescent protein according to claim 11, comprising the amino acid sequence represented by SEQ ID NO: 50.   A nucleic acid comprising a base sequence encoding the fluorescent protein according to any one of claims 1 to 12.   The nucleic acid according to claim 13, wherein the base sequence is the base sequence represented by SEQ ID NO: 2, 43, 47 or 51.   A method for introducing the fluorescent protein according to any one of claims 1 to 12 into a target and measuring the pH inside the target based on fluorescence emitted by the fluorescent protein.   A fusion protein comprising the fluorescent protein according to any one of claims 1 to 12 and a protein different from the fluorescent protein is introduced into a target, and the pH inside the target is measured based on the fluorescence emitted by the fluorescent protein. how to.   The method according to claim 15 or 16, wherein the subject is a cell, tissue or individual.   The method of claim 17, wherein the subject is a fixed cell or a living cell.   The method according to any one of claims 15 to 18, wherein the measurement is performed based on a ratio between a fluorescence intensity near 509 nm and a fluorescence intensity near 462 nm.   20. The method according to claim 15, wherein the fluorescent protein is irradiated with two excitation lights having different wavelengths, and the pH inside the object is measured based on fluorescence generated from the fluorescent protein.   The method according to any one of claims 15 to 19, wherein the fluorescent protein is irradiated with excitation light having a single wavelength, and the pH inside the object is measured based on fluorescence generated from the fluorescent protein.   The method according to claims 15 to 21, wherein the treatment is carried out on a single or multiple subjects using a combination of at least two fluorescent proteins selected from the group consisting of the fluorescent proteins according to claims 5, 6, 9 and 11. the method of.

Images