RU2535981C1 - Nucleic acid encoding fret-based far-red biosensor for intracellular caspase 3 activity measurement - Google Patents

Abstract

FIELD: chemistry.

SUBSTANCE: present invention relates to biochemistry and provides a nucleic acid which encodes a FRET-based far-red fluorescent biosensor for intracellular captase 3 activity measurement, where the analytical signal of the fluorescent biosensor is fluorescence in the far-red spectral region, the acceptor is iRFP and the donor is a far-red fluorescent protein of the GFP family, where the amino acid sequence of the far-red fluorescent biosensor is selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7.

EFFECT: invention enables to obtain a novel biosensor for measuring captase 3 activity using far-red fluorescent proteins which provide an analytical fluorescent signal from the biosensor in the wavelength range greater than 650 nm.

7 dwg, 3 ex

Description

[002] FIELD OF THE INVENTION

[003] This invention relates generally to the field of biology and chemistry. In particular, the invention is directed to biosensors for detecting caspase 3 activity, constructed on the basis of fluorescent proteins.

[004] BACKGROUND

[005] The programmed cell death process, apoptosis, is one of the key processes for embryonic development and maintaining healthy tissues, in particular counteracting tumor growth. Caspase enzymes play a key role in the initiation and effector stage of apoptosis.

[006] Caspases are a family of intracellular specific cysteine proteases that are highly conserved in multicellular organisms. In mammals, 14 representatives of the caspase family were identified, grouped into 2 main groups, inflammatory and apototic caspases. Caspases associated with apoptosis are further classified into 2 groups: initiating caspases (caspases 2, 8, and 9) that function at the beginning of the caspase signaling pathway, and effector caspases 3, 6, and 7 [Degterev A, Boyce M, Yuan J. A decade of caspases. Oncogene. 2003; 22 (53): 8543-8567].

[007] The initiating caspases 8 and 9 are activated by autocatalytic cleavage mediated by a high molecular weight adapter complex known as apoptosome. This complex is usually formed in response to intracellular or extracellular stimuli, signaling the need for cell death [Riedl SJ, Salvesen GS. The apoptosome: signalling platform of cell death. Nat Rev Mol CelS Biol. 2007; 8 (5): 405-413]. The main target of activated initiating caspases are inactive precursors of effector caspases 3, 6, and 7 pro-caspases. Cleavage by caspases 8 and 9 activates effector caspases. The targets for cleavage of effector caspases, in particular caspases 3, are many cellular proteins, which leads to controlled cell death. In addition to a key role in apoptosis, recent studies demonstrate non-apoptotic non-effector caspase functions, including regulation of the immune response, proliferation, differentiation, and cell motility [Kuranaga E, Miura M. Nonapoptotic functions of caspases: caspases as regulatory molecules for immunity and cell -fate determination. Trends Cell Biol. 2007; 17 (3): 135-144; Yi CH, Yuan J. The Jekyll and Hyde functions of caspases. Dev Cell. 2009; 16 (1): 21-34].

[008] Caspases are characterized by high substrate specificity. They recognize a specific sequence in target proteins. Using libraries of fluorescently labeled tetrapeptide substrates, it was found that caspases 3 and 7 recognize the DEVD sequence as a target.

[009] As indicated by a number of authors, the specificity of caspases for substrates, determined in vitro using this approach, is not an absolutely accurate reflection of the necessary in vivo cleavage conditions. The specificity of the conformation of caspase cleavage in vivo is influenced by the features of the conformation of amino acid sequences flanking the cleaved tetrapeptide motif that can control the molecular electrostatic potential and steric accessibility of the active center of the protease and the target protein [Muneef Ayyash, Hashem Tamimi, and Yaqoub Ashhab Developing a powerful In Silico tool for the discovery of novel caspase-3 substrates: a preliminary screening of the human proteome. BMC Bioinformatics. 2012; 13: 14]. For example, despite the identical cleavable tetrapeptide sequence of DEVD, caspases 3 and 7 are characterized by a clear difference in cleavable natural substrates [Walsh JG et al. Executioner caspase-3 and caspase-7 are functionally distinct proteases. Proc Natl Acad Sci USA. 2008; 105 (35): 12815-12819]. It has been shown that, in addition to the DEVD therapeutic peptide cleavage sequence (P4-P1), residues P6, P5, P2 'and PZ' located outside the core sequence are extremely important for the identification of proteins as substrates of caspase 3 and caspase 7 [Demon D et al. Proteome-wide substrate analysis indicates substrate exclusion as a mechanism to generate caspase-7 versus caspase-3 specificity. Mol Cell Proteomics. 2009; 8 (12): 2700-2714].

[010] The limitations described above on steric availability, electrostatic charge of residues on the surface of a protein, and the effect of certain residues beyond the DEVD core sequence, superimposed on caspase targets in vivo, make the construction of artificial protein substrates for caspases a non-trivial task. Moreover, the transfer of a known caspase cleavable sequence into a new chimeric polypeptide that is not a caspase substrate does not guarantee the operability of the obtained chimeric polypeptide as a caspase substrate.

[011] Among effector caspases, caspase 3 is considered the most important effector to cleave a large number of cell substrates. Inactivation of caspase 3 using antibodies inhibits most of the proteolytic reactions that occur during apoptosis, while inactivation of other effector caspases has a negligible effect on apoptosis markers and the effectiveness of their proteolysis [Walsh JG et al. Executioner caspase-3 and caspase-7 are functionally distinct proteases. Proc Natl Acad Sci USA. 2008; 105 (35): 12815-12819]. Studies over the past 10 years have identified more than 200 substrates of caspase 3 and their number continues to grow.

[012] Determining the level of cells undergoing apoptosis, for example, by measuring caspase 3 activity, can be used, in particular, to evaluate the effectiveness of anti-cancer therapy [Rossi E et al. Dynamic changes of live / apoptotic circulating tumor cells as predictive marker of response to sunitinib in metastatic renal cancer. Br J Cancer. 2012 Oct 9; 107 (8): 1286-94; Yang F et al. Sunitinib induces apoptosis and growth arrest of medulloblastoma tumor cells by inhibiting STAT3 and ACT signaling pathways. Mol Cancer Res. 2010 Jan; 8 (1): 35-45]. A widely used method for determining caspase 3 activity based on the immunochemical detection of caspase activity product, cleaved cytokeratin 18 (M30 CytoDEATH ™, Peviva), is described in the literature. However, with high sensitivity and reliability, this method has several disadvantages, such as the inability to track changes in the activity of caspases in dynamics, the high cost and complexity of the analysis.

[013] Analysis of the use of genetically encoded biosensors based on fluorescent proteins [Chudakov DM, Matz MV, Lukyanov S, Lukyanov KA. Fluorescent Proteins and Their Applications in Imaging. Living Cells and Tissues. Physiol Rev. 2010 Jul; 90 (3): 1103-63].

[014] Fluorescent proteins of the GFP family (Green Fluorescent Protein, GFP), including the actual GFP from the jellyfish Aequorea victoria (avGFP), its mutants and homologs, are widely known today due to their intensive use as in vivo fluorescent markers in biomedical research, which is described in detail reviewed by Lippincott-Schwartz and Patterson in Science (2003) 300 (5616): 87-91 and Chudakov et al. (Physiol Rev. 2010 Jul; 90 (3): 1103-63).

[015] Fluorescent proteins are capable of fluorescence when irradiated with light of a suitable wavelength. The fluorescence properties of these proteins are due to the interaction of two or more amino acid residues that form the chromophore, and not the fluorescence of any one amino acid residue.

[016] GFP hydromedusa Aequorea aequorea (synonym for A. victoria) has been described by Johnson et al. at J Cell Comp Physiol. (1962), 60: 85-104, as part of a jellyfish bioluminescent system, where GFP plays the role of a secondary emitter that converts blue light from an equorin photo protein to green light. The cDNA encoding A. victoria GFP was cloned by Prasher et al. (Gene (1992), 111 (2): 229-33). It turned out that this gene can be heterologically expressed in virtually any organism due to the unique ability of GFP to autocatalytically form a chromophore (Chalfie et al., Science 263 (1994), 802-805). This information has opened up broad prospects for the use of GFP in cell biology as a genetically encoded fluorescent label.

[017] GFP has been used in a wide range of applications, including the study of gene expression and protein localization (Chalfie et al., Science 263 (1994), 802-805, and Heim et al. In Proc. Nat. Acad. Sci. (1994 ), 91: 12501-12504), as a tool for visualizing the intracellular distribution of organelles (Rizzuto et al., Curr. Biology (1995), 5: 635-642), for visualizing the transport of proteins along the secretory pathway (Kaetherand Gerdes, FEBS Letters ( 1995), 369: 267-271).

[018] Numerous studies have been conducted to improve the properties of avGFP (Aequorea victoria GFP) and to obtain GFP variants that are suitable and optimized for various research purposes. The avGFP (codon usage) genetic code was optimized to increase expression in mammalian cells (“humanized” GFP, Haas, et al., Current Biology (1996), 6: 315-324; Yang, et al., Nucleic Acids Research (1996), 24: 4592-4593). Various GFP mutants have been obtained, including the “enhanced green fluorescent protein” (EGFP) having two amino acid substitutions: F64L and S65T (Heim et al., Nature 373 (1995), 663-664). Other mutants are blue, blue, and yellow-green spectral variants of avGFP and contain substitutions of amino acid residues that form the chromophore and / or residues that form the environment of the chromophore.

[019] In 1999, GFP homologues were cloned from non-bioluminescent species of Arrthozoa (Matz et al., Nature Biotechnol. (1999), 17: 969-973). This discovery has demonstrated that these proteins are not necessarily a component of the bioluminescent system. GFP-like proteins from Anthozoa had a large spectral diversity and included cyanic, green, yellow, red fluorescent proteins and violet-blue non-fluorescent chromoproteins (CPs) (Matz et al., Bioessays (2002), 24 (10): 953-959) . Subsequently, cDNAs of GFP-like proteins were cloned from a number of hydroid jellyfish and from copepods (Shagin et al., Mol Biol Evol. (2004), 21 (5): 841-850). Today, the family of GFP-like proteins includes hundreds of fluorescent and stained GFP homologs. The similarity of these proteins to GFP varies from 80-90% to less than 25% amino acid sequence identity.

[020] Crystal structures of wild-type avGFP, GFP S65T mutant, and a number of GFP homologues were obtained (Ormo et al. Science (1996) 273: 1392-1395; Wall et al. Nat Struct Biol (2000), 7: 1133-1138; Yarbrough et al. Proc Natl Acad Sci USA (2001) 98: 462-467; Prescott et al. Structure (Camb) (2003), 11: 275-284; Petersen et al. J Biol Chem (2003), 278: 44626 -44631; Wilmann et al. J Biol Chem (2005), 280: 2401-2404; Remington et al. Biochemistry (2005), 44, 202-212; Quillin et al. Biochemistry (2005), 44: 5774-5787) . It was postulated that all members of the family have a common 3D structure (GFP-like domain), which is the so-called “barrel” of 11 beta layers, forming a compact antiparallel structure, inside which there is an alpha helix containing a chromophore. A chromophore is formed within a GFP-like domain by oxidative cyclization of three conserved amino acid residues in the central region of the alpha helix (Cody et al., Biochemistry (1993) 32, 1212-1218). The positions of the amino acid residues forming the chromophore correspond to the Ser65-Tyr66-Gly67 region of avGFP. These amino acid residues can easily be identified in any GFP-like protein by aligning its sequence with the avGFP sequence.

[021] Fluorescent proteins are a unique family of structurally related proteins that are capable of forming a chromophore autocatalytically without involving external substrates or cofactors. Under the influence of inducing light, the chromophore produces fluorescence that can be easily detected using modern laboratory equipment (spectrofluorimeter, fluorescence microscope, fluorescence-activated cell sorter, flatbed fluorimeter).

[022] The process of autocatalytic formation of a chromophore of proteins with different spectral properties is described in detail in a number of articles and includes several chemical reactions (Heim et al. Proc Natl Acad Sci USA. 1994; 91: 12501-12504; Ormo et al. Science. 1996; 273 : 1392-1395; Yang et al. Nat Biotechnol. 1996; 14: 1246-1251; Brejc et al. J. Proc Natl Acad Sci USA. 1997; 94: 2306-2311; Palm et al. Nat Struct Biol. 1997; 4: 361-365; Gurskaya et al., BMC Biochem. 2001; 2: 6; Gross et al. Proc Natl Acad Sci USA. 2000; 97: 11990-11995; Wall et al. Nat Struct Biol. 2000; 7: 1133-1138; Yarbrough et al., J. Proc Natl Acad Sci USA. 2001; 98: 462-467; Pakhomov, AA and Martynov, VI Chem. Biol. 2008, 15, 755-764; Quillinet al. (2005) Biochemistry 44, 5774-5787; Yampolsky et al. (2005) Biochemistry 44, 5788-5793; Shu et al. (2006) Biochemistry 45, 9639-9647; K ikuchi et al. (2008) Biochemistry 47, 11573-11580; Yampolsky et al., Biochemistry, 2009, 48 (33), p.8077-8082).

[023] GFP-like proteins are widely used to create genetically encoded biosensors. The study of intracellular processes using such genetically encoded biosensors is becoming increasingly popular, since only such sensors can provide information about changes in the parameter under study directly in a living system. Such biosensors are in demand both in basic research of the body's signaling pathways, and in testing toxic and drug preparations on model cell lines or organisms. Compared with chemical and physical methods for recording biologically active substances with biosensors requiring exogenously added dyes, substrates, or cofactors, genetically encoded nanobiosensors belong to the class of non-reagent and reusable sensors.

[024] In order to monitor the processes in the thickness of the tissues of mammals of animals, characterized by significant absorption and light scattering at wavelengths less than 650 nm, related GFP fluorescent proteins with emission maxima in the far red region were developed. Katushka fluorescent protein has been described (maximum excitation 588 nm, maximum emission 635 nm) [Shcherbo D et al. Bright far-red fluorescent protein for whole-body imaging. Nat Methods. 2007 Sep; 4 (9): 741-6], as well as its variant with increased monomerism mKate2, eqFP650 (dimeric protein, maximum excitation 592 nm, maximum emission 650 nm), NiRFP (eqFP670, dimer protein, maximum excitation 605 nm, maximum emission 670 nm) [Shcherbo D et al. Near-infrared fluorescent proteins. Nat Methods. 2010 Oct; 7 (10): 827-9]. eqFP650 is one of the brightest fluorescent proteins with a maximum emission with a wavelength of more than 635 nm, and eqFP670 has high photostability and is today the fluorescent protein with the longest wavelength maximum of fluorescence emission among GFP-like proteins.

[025] In 2010, a fluorescent protein that was not related to the GFP protein was described, which has a completely different structure and unique spectral properties. The near-infrared emission fluorescent protein (iRFP) is a bacterial phytochrome RpBphP2 protein from the photosynthetic bacterium Rhodopseudomonas palustris with absorption and emission maxima of 690 and 713 nm, respectively. The protein was developed for functional studies using fluorescence in mammalian animal tissue in vivo, in which the use of most related GFP fluorescent proteins is limited due to the high light absorption of hemoglobin and skin melanin. For these purposes, the absorption and emission maxima should be close to the infrared region of the spectrum from 650 to 900 nm, where the absorption and scattering of light by tissues is the smallest.

[026] The role of the fluorophore in the protein is played by the molecule of linear tetrapyrrole biliverdin IXα, covalently attached to the cysteine residue of the polypeptide chain. In mammalian cells, iRFP does not require additional addition of the biliverdin cofactor necessary for fluorescence, since this compound is an intermediate in heme metabolism and is present in cells. The protein has a high fluorescence brightness, intracellular stability and photostability compared to previously known phytochrome-based fluorescent proteins. Compared to far-red GFP-based fluorescent proteins, iRFP is characterized by a higher signal-to-background ratio in animal tissues due to emission in the near-infrared region of the spectrum.

[027] Theoretically, due to its spectral properties, the iRFP protein can be used as an acceptor for FRET paired with donors such as far red fluorescent GFP family proteins. Theoretically, this protein can be used to construct FRET-based biosensors using donors such as far-red fluorescent proteins of the GFP family, however, the possibility of creating such sensors has not been previously experimentally tested.

[028] The protein is a dimer, which complicates the construction of biosensors with its use. To obtain fusion proteins with iRFP, it is recommended that its developers use tandem dimers of this protein (Filonov GS, Piatkevich KD, Ting LM, Zhang J, Kim K, Verkhusha W. Bright and stable near-infrared fluorescent protein for in vivo imaging. Nat Biotechnol. 2011 Jul 17; 29 (8): 757-61].

[029] Fluorescent protein-based biosensors are chimeric proteins that include a sensory domain — a protein, a protein domain, or a polypeptide that is sensitive to a change in a specific cell parameter, for example, a change in the activity of an enzyme protein (such as a protease, for example, caspase). As the signal part of the biosensor, GFP-like proteins or their variants are used, between which the process of Ferster resonance energy transfer (FRET) can occur [Chudakov DM, Matz MV, Lukyanov S, Lukyanov KA. Fluorescent Proteins and Their Applications in Imaging. Living Cells and Tissues. Physiol Rev. 2010 Jul; 90 (3): 1103-63].

[030] Ferster energy transfer, otherwise a dipole-dipole energy transfer; fluorescent resonant energy transfer; inductive resonance energy transfer (FRET) is a mechanism of energy transfer between two chromophores (from a donor to an acceptor) that occurs without intermediate emission of photons and is the result of a dipole-dipole interaction between a donor and an acceptor. A characteristic feature of this process is the quenching of donor fluorescence and the occurrence of longer wavelength acceptor fluorescence. The energy transfer efficiency (or the ratio of the number of energy transfer events to the number of donor excitation events) is directly related to the transfer rate and depends on the distance between objects (decreases as r ^-6 ). The effective distance at which the transition rate is 50% of the maximum is called the Foerster radius. For most systems, its value is 20-50 Å.

[031] The energy transfer efficiency also depends on many factors, such as the distance between the donor and the acceptor, the degree of overlap of the emission spectra of the donor and the absorption of the acceptor, the relative orientation of the dipoles of the donor and the acceptor [Lakowicz J.R. Principles of fluorescence spectroscopy. - Springer, 2006].

[032] Thus, it is practically impossible to predict the effectiveness of FRET between known fluorophore proteins in advance, therefore, creating an efficient FRET-based fluorescent biosensor with a new pair of fluorophores is a non-standard and difficult task [Campbell RE. Fluorescent-protein-based biosensors: modulation of energy transfer as a design principle. Anal Chem. 2009 Aug 1; 81 (15): 5972-9.].

[033] Detection of molecular dynamics using FRET is a modern and highly popular method for the analysis of protein-protein interactions upon activation of intracellular signaling pathways. Studies using FRET between labeled derivatives of GFP molecules showed the formation of complexes between signaling proteins in various cell compartments. FRET-based biosensors were also created for the detection of caspase activity [Chudakov DM, Matz MV, Lukyanov S. Lukyanov KA. Fluorescent Proteins and Their Applications in Imaging. Living Cells and Tissues. Physiol Rev. 2010 Jul; 90 (3): 1103-63].

[034] For example, to detect caspase 3 activity, an FRET-based biosensor consisting of two fluorescent proteins derived from green fluorescent GFP protein, such as cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP), was constructed and successfully used, and including a caspase recognized sequence in the linker between them. In this system, cleavage of the linker moiety by activated caspase led to the disappearance of FRET due to the physical discrepancy of the two fluorophores. A similar sensor for caspase 8 was also obtained [Luo KQ, Yu VC, Pu Y, Chang DC. Measuring dynamics of caspase-8 activation in a single living HeLa cell during TNFalpha-induced apoptosis. Biochem Biophys Res Commun. 2003 May 2; 304 (2): 217-22].

[035] A similar genetically encoded biosensor of casperase 3 activity Casper3-BG (Subach OM et al. Chem Biol. 2008 Oct 20; 15 (10): 1116-24) based on FRET between the blue fluorescent TagBFP protein and green is also described TagGFP2 fluorescent protein from the family of GFP-like proteins separated by a caspase 3 cleavable DEVD linker. Activation of caspase 3 during apoptosis leads to cleavage of the linker sequence between proteins and the disappearance of FRET, which can be detected by attenuation of the green fluorescence of TagGFP2 and simultaneous enhancement of TagBFP fluorescence. TagGFP2 and TagBFP proteins are less able to form heterodimers compared to YFP and CFP, which leads to a decrease in the background level of the FRET biosensor.

[036] The FRET-based caspase activity biosensors also include a genetically encoded biosensor consisting of a red fluorescent TagRFP protein (emission maximum 584 nm) as a donor for FRET and not fluorescent under the conditions of measurement of the KFP chromoprotein as an FRET acceptor [Savitsky AP et al. FLIM-FRET Imaging of Caspase-3 Activity in Live Cells Using Pair of Red Fluorescent Proteins. Theranostics. 2012; 2 (2): 215-261.

[037] A FRET-based biosensor has been described for the simultaneous detection of caspase 8 and caspase 3 activity of CYR83 constructed from three fluorescent proteins of the GFP family: cyan fluorescent protein seCFP (420 nm excitation, 476 nm emission), Venus yellow fluorescent protein (514 nm excitation , 528 nm emission) and red fluorescent protein mRFP1 (500 nm excitation, 608 nm emission). Proteins seCFP and Venus were linked by a caspase-cleavable 8 linker, then the Venus protein was linked to the mRFP1 protein by a caspase-cleaved 3 linker. Caspase 3 activity was detected by the disappearance of FRET between Venus and mRFP1, by an increase in fluorescence at 528 nm and a decrease in fluorescence at 608 nm.

[038] However, all the described genetically encoded fluorescence caspase biosensors do not allow measurements in the wavelength range 650-900 nm, which is convenient for measuring fluorescence in animal models. Thus, there is a need to develop new genetically encoded biosensors of caspase 3 activity using far-red fluorescent proteins that provide an analytical fluorescent signal from the biosensor in the wavelength region of more than 650 nm.

[039] To date, no fluorescent caspase activity biosensors based on FRET have been developed using far-red fluorescent proteins as donors for energy transfer. Also not described are biosensors based on FRET designed using a fluorescent protein with emission in the near infrared region of the iRFP spectrum.

[040] Since the presence and effectiveness of FRET between donor and acceptor fluorophores, in particular two fluorescent proteins, depends on many parameters, it does not seem to predict the possibility of creating a FRET biosensor based on theoretical assumptions about the properties of iRFP and far-red GFP mutants possible.

[041] Since the fluorescent proteins of the GFP family eqFP650 and eqFP670 and the fluorescent protein iRFP in vivo used in the construction of the genetically encoded biosensors of the present invention are non-covalent linked dimers, the biosensors of the invention are also higher order dimers or structures in in systems vivo, which can completely sterically block the caspase-sensitive 3 linker and inhibit the degradation of the biosensor by caspase. This situation is also complicated by the fact that the caspase 3 enzyme itself is active in the cell as a dimer [Savitsky AP et al. FLIM-FRET Imaging of Caspase-3 Activity in Live Cells Using Pair of Red Fluorescent Proteins. Theranostics. 2012; 2 (2): 215-26]. Since the structure of the iRFP protein is fundamentally different from the structure of GFP-like proteins, the structure of biosensors according to the invention cannot be approximated from known biosensor structures based on only GFP-like proteins.

[042] SUMMARY OF THE INVENTION

[043] The present invention provides isolated nucleic acid molecules encoding fluorescence biosensors for measuring caspase 3 activity, the analytical signal of which is fluorescence in the far red spectrum.

[044] In some embodiments, the nucleic acid of the present invention encodes a fluorescent biosensor to detect caspase 3 activity within cells. In some embodiments, the biosensor responds by increasing the activity of caspase 3 in the medium by increasing the fluorescence of the FRET donor protein in the far red region with a wavelength of more than 650 nm when excited relative to the fluorescence of the iRFP protein. In some embodiments, the far-red fluorescent protein donor for FRET is a protein of the GFP family. In some embodiments, the far red fluorescence protein donor for FRET is mKate2 protein, the fluorescence of which is excited by light with a wavelength of approximately 588 nm and measured at a wavelength of approximately at least 635 nm, preferably approximately 650 nm. In some embodiments, the far red fluorescence protein donor for FRET is an eqFP650 protein, the fluorescence of which is excited by light with a wavelength of approximately 592 nm and measured at a wavelength of approximately at least 650 nm. In some embodiments, the far red fluorescence protein donor for FRET is an eqFP670 protein, the fluorescence of which is excited by light with a wavelength of approximately 605 nm and measured at a wavelength of approximately at least 670 nm. Preferably, changes in the fluorescence of a far-red fluorescence protein donor for FRET are normalized to the fluorescence of the iRFP protein at a wavelength of at least at least 713 nm when excited with light at a wavelength of approximately 690 nm.

[045] In some embodiments, the biosensor of the present invention consists of a far-red fluorescent protein molecule of the GFP family (SEQ ID NO: 1, 2, or 3) operatively coupled via a movable linker containing a caspase 3 cleavage site to a fluorescent iRFP protein with emission in close to the infrared region of the spectrum (SEQ ID NO: 4). In some embodiments, a movable linker containing a caspase 3 cleavage site has the amino acid sequence shown in SEQ ID NO: 8. In some embodiments, the biosensor of the present invention has the amino acid sequence shown in SEQ ID NO: 5, 6 or 7 (mKate2-kasp-iRFP, FP650-kasp-iRFP or NiRFP-kasp-iRFP). In some embodiments, the nucleic acid encoding the biosensor of the present invention has the nucleotide sequence shown in SEQ ID NO: 9, 10 or 11.

[046] Nucleic acid molecules that differ from the presented nucleotide sequences due to the degeneracy of the genetic code are also included in the scope of the present invention.

[047] In other embodiments, vectors comprising the nucleic acid of the present invention are also provided. In addition, the present invention provides expression cassettes comprising the nucleic acid of the present invention and regulatory elements necessary for expression of the nucleic acid in a selected host cell. In addition, cells, stable cell lines, transgenic animals and transgenic plants including nucleic acids, vectors or expression cassettes of the present invention are also provided. In other embodiments, the functional fluorescent biosensors of the present invention are provided, which are encoded by the nucleic acids indicated above. In addition, a kit comprising nucleic acids and / or vectors and / or expression cassettes comprising said nucleic acids of the present invention is provided.

[048] BRIEF DESCRIPTION OF THE DRAWINGS

[049] Figure 1 illustrates the structure of the biosensors of the present invention and the principle of their operation. The fluorescent proteins are shown — donor and acceptor for FRET, separated by a DEVD-containing linker linker. Caspase 3 linker cutting is accompanied by the disappearance of FRET.

[050] Figure 2A shows the fluorescence excitation spectrum of mKate2-kasp-iRFP before and after the addition of caspase 3 upon emission at 740 nm.

[051] Figure 2B shows the FP650-kasp-jrfp fluorescence excitation spectrum before and after the addition of caspase 3 upon emission at 740 nm.

[052] Figure 2B shows the fluorescence excitation spectrum of NiRFP-kasp-iRFP before and after the addition of caspase 3 upon emission at 740 nm.

[053] Figure 3A shows mKate2-kasp-iRFP fluorescence emission spectra upon excitation at 550 nm before and after the addition of caspase 3.

[054] Figure 3B shows the FP650-kasp-iRFP fluorescence emission spectra upon excitation at 580 nm before and after the addition of caspase 3.

Figure 3B shows NiRFP-kasp-iRFP fluorescence emission spectra upon excitation at 590 nm before and after the addition of caspase 3.

[055] EMBODIMENTS OF THE INVENTION

[056] To more fully disclose the above characteristics of the present invention, a detailed description of the invention, summarized above, in the form of references to embodiments, some of which are illustrated by additional figures, is provided below. It should be noted that the accompanying figures illustrate only typical embodiments of the present invention and, therefore, should not be construed as limiting the scope of the invention, which may allow other equally effective embodiments.

[057] As indicated above, the present invention is directed to nucleic acid molecules that encode fluorescence biosensors for measuring caspase 3 activity, the analytical signal of which is fluorescence in the far red spectrum.

[058] the Nucleic acids of the present invention obtained using recombinant technologies. In preferred embodiments, the nucleic acids of the present invention encode proteins having the amino acid sequence shown in SEQ ID NO: 5, 6, or 7. Also provided are vectors and expression cassettes comprising the nucleic acid of the present invention. In addition, provided are cells, stable cell lines, transgenic animals and transgenic plants, including nucleic acids, vectors or expression cassettes of the present invention.

[059] These nucleic acids are used in many different applications and methods, in particular for monitoring changes in caspase 3 activity within cells.

[060] Definitions

[061] Various terms related to the biological molecules of the present invention are used above and also in the description and in the claims.

[062] As used here, the term "fluorescent protein" means a protein that has the ability to fluorescence; for example, it may exhibit low, medium, or intense fluorescence when irradiated with light at a suitable wavelength for excitation. The fluorescent property of a fluorescent protein is such a property that is the result of the work of the chromophore. As such, the fluorescent proteins of the present invention do not include proteins that exhibit fluorescence due to individual fluorescent residues such as tryptophan, tyrosine and phenylalanine.

[063] As used here, the term "fluorescent protein based on GFP" means a protein belonging to the family of GFP-like proteins, which has the ability to fluorescence; for example, it may exhibit low, medium, or intense fluorescence when irradiated with light at a suitable wavelength for excitation. The fluorescent property of a fluorescent protein is such a property, which is the result of the work of a chromophore formed by autocatalytic cyclization of three or more amino acid residues in a polypeptide chain. As such, the fluorescent proteins of the present invention do not include proteins that exhibit fluorescence due to individual fluorescent residues such as tryptophan, tyrosine and phenylalanine.

[064] As used here, the term “near-infrared emission fluorescent protein iRFP” or “iRFP” means a bacterial phytochrome RpBphP2 protein from the photosynthetic bacterium Rhodopseudomonas palustris with absorption and emission maxima of 690 and 713 nm, having an amino acid sequence given in SEQ ID NO: 4.

[065] As used here, the term "caspase" refers to proteins of the family of intracellular specific cysteine proteases involved in apoptosis. More preferably, the term caspase refers to effector caspases, more preferably caspase 3.

[066] As used here, the term "avGFP" refers to a green fluorescent protein from Aequorea victoria jellyfish, including avGFP variants known in the art, designed to provide greater fluorescence or fluorescence intensity in other color areas. The wild-type avGFP sequence has been disclosed in Prasher et al. (1992, Gene 111: 229-33).

[067] As used here, the term "Förster energy transfer" (FRET) means the mechanism of energy transfer between two chromophores (from donor to acceptor), which occurs without intermediate emission of photons and is the result of a dipole-dipole interaction between the donor and the acceptor. The effectiveness of FRET may be different.

[068] As used here, the term “far red fluorescent protein” refers to GFP family proteins with a maximum fluorescence emission at a wavelength of more than 630 nm, preferably at a wavelength of more than 650 nm, such as Katushka, mKate2, eqFP650, NiRFP ( eqFP670).

[069] As used here, the term "isolated" or "isolated" means a molecule or cell that is in an environment other than the environment in which the molecule or cell is in vivo.

[070] As used here, the term "mutant" or "derivative" refers to a protein disclosed in the present invention, in which one or more amino acids are added, and / or substituted, and / or removed (delegated), and / or inserted ( inverted) to the N-terminus and / or C-terminus and / or within the native amino acid sequences of the proteins of the present invention. As used here, the term "mutant" refers to a nucleic acid molecule that encodes a mutant protein. In addition, the term "mutant" refers to any variant that is shorter or longer than a protein or nucleic acid.

[071] The term "homology" is used here to describe the relationship of nucleotide or amino acid sequences to other nucleotide or amino acid sequences, which is determined by the degree of identity and / or similarity between these compared sequences.

[072] As used here, the amino acid or nucleotide sequences are "substantially similar" or "substantially the same as the reference sequence" if the amino acid or nucleotide sequences have at least 85% identity with the specified sequence within the region selected for comparison . Thus, substantially similar sequences include those that have, for example, at least 85% identity, at least 90% identity, at least 95% identity, or at least 96%, 97%, 98 % or 99% identity. Two sequences that are identical to one another are also essentially similar.

[073] The percentage of sequence identity is determined based on a reference sequence. Algorithms for sequence analysis are known in the art, such as BLAST described in Altschul et al., J. Mol. Biol., 215, p. 403-10 (1990). For the purposes of the present invention, nucleotide and amino acid sequence comparisons performed using the Blast software package provided by the National Center for Biotechnology Information (http://www.ncbj.nlm.njh.gov/blast) using alignment breaks with standard parameters may be used to determine the level of identity and similarity between nucleotide sequences and amino acid sequences.

[074] As used here, the term "similar proteins" or "essentially similar proteins" refers to proteins that have amino acid sequences that are at least 85% identical, typically 90% or more identical, most often identical at least at least 95% or more (for example, 96% or more, 97% or more, 98% or more, 99% or more, 100%). In this case, the length of homologous amino acid sequences of "similar proteins" can be at least 100 amino acid residues, more often at least 200 amino acid residues or 300 amino acid residues.

[075] In some embodiments, the term “similar proteins” or “substantially similar proteins” refers to proteins that have the amino acid sequences of a whole protein that are at least 85% identical, typically 90% or more identical, most often identical at least 95% or more (for example, 96% or more, 97% or more, 98% or more, 99% or more, 100%).

[076] As used here, the term "functional" means that the nucleotide or amino acid sequence can function for the specified test or task. The term "functional", used to describe the biosensor of the present invention, means that it changes the spectral characteristics in the presence of caspase 3 activity in the medium.

[077] As used here, the term "environment" in relation to a biosensor means any environment in which this biosensor can function. For an isolated protein, this can be any buffer solution in which this sensor retains functionality. For a protein expressed in a cell, it is the cytoplasm or cell compartment in which the biosensor is localized.

[078] As used here, “biochemical properties” refer to protein folding (folding) and maturation rate, recovery rate after reaction with a test substance, half-life, aggregation ability, oligomerization ability, pH and temperature stability, and other similar properties.

[079] As used herein, “fluorescence properties” or “spectral properties” refer to the molar extinction coefficient at a suitable wavelength, the quantum yield of fluorescence, the shape of the fluorescence excitation spectrum or emission spectrum, the wavelength corresponding to the maximum fluorescence excitation, and wavelength corresponding to the maximum emission, the ratio of the amplitude of the excitation of fluorescence at two different wavelengths, the ratio of the amplitude of the emission at two different wavelengths, the lifetime of the excited state and anisotropy of optical properties. The measured difference can be defined as the amount of any quantitative fluorescence property, for example, the fluorescence intensity at a specific wavelength, or the integral fluorescence over the entire emission spectrum.

[080] As used here, "aggregation" refers to the tendency or ability of an expressed protein to form an insoluble precipitate (aggregates). “Aggregation” should be distinguishable from “oligomerization”. In particular, mutants with reduced ability to aggregate, for example with increased solubility, do not necessarily have a reduced ability to oligomerization.

[081] As used here, "oligomerization" refers to the tendency or ability of an expressed protein to form complexes (oligomers) as a result of the specific interaction of two or more polypeptides. The specified specific interaction is observed under special conditions, for example, under physiological conditions, and is relatively stable under these conditions. A reference to the “ability” of proteins to oligomerize means that proteins can form dimers, trimmers, tetramers, or similar complexes under special conditions. As a rule, fluorescent proteins are capable of oligomerization under physiological conditions. Fluorescent proteins can also oligomerize under conditions other than, for example, pH than pH under physiological conditions. The conditions under which fluorescent proteins form oligomers or show a tendency to oligomerization can be determined using well-known methods, such as gel filtration, or by any other method known in the art.

[082] Reference to a nucleotide sequence encoding a polypeptide means that the polypeptide is produced from the nucleotide sequence during translation and transcription of mRNA. In this case, both a coding strand identical to mRNA and usually used in the list of sequences can be indicated, as well as a complementary strand that is used as a template for transcription. As is obvious to any person skilled in the art, the term also includes any degenerate nucleotide sequences encoding the same amino acid sequence. Nucleotide sequences encoding a polypeptide include sequences containing introns.

[083] The term “operatively linked”, “operatively integrated” or the like when describing the structure of a biosensor or chimeric proteins based on it refers to polypeptide sequences that are in physical and functional connection with each other. In the most preferred embodiments, the basic functions of the polypeptide components of the chimeric molecule are not changed compared to the functional properties of the isolated polypeptide components. For example, the far-red fluorescent protein and the iRFP protein that are part of the biosensor of the present invention retain the ability to fluorescence. In the case where the biosensor of the present invention is crosslinked with an intracellular localization signal of interest, the chimeric protein retains the ability to respond to changes in caspase 3 activity, but is localized in a specific cell compartment. As is obvious to any person skilled in the art, nucleotide sequences encoding a chimeric protein including “operably linked” components (proteins, polypeptides, linker sequences, protein domains, etc.) consist of fragments encoding these components, where these the fragments are covalently linked in such a way that a full-sized chimeric protein is produced during translation and transcription of the nucleotide sequence. In other words, the fragments are connected in such a way that there are no “failures” in the reading frame and stop codons at their junctions.

[084] As used here, the term "caspase 3 activity" refers to the ability of a caspase 3 enzyme protein to specifically catalyze the cleavage reaction of its natural or artificial substrates.

[085] As used here, the term "biosensor signal" means a detectable change in the spectral characteristics of the biosensor in response to the activity of caspase 3 in the medium.

[086] NUCLEIC ACID MOLECULES

[087] The present invention provides nucleic acid molecules encoding a fluorescence biosensor for detecting caspase 3 activity, the analytical signal of which is fluorescence in the far red spectrum.

[088] As used here, a nucleic acid molecule is a DNA molecule, such as a genomic DNA or cDNA molecule, or an RNA molecule, such as an mRNA molecule. As used here, the term "cDNA" refers to nucleic acids that possess the arrangement of sequence elements found in native mature types of mRNA, where sequence elements are exons and the 5 'and 3' non-coding regions.

[089] The biosensor structure is shown schematically in Figure 1. The biosensor is a chimeric protein consisting of a far-red fluorescent protein of the GFP family (SEQ ID NO: 1. 2 or 3), to which, through a movable linker containing a caspase 3 cleavage site, the fluorescent IRFP protein is coupled operatively with emission in the near infrared region of the spectrum (SEQ ID NO: 4). In some embodiments, as shown in Figure 1, a movable linker containing a caspase 3 cleavage site includes a DEVD sequence. In some embodiments, a movable linker containing a caspase 3 cleavage site has the amino acid sequence shown in SEQ ID NO: 8. In some embodiments, the biosensor of the present invention has the amino acid sequence shown in SEQ ID NO: 5, 6 or 7 (mKate2-kasp-iRFP, FP650-kasp-JRFP or NiRFP-kasp-iRFP). In some embodiments, the nucleic acid encoding the biosensor of the present invention has the nucleotide sequence shown in SEQ ID NO: 9, 10 or 11.

[090] Methods for producing such chimeric proteins are well known to those skilled in the art. For example, parts of a nucleic acid encoding various elements (for example, amino acid sequences of far-red fluorescent proteins, linker sequences, iRFP protein) can be inserted in a specific order in the polylinker of the vector, so that there are no stop codons between different parts in reading frame and there will be no malfunctioning of the reading frame. Alternatively, the desired nucleotide sequence can be assembled from the fragments using DNA ligase or PCR with primers containing parts complementary to the terminal sequences of the fragments to be joined.

[091] A nucleic acid molecule encoding a fluorescent biosensor can be synthesized from suitable nucleoside triphosphates. This method is based on protocols well known in the art. For example, the availability of amino acid sequence information or nucleotide sequence information enables the production of isolated nucleic acid molecules of the present invention using oligonucleotide synthesis. In the case of amino acid sequence information, several nucleic acids can be synthesized that differ from each other due to the degeneracy of the genetic code. Methods for selecting codon variants for a desired host are well known in the art. Synthetic oligonucleotides can be prepared using the phosphoramidite method and the resulting constructs can be purified using methods well known in the art, such as high performance liquid chromatography (HPLC), or other methods as described, for example, in Sambrook et al., Molecular Cloning : A Laboratory Manual, 2 ^nd Ed., (1989) Cold Spring Harbor Press, Cold Spring Harbor, NY, and as described in, for example, United States Dept of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research. The long double-stranded DNA molecules of the present invention can be synthesized in the following stages: several smaller fragments with the necessary complementarity, which contain suitable ends capable of cohesion with the adjacent fragment. Neighboring fragments can be crosslinked using a DNA ligase or PCR based method. A nucleic acid encoding a biosensor can be isolated by any of many known methods.

[092] In addition, degenerate nucleic acid variants that encode the biosensor of the present invention are also provided. Degenerate nucleic acid variants include substitutions of nucleic acid codons with other codons encoding the same amino acids. In particular, degenerate nucleic acid variants are created to increase expression in the host cell. In this embodiment, nucleic acid codons that are not preferred or less preferred in the genes of the host cell are replaced by codons that are abundantly represented in the coding sequences of the genes in the host cell, where said replaced codons encode the same amino acid.

[093] Of particular interest are humanized versions of the nucleic acids of the present invention. As used herein, the term “humanized” refers to substitutions made in a nucleic acid sequence to optimize codons for protein expression in mammalian (human) cells (Yang et al., Nucleic Acids Research (1996) 24: 4592-4593). See also US Patent No. 5,795,737, which describes the humanization of proteins, the disclosure of which is incorporated herein by reference.

[094] In some embodiments, the nucleic acid molecule of the present invention is a DNA (or cDNA) molecule containing an open reading frame that encodes a biosensor of the present invention and is capable of being used under suitable conditions (eg, physiological intracellular conditions) for expression of a protein in a cell - the owner. The present invention also encompasses nucleic acids that are homologous, substantially similar, identical, or derived from nucleic acids encoding the proteins of the present invention. These nucleic acids are in an environment different from the environment in which they are found in vivo, for example, they are isolated, present in an increased amount, are or are expressed in vitro systems or in cells or organisms other than those in which they are found. in vivo.

[095] The claimed nucleic acids can be isolated and obtained essentially in purified form. Essentially purified form means that the nucleic acids are at least about 50% pure, usually at least about 90% pure and usually are “recombinant”, that is, flanked by one or more nucleotides to which it is not normally associated with a chromosome found naturally in its natural host organism.

[096] Changes or differences in the nucleotide sequence between highly similar nucleotide sequences can represent nucleotide substitutions in the sequence that occur during normal replication or duplication. Other substitutions can be specifically calculated and inserted into the sequence for specific purposes, such as changing the codons of certain amino acids or the nucleotide sequence of a regulatory region. Such special substitutions can be made in vitro using various mutagenesis technologies or obtained in host organisms under specific breeding conditions that induce or select these changes. Such specially prepared sequence variants may be called “mutants” or “derivatives” of the original sequence.

[097] Mutant or derivative nucleic acids can be obtained on a matrix nucleic acid selected from the above nucleic acids, by modifying, deleting or adding one or more nucleotides in the matrix sequence or a combination thereof, to obtain a variant of the matrix nucleic acid. Modifications, additions or deletions can be performed by any method known in the art (see, for example, Gustin et al., Biotechniques (1993) 14: 22; Barany, Gene (1985) 37: 111-123; and Colicelli et al., Mol. Gen. Genet. (1985) 199: 537-539, Sambrook et al., Molecular Cloning: A Laboratory Manual, (1989), CSH Press, p.15.3-15.108), including error prone PCR ), shuffling, oligonucleotide-directed mutagenesis, assembly PCR, pairwise PCR mutagenesis, in vivo mutagenesis, cassette mutagenesis, recursive multiple mutagenesis, exponential multiple mutagenesis, site-specific mutagenesis, random mutagenesis, gene re ssemblirovanie (gene reassembly), gene site saturation mutagenesis (GSSM), synthetic ligation rearrangement (SLR) or a combination thereof. Modifications, additions or deletions can also be carried out by a method including recombination, recursive recombination of sequences, phosphothioate-modified DNA mutagenesis, mutation on a uracil-containing matrix, double-pass mutagenesis, point-mutation reductive mutagenesis, strain mutagenesis, recovery-deficient mutagenesis, radioactive mutagenesis, deletion mutagenesis, restriction-selective mutagenesis, restriction mutagenesis with purification, synthesis of artificial enes, multiple mutagenesis, creation of multiple chimeric nucleic acids, and combinations thereof.

[098] Also provided are nucleic acids encoding chimeric proteins consisting of a biosensor of the present invention and a signal of a specific intracellular localization. Such chimeric proteins can be obtained by operatively combining a nucleic acid of the present invention encoding a biosensor and a nucleic acid encoding an intracellular localization signal. Methods for producing such nucleic acids are well known to those skilled in the art.

[099] A vector and other nucleic acid constructs containing the claimed nucleic acids are also provided. Suitable vectors include viral and non-viral vectors, plasmids, cosmids, phages, etc., preferably plasmids, and are used for cloning, amplification, expression, transfer, etc. the nucleic acid sequences of the present invention in a suitable host. The selection of a suitable vector is readily apparent to those skilled in the art, and many such commercially available vectors are known. To prepare the construct, a full-length nucleic acid or part thereof is usually inserted into the vector by attaching a DNA ligase to a restriction enzyme cleaved site in a vector. Alternatively, the desired nucleotide sequence can be inserted by in vivo homologous recombination, usually by attaching homologous regions to a vector on the flanks of the desired nucleotide sequence. Homologous regions are added by ligation of oligonucleotides or by polymerase chain reaction using primers including, for example, both homologous regions and part of the desired nucleotide sequence.

[0100] Also provided are expression cassettes or systems used to produce the claimed biosensors or chimeric proteins based thereon or to replicate the claimed nucleic acid molecules. The expression cassette may exist as an extrachromosomal element or may be incorporated into the genome of a cell as a result of introducing said expression cassette into the cell.

[0101] In the expression cassette, the specified nucleic acid is functionally linked to a regulatory sequence, which may include promoters, enhancers, terminators, operators, repressors and inducers and provides the initiation of RNA reading (transcription) in the host cell. In the expression cassette, the nucleic acid of the present invention may also be associated with transcription termination signals that are functional in the host cell. Methods for making expression cassettes or systems for expressing a desired product are known to those skilled in the art.

[0102] The above expression systems can be used in prokaryotic or eukaryotic hosts. Cell lines that stably express the proteins of the present invention can be selected by methods known in the art (e.g., co-transfection with a selectable marker, such as dhfr, gpt, neomycin, hygromycin, which makes it possible to identify and isolate transfected cells that contain gene included in the genome).

[0103] The protein product encoded by the nucleic acid of the invention can be obtained by expression in any convenient expression system, including, for example, bacterial systems, yeast systems, insect cells, amphibians, or mammalian cells. For example, host cells such as E. coli, B. subtilis can be used to produce protein. S. cerevisiae, insect cells in combination with baculovirus vectors, or cells of a higher organism such as vertebrates, for example, COS 7 cells, HEK 293, CHO, Xenopus oocytes, etc.

[0104] If any of the aforementioned host cells or other suitable host cells or organisms are used to replicate and / or express the nucleic acids of the invention, the resulting replicated nucleic acid, expressed protein or polypeptide is within the scope of the invention as a product of the host cell or organism . The product can be isolated by a suitable method known in the art.

[0105] Squirrels

[0106] The nucleic acid of the present invention encodes a fluorescence biosensor for detecting caspase 3 activity, the analytical signal of which is fluorescence in the far red spectrum. Specific biosensors of interest include biosensors having the amino acid sequences of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, the properties of which are described in detail in the experimental part below.

[0107] The claimed biosensor has detectable fluorescence ability, which can be detected by visual screening, spectrophotometry, spectrofluorimetry, fluorescence microscopy, using FACS or another conventional method for detecting fluorescence. The claimed biosensors upon excitation of a far-red fluorescent protein with light with a wavelength in the range of 550-620 nm have a maximum (peak) of fluorescence emission in the range from 630 nm to 680 nm, for example, 635 nm, 650 nm or 670 nm, and a peak of fluorescence emission corresponding to the iRFP protein due to FRET at 700-750 nm. The claimed biosensors upon excitation of the iRFP protein with light with a wavelength in the range of 670-690 nm have a maximum (peak) of fluorescence emission in the range of 700-750 nm. In preferred embodiments, the first fluorescence peak and the second fluorescence peak when excited with light with a wavelength of 550-620 nm and 670-690 nm can be measured using spectrophotometry, spectrofluorimetry, fluorescence microscopy, using FACS or other conventional method for recording fluorescence.

[0108] The claimed biosensor varies the fluorescence intensity in the range from 630 nm to 680 nm and in the range from 700 nm to 750 nm when excited with light with a wavelength of 550-620 nm, while the fluorescence intensity in the range from 700 nm to 750 nm when excited light with a wavelength of 670-690 remains unchanged. For the needs of the present invention, the biosensor signal is the ratio of the fluorescence intensity in the range from 630 nm to 680 nm and in the range from 700 nm to 750 nm when excited by light with a wavelength of 550-620 to the fluorescence intensity when excited with light with a wavelength of 670-690 nm. This parameter is independent of the biosensor concentration in the medium.

[0109] In preferred embodiments, when caspase 3 activity is present in the medium, the fluorescence intensity of the claimed biosensor in the range from 630 nm to 680 nm when excited by light with a wavelength of 550-620 nm increases due to the disappearance of energy transfer to the FRET acceptor iRFP protein, and the intensity the fluorescence of the claimed biosensor in the range from 700 nm to 750 nm when excited by light with a wavelength of 550-620 nm decreases. Thus, in the presence of caspase 3 activity in the medium, the analytical signal of the biosensor changes in the far-red region of the spectrum.

[110] The registration of the biosensor signal can be carried out using spectrophotometry, spectrofluorimetry, fluorescence microscopy, using FACS or other generally accepted method for recording fluorescence.

[0111] The claimed biosensor is capable of detecting the presence of caspase 3 activity in a medium, for example, inside cells. Determining the presence of caspase 3 activity inside the cells will make it possible to judge the entry of cells into apoptosis.

[0112] The ability of a biosensor to detect caspase 3 activity can be determined using an isolated recombinant biosensor protein obtained by genetic engineering, as described in Examples 1 and 2, by adding a purified active caspase 3 preparation to it, as described in Example 3. In this the caspase 3 system enzymatically hydrolyzes the linker containing the DEVD site, which leads to a change in the fluorescence of the biosensor compared to the fluorescence of the sample before the reaction.

[0113] The claimed biosensor is relatively small and consists of 600-700 amino acids, typically a biosensor length of 600-650 amino acids, for example, 612 amino acids (including the first methionine).

[0114] Functional biosensors are also provided that are substantially similar to the above biosensors, where substantially similar means that these proteins have an amino acid sequence identical to the sequence of SEQ ID NOs: 5, 6, or 7, at least 85% identities, usually at least 90% and more often, at least 95% (e.g. 95% or more; 96% or more, 97% or more; 98% or more: 99% or more or 100% identity sequence).

[0115] Mutants can be obtained using standard methods of molecular biology, as described in detail in the section "nucleic acid molecules" above. The examples provide general techniques and the use of standard methods, so that those skilled in the art can easily obtain a large number of additional mutants and check whether the biological (e.g., biochemical, spectral, etc.) property has been changed. For example, fluorescence intensity can be measured using a spectrofluorimeter at various excitation wavelengths.

[0116] The biosensors of the present invention are present in an environment different from their natural environment; for example, they are recombinant. The proteins of the present invention can be in an isolated state, which means that the proteins are substantially free of other proteins and other biological molecules present in the natural environment, such as oligosaccharides, nucleic acids and fragments thereof and the like, where the term "essentially free "in this case means that less than 70%, usually less than 60% and more often less than 50% of the composition containing the isolated protein, are some other biological molecules than those found in nature. In some embodiments, the proteins are present in a substantially purified form, where “substantially purified form” means purified at least 95%, usually at least 97%, and more often at least 99%.

[0117] The claimed biosensors can be obtained artificially, for example by expression of a recombinant nucleic acid encoding a sequence of a protein of interest in an appropriate host, as described above. For protein purification, any conventional methodology may be employed where suitable protein purification methods are described in Guide to Protein Purification, (Deuthser ed., Academic Press, 1990). For example, a lysate can be prepared from a source and purified using HPLC, size exclusion chromatography, gel electrophoresis, affinity chromatography, and the like.

[0118] Also provided are fusion proteins comprising the biosensor of the present invention fused to an intracellular localization sequence (for example, a localization signal in the nucleus, peroxisomes, Golgi apparatus, mitochondria, etc.). A polypeptide providing a certain intracellular localization can be operatively attached to the N-terminus and / or C-terminus of the biosensor. Signals of intracellular localization are well known to specialists in this field and are described, for example, by Nakai K. (Advances in Protein Chemistry, Vol. 54, 2000, p. 277-344).

Transformants

[0119] The nucleic acids of the present invention are used to obtain transformants, including transgenic organisms or site-specific gene changes in cell lines. The transgenic cells of the invention comprise one or more nucleic acids of the invention as a transgene. For the purposes of the invention, any suitable host cell can be used, including prokaryotic (e.g., Escherichia coli. Streptomyces sp., Bacillus subtilis, Lactobacillus acidophilus, etc.) or eukaryotic host cells. A transgenic organism of the invention may be a prokaryotic or eukaryotic organism, including bacteria, cyanobacteria, fungi, plants, and animals in which one or more cells of the body contain a heterogeneous nucleic acid of the invention, introduced by human intervention, by methods such as technologies transgenosis, which are known in the art.

[0120] The isolated nucleic acid of the present invention can be introduced into the host by methods known in the art, for example, infection, transfection, transformation or trans-conjugation. Methods for transferring a nucleic acid molecule (i.e., DNA) into such organisms are widely known and provided in references such as Sambrook et al. (Molecular Cloning: A Laboratory Manual, 3nd Ed., (2001) Cold Spring Harbor Press, Cold Spring Harbor, NY).

[0121] In one embodiment, the transgenic organism may be a prokaryotic organism. Methods for transforming prokaryotic hosts are well described in the art (e.g., see Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd edition (1989) Cold Spring Harbor Laboratory Press and Ausubel et al., Current Protocols in Molecular Biology (1995) John Wiley & Sons, Inc).

[0122] In another embodiment, the transgenic organisms may be fungi, for example, yeast. Yeast is widely used as a carrier for the expression of a heterogeneous gene (e.g. see Goodey et al Yeast biotechnology, DR Berry et al, eds, (1987) Alien and Unwin, London, p.401-429) and King et al Molecular and Cell Biology of Yeasts, EF Walton and GT Yarronton, eds, Blackie, Glasgow (1989), p.107-133). Several types of yeast vectors are available, including integrative vectors that require recombination with the host genome to support them, and autonomously replicating plasmid vectors.

[0123] In another embodiment, the transgenic organisms may be animals. Transgenic animals can be obtained by transgenic methods known in the art and are provided in references such as Pinkert, Transgenic Animal Technology: a Laboratory Handbook, 2nd edition (2203) San Diego: Academic Press; Gersenstein and Vintersten, Manipulating the Mouse Embryo: A Laboratory Manual, 3rd ed, (2002) Nagy A. (Ed), Cold Spring Harbor Laboratory; Blau et al., Laboratory Animal Medicine, 2nd Ed., (2002) Fox J.G., Anderson L.C., Loew P.M., Quimby F.W. (Eds), American Medical Association, American Psychological Association; Gene Targeting: A Practical Approach by Alexandra L. Joyner (Ed.) Oxford University Press; 2 nd edition (2000). For example, transgenic animals can be obtained by homologous recombination, where the endogenous locus changes. Alternatively, the nucleic acid construct is randomly incorporated into the genome. Vectors for sustainable incorporation include plasmids, retroviruses and other animal viruses, YAC, and the like. Nucleic acids can be introduced into a cell directly or indirectly, by introducing into a cell precursor, by intentional genetic manipulation, such as microinjection or infection with a recombinant virus or recombinant viral vector and the like. The term “genetic manipulation” does not include classical cross-fertilization or in vitro fertilization, but is preferably directed to the introduction of recombinant nucleic acid molecules. These nucleic acid molecules can be included in the chromosome or they can be extrachromosomal replicating DNA. DNA constructs for homologous recombination will contain at least a portion of the nucleic acid of the present invention, where the gene has the desired genetic modification (s) and includes homology regions with a target locus. DNA constructs for arbitrary incorporation do not necessarily contain a region of homology with a recombination mediator. Markers for positive and negative selection can easily be included. Methods for producing cells having targeted gene modifications through a homologous combination are known in the art. For various methods for transfecting mammalian cells, see Keown et al., Meth. Enzymol. (1990) 185: 527-537.

[0124] Transgenic animals can be any non-human animals, including a non-human mammal (eg, mouse, rat), bird or amphibian, etc., and are used in functional research, drug screening, and so on. .P.

[0125] Transgenic plants can also be obtained. Methods for producing transgenic plant cells and plants are described in US patent No. 5767367; 5,750,870; 5,739,409; 5,689,049; 5,689,045; 5,674,731; 5656466; 5,633,155; 5,629,470; 5,595,896; 5,576,198; 5,538,879; 5,484,956; disclosures of which are incorporated herein by reference. Methods for producing transgenic plants are also discussed in Plant Biochemistry and Molecular Biology (eds. Lea and Leegood, John Wiley & Sons) (1993) p. 275-295 and Plant Biotechnology and Transgenic Plants (eds. Oksman-Caldentey and Barz), ( 2002) 719 p. For example, embryogenic explants containing somatic cells can be used to produce a transgenic host. After collecting cells or tissues, exogenous DNA of interest is introduced into the plant cells, and a number of different methods are known for this introduction. In the presence of isolated protoplasts, it becomes possible to introduce through DNA-mediated gene transfer protocols, including incubating protoplasts with purified DNA, such as a plasmid containing the desired exogenous sequence of interest in the presence of polyvalent cations (eg, PEG or PLO); or electroporation of protoplasts in the presence of isolated DNA, including the target exogenous sequence. Protoplasts that successfully incorporate exogenous DNA are then selected, grown in callus, and ultimately in a transgenic plant in contact with suitable amounts and ratios of stimulatory factors such as auxins and cytokines. Other suitable plant production methods that are available to those skilled in the art can be used, such as using a “gene gun” or Agrobacterium-mediated transformation.

Application methods

[0126] The biosensors of the present invention are genetically encoded fluorescent proteins that change spectral properties in the presence of active caspase 3 in the medium. They can be used to register changes in caspase 3 activity within cells, for example, upon entry of cells into apoptosis, for example, under the influence of a chemotherapeutic agent.

[0127] For the implementation of the present application, a nucleic acid encoding a biosensor must be obtained. Obtaining such designs is obvious to any person skilled in the art. The resulting construct must be integrated into the expression cassette (or vector), providing temporary or permanent expression of this nucleic acid in the host cells. The expression vector or cassette may contain elements that provide targeted delivery of the construct to cells of interest, or is part of particles that provide targeted delivery. After transfection of the cells with the vector and after the time required for the expression product to develop in the cells, the change in caspase 3 activity inside the cells can be recorded.

[0128] The biosensors of the present invention can be stitched with signals of different intracellular localization to direct biosensors to specific cell compartments and register caspase 3 activity in these cell compartments.

[0129] The following examples are provided for illustrative purposes and should not limit the scope of the invention.

[0130]

EXAMPLES

Example 1. Obtaining variants of the biosensor.

[0131] Nucleic acid encoding an IRFP protein was obtained by PCR from the iRFP-pBAD plasmid, kindly provided by Dr. B. Verkhushey, using gene-specific primers and cloned into pQE-30 (Qiagen, Germany) by standard technology.

[0132] Nucleic acids encoding the fluorescent proteins mKate2, FP650 and NiRFP were amplified by PCR using gene-specific primers using mKate2-N, FP650-N, NiRFP-N plasmids as a template (Eurogen, Russia). Using primers during the PCR reaction at the 3 'ends of the cloned nucleic acid molecules, sequences coding for a linker containing the caspase 3 recognized DEVD sequence were added. The obtained nucleic acid fragments encoding red fluorescent proteins were cloned into a reading frame into a plasmid containing a nucleic acid encoding an IRFP protein.

[0133] For this, the corresponding mKate2, FP650 and NiRPP DNA fragments were amplified from gene-specific primers, where the reverse primers additionally contained a sequence encoding a caspase-cleavable 3 linker, and was purified by electrophoresis on a 1% agarose gel. The linker sequence corresponded to the sequence of caspase-cleavable 3 linker from the Casper3-BG plasmid (Eurogen, Russia). Amplification was performed on a RTS-100 Thermal Cycler device (MJ Reserch, Germany). Each reaction sample also contained primers (0.5 μM), an equimolar mixture of dNTP (0.5 μM), template DNA (10-100 ng), Tersus polymerase (Eurogen). To bring the mixture to the desired volume used sterile deionized water. Used the following amplification mode: denaturation 95 ° C -12 sec; annealing 65 ° С - 4 min; elongation 72 ° C - 1 min, 10 cycles of PCR. The construct was cloned into pQE-30 (Qiagen) by standard technology and used to transform E. coli cells.

[0134] Thus, the constructions mKate2-kasp-iRFP, FP650-kasp-iRFP, NiRFP-kasp-iRFP were created, where kasp is a linker containing a sequence recognized by caspase 3 (Fig. 1).

Example 2. Expression of biosensor variants and isolation of biosensor proteins of the invention.

[0135] For bacterial expression, E. coli strain BW25113 was used, co-expressing one of the expression plasmids mKate2-kasp-iRFP, FP650-kasp-iRFP, NiRFP-kasp-iRFP, obtained as described above, encoding the biosensor of the invention, and plasmid encoding heme oxygenase (pwa23-HO [Filonov GS, Piatkevich KD, Ting LM. Zhang J, Kirn K, Verkhusha W. Bright and stable near-infrared fluorescent protein for in vivo imaging. Nat Biotechnol. 2011 Jul 17; 29 ( 8): 757-61]).

[0136] E. coli BW25113 bacteria transformed according to the standard protocol were seeded onto Petri dishes containing LB agar medium with arabinose (150 mg / ml), ramnose (0.0024% by weight), kanamycin (0.1 mg / ml ), ampicillin (0.5 mg / ml) and the heme precursor, δ-aminolevulinic acid (0.2 mM).

[0137] Cups with transformants were incubated at 37 ° C for 24 hours

[0138] The protein was isolated from the biomass of bacteria collected from 5 Petri dishes using TALON (Clontech. USA), according to the manufacturer's standard protocol with elution in PBS-imidazole (0.25M).

Example 3. The change in the spectral characteristics of the biosensors mKate2-kasp-iRFP, FP650-kasp-iRFP, NiRFP-kasp-iRFP under the action of isolated caspase 3 in vitro.

[0139] The biosensors mKate2-kasp-iRFP, FP650-kasp-iRFP and NiRFP-kasp-iFP, the nucleic acids of which were obtained as described in Example 1, were isolated from bacteria, as described in Example 2, and used to test them sensitivity to caspase 3.

[0140] For this, the isolated protein in PBS imidazole was added to the spectrophotometric cell. The amount of protein in different samples was different, because the sensor signal should not depend on its concentration. Next, excitation and fluorescence emission spectra were taken:

[0141] For mKate2-kasp-iRFP: excitation spectrum at 740 nm emission, fluorescence emission spectra at 550 nm and 650 nm.

[0142] For FP650-kasp-iRFP: excitation spectrum at 740 nm emission, fluorescence emission spectra at 580 nm and 670 nm.

[0143] For NiRFP-kasp-iRFP: excitation spectrum at 740 nm emission, fluorescence emission spectra at 590 nm and 670 nm.

[0144] Next, the following reaction medium components were introduced into the system: 50 mM HEPES buffer (pH 7.5), 100 mM NaCl, 1 mM EDTA, 10% sucrose (mass / volume), 0.1% CHAPS, 10 mM DTT and caspase 3 were incubated for 1 hour at 37 ° C.

[0145] Caspase cleavage of the sensor was recorded by changing the types of excitation graphs at 740 nm emission (Fig. 2A, 2B, 2C) and fluorescence emission graphs at excitation 550, 580 and 590 nm, respectively, for each of the three sensors (Fig. 3A, 3B, 3B). Thus, we determined the dependence of the sensor signal (the ratio of the excitation intensities in the region of 588, 592, 605 nm, respectively, on the excitation spectrum before and after the reaction; the ratio of the fluorescence intensities in the region of 633, 650, 670 nm, respectively, and 710 nm in the spectrum fluorescence before and after the reaction) from the addition of caspase to the sensor.

For all three variants, a decrease in the excitation intensity was observed upon emission at 740 nm: in the region of 588, 592, 605 nm, respectively, which can be explained by a decrease in FRET due to the splitting of the sensor by caspase. For the fluorescence plot with excitation of 650, 670 and 670 nm, respectively, in the region of 740 nm, no changes were observed with the addition of caspase. After adding caspase upon excitation with light of 550, 580, and 590 nm, all three variants showed an increase in the fluorescence intensity in the region of 633, 650, 670 nm, with a simultaneous decrease in the fluorescence intensity in the region of 713 nm, which also indicates a decrease in FRET from donor to acceptor. The FP650-kasp-iRFP and NiRFP-kasp-iRFP variants after caspase treatment showed more significant changes than mKate2-kasp-IRFP.

All publications and patent applications cited in the present description, are introduced into the present description by reference, as if each individual publication or patent application was specifically and separately introduced by reference. The citation of any publication is in accordance with the context and interpretation of the present invention and should not be construed as recognition of any such publication as a prototype of the present invention.

SEQ ID NO: 1 Amino Acid Sequence of Far Red Fluorescent mKate Protein

prt

MVSELIKENMHMKLYMEGTV

NNHHFKCTSEGEGKPYEGTQ

TMRIKAVEGGPLPFAFDILA

TSFMYGSKTFINHTQGIPDF

FKQSFPEGFTWERVTTYEDG

GVLTATQDTSLQDGCLIYNV

KIRGVNFPSNGPVMQKKTLG

WEASTETLYPADGGLEGRAD

MALKLVGGGHLICNLKTTYR

SKKPAKNLKMPGVYYVDRRL

ERIKEADKETYVEQHEVAVA

RYCDLPSKLGHR

SEQ ID NO: 2 Amino Acid Sequence of Far-Red Fluorescent FP650 Protein

prt

MGEDSELISENMHMKLYMEG

TVNGHHFKCTSEGEGKPYEG

TQTAKIKVVEGGPLPFAFDI

LATSFMYGSKTFINHTQGIP

DFFKQSFPEGFTWERITTYE

DGGVLTATQDTSLQNGCLIY

NVKINGVNFPSNGPVMQKKT

LGWEASTEMLYPADSGLRGH

SQMALKLVGGGYLHCSLKTT

YRSKKPAKNLKMPGFYFVDR

KLERIKEADKETYVEQHEMA

VARYCDLPSKLGHS

SEQ ID NO: 3 Amino Acid Sequence of Far-Red Fluorescent FP670 Protein

prt

MGEDSELISENMHTKLYMEG

TVNGHHFKCTSEGEGKPYEG

TQTCKIKVVEGGPLPFAFDI

LATSFMYGSKTFINHTQGIP

DFFKQSFPEGFTWERITTYE

DGGVLTATQDTSLQNGCLIY

NVKINGVNFPSNGPVMQKKT

LGWEANTEMLYPADSGLRGH

NQMALKLVGGGYLHCSLKTT

YRSKKPAKNLKMPGFYFVDR

KLERIKEADKETYVEQHEMA

VARYCDLPSKLGHS

SEQ ID NO: 4 Amino Acid Sequence of iRFP Fluorescent Protein

prt

MASMTGGQQMGRDLYDDDDK

DPSSRSMTEGSVARQPDLLT

CDDEPIHIPGAIQPHGLLLA

LAADMTIVAGSDNLPELTGL

AIGALIGRSAADVFDSETHN

RLTIALAEPGAAVGAPITVG

FTMRKDAGFIGSWHRHDQLI

FLELEPPQRDVAEPQAFFRR

TNSAIRRLQAAETLESACAA

AAQEVRKITGFDRVMIYRFA

SDFSGEVIAEDRCAEVESKL

GLHYPASTVPAQARRLYTIN

PVRIIPDINYRPVPVTPDLN

PVTGRPIDLSFAILRSVSPV

HLEFMRNIGMHGTMSISILR

GERLWGLIVCHHRTPYYVDL

DGRQACELVAQVLAWQIGVM

Ee

SEQ ID NO: 5 Amino acid sequence of the mKate2-kasp-iRFP fluorescent biosensor

prt

MVSELIKENMHMKLYMEGTV

NNHHFKCTSEGEGKPYEGTQ

TMRIKAVEGGPLPFAFDILA

TSFMYGSKTFINHTQGIPDF

FKQSFPEGFTWERVTTYEDG

GVLTATQDTSLQDGCLIYNV

KIRGVNFPSNGPVMQKKTLG

WEASTETLYPADGGLEGRAD

MALKLVGGGHLICNLKTTYR

SKKPAKNLKMPGVYYVDRRL

ERIKEADKETYVEQHEVAVA

RYCDLPSKLGHRELGTEFGG

SGSDEVDKLGGSGSMASMTG

GQQMGRDLYDDDDKDPSSRS

MTEGSVARQPDLLTCDDEPI

HIPGAIQPHGLLLALAADMT

IVAGSDNLPELTGLAIGALI

GRSAADVFDSETHNRLTIAL

AEPGAAVGAPITVGFTMRKD

AGFIGSWHRHDQLIFLELEP

PQRDVAEPQAFFRRTNSAIR

RLQAAETLESACAAAAQEVR

KITGFDRVMIYRFASDFSGE

VIAEDRCAEVESKLGLHYPA

STVPAQARRLYTINPVRIIP

DINYRPVPVTPDLNPVTGRP

IDLSFAILRSVSPVHLEFMR

NIGMHGTMSISILRGERLWG

LIVCHHRTPYYVDLDGRQAC

ELVAQVLAWQIGVMEE

SEQ ID NO: 6 Amino Acid Sequence of FP650-kasp-iRFP Fluorescent Biosensor

prt

MGEDSELISENMHMKLYMEG

TVNGHHFKCTSEGEGKPYEG

TQTAKIKVVEGGPLPFAFDI

LATSFMYGSKTFINHTQGIP

DFFKQSFPEGFTWERITTYE

DGGVLTATQDTSLQNGCLIY

NVKINGVNFPSNGPVMQKKT

LGWEASTEMLYPADSGLRGH

SQMALKLVGGGYLHCSLKTT

YRSKKPAKNLKMPGFYFVDR

KLERIKEADKETYVEQHEMA

VARYCDLPSKLGHSELGTEF

GGSGSDEVDKLGGSGSMASM

TGGQQMGRDLYDDDDKDPSS

RSMTEGSVARQPDLLTCDDE

PIHIPGAIQPHGLLLALAAD

MTIVAGSDNLPELTGLAIGA

LIGRSAADVFDSETHNRLTI

ALAEPGAAVGAPITVGFTMR

KDAGFIGSWHRHDQLIFLEL

EPPQRDVAEPQAFFRRTNSA

IRRLQAAETLESACAAAAQE

VRKITGFDRVMIYRFASDFS

GEVIAEDRCAEVESKLGLHY

PASTVPAQARRLYTINPVRI

IPDINYRPVPVTPDLNPVTG

RPIDLSFAILRSVSPVHLEF

MRNIGMHGTMSISILRGERL

WGLIVCHHRTPYYVDLDGRQ

ACELVAQVLAWQIGVMEE

SEQ ID NO: 7 Amino Acid Sequence of NiRFP-kasp-iRFP Fluorescent Biosensor

prt

MGEDSELISENMHTKLYMEG

TVNGHHFKCTSEGEGKPYEG

TQTCKIKVVEGGPLPFAFDI

LATSFMYGSKTFINHTQGIP

DFFKQSFPEGFTWERITTYE

DGGVLTATQDTSLQNGCLIY

NVKINGVNFPSNGPVMQKKT

LGWEANTEMLYPADSGLRGH

NQMALKLVGGGYLHCSLKTT

YRSKKPAKNLKMPGFYFVDR

KLERIKEADKETYVEQHEMA

VARYCDLPSKLGHSELGTEF

GGSGSDEVDKLGGSGSMASM

TGGQQMGRDLYDDDDKDPSS

RSMTEGSVARQPDLLTCDDE

PIHIPGAIQPHGLLLALAAD

MTIVAGSDNLPELTGLAIGA

LIGRSAADVFDSETHNRLTI

ALAEPGAAVGAPITVGFTMR

KDAGFIGSWHRHDQLIFLEL

EPPQRDVAEPQAFFRRTNSA

IRRLQAAETLESACAAAAQE

VRKITGFDRVMIYRFASDFS

GEVIAEDRCAEVESKLGLHY

PASTVPAQARRLYTINPVRI

IPDINYRPVPVTPDLNPVTG

RPIDLSFAILRSVSPVHLEF

MRNIGMHGTMSISILRGERL

WGLIVCHHRTPYYVDLDGRQ

ACELVAQVLAWQIGVMEE

SEQ ID NO: 8 Aminoxyl sequence of a caspase cleavable linker

prt

EFGGSGSDEVDKLGGSGS

SEQ ID NO: 9 The nucleotide sequence of the mKate2-kasp-iRFP fluorescent biosensor

dna

atggtgagcgagctgattaaggagaacatgcacatgaagctgtacatggagggcaccgtg

aacaaccaccacttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccag

accatgagaatcaaggcggtcgagggcggccctctccccttcgccttcgacatcctggct

accagcttcatgtacggcagcaaaaccttcatcaaccacacccagggcatccccgacttc

tttaagcagtccttccccgagggcttcacatgggagagagtcaccacatacgaagacggg

ggcgtgctgaccgctacccaggacaccagcctccaggacggctgcctcatctacaacgtc

aagatcagaggggtgaacttcccatccaacggccctgtgatgcagaagaaaacactcggc

tgggaggcctccaccgagaccctgtaccccgctgacggcggcctggaaggcagagccgac

atggccctgaagctcgtgggcgggggccacctgatctgcaacttgaagaccacatacaga

tccaagaaacccgctaagaacctcaagatgcccggcgtctactatgtggacagaagactg

gaaagaatcaaggaggccgacaaagagacctacgtcgagcagcacgaggtggctgtggcc

agatactgcgacctccctagcaaactggggcacagagagctcggtaccgaattcggtggt

tctggttctgatgaagttgataagcttggtggttctggttctatggctagcatgactggt

ggacagcaaatgggtcgggatctgtacgacgatgacgataaggatccgagctcgagatct

atgacagaaggatccgtcgccaggcagcctgacctctttgacctgcgacgatgagccgatc

catatccccggtgccatccaaccgcatggactgctgctcgccctcgccgccgacatgacg

atcgttgccggcagcgacaaccttcccgaactcaccggactggcgatcggcgccctgatc

ggccgctctgcggccgatgtcttcgactcggagacgcacaaccgtctgacgatcgccttg

gccgagcccggggcggccgtcggagcaccgatcactgtcggcttcacgatgcgaaaggac

gcaggcttcatcggctcctggcatcgccatgatcagctcatcttcctcgagctcgagcct

ccccagcgggacgtcgccgagccgcaggcgttcttccgccgcaccaacagcgccatccgc

cgcctgcaggccgccgaaaccttggaaagcgcctgcgccgccgcggcgcaagaggtgcgg

aagattaccggcttcgatcgggtgatgatctatcgcttcgcctccgacttcagcggcgaa

gtgatcgcagaggatcggtgcgccgaggtcgagtcaaaactaggcctgcactatcctgcc

tcaaccgtgccggcgcaggcccgtcggctctataccatcaacccggtacggatcattccc

gatatcaattatcggccggtgccggtcaccccagacctcaatccggtcaccgggcggccg

attgatcttagcttcgccatcctgcgcagcgtctcgcccgtccatctggaattcatgcgc

aacataggcatgcacggcacgatgtcgatctcgattttgcgcggcgagcgactgtgggga

ttgatcgtttgccatcaccgaacgccgtactacgtcgatctcgatggccgccaagcctgc

gagctagtcgcccaggttctggcctggcagatcggcgtgatggaagag

SEQ ID NO: 10 FP650-kasp-iRFP Fluorescent Biosensor Nucleotide Sequence

dna

atgggagaggatagcgagctgatctccgagaacatgcacatgaaactgtacatggagggc

accgtgaacggccaccacttcaagtgcacatccgagggcgaaggcaagccctacgagggc

acccagaccgctaagatcaaggtggtcgagggcggccctctccccttcgccttcgacatc

ctggctaccagcttcatgtacggcagcaaaacctttatcaaccacacccagggcatcccc

gacttctttaagcagtccttccctgagggcttcacatgggagaggatcaccacatacgaa

gacgggggcgtgctgaccgctacccaggacaccagcctccagaacggctgcctcatctac

aacgtcaagatcaacggggtgaacttcccatccaacggccccctgtgatgcagaagaaaaca

ctcggctgggaggccagcaccgagatgctgtaccccgctgacagcggcctgagaggccat

agtcagatggccctgaagctcgtgggcgggggctacctgcactgctccctcaagaccaca

tacagatccaagaaacccgctaagaacctcaagatgcccggcttctacttcgtggacagg

aaactggaaagaatcaaggaggccgacaaagagacctacgtcgagcagcacgagatggct

gtggccaggtactgcgacctgcctagcaaactggggcacagcgagctcggtaccgaattc

ggtggttctggttctgatgaagttgataagcttggtggttctggttctatggctagcatg

actggtggacagcaaatgggtcgggatctgtacgacgatgacgataaggatccgagctcg

agatctatgacagaaggatccgtcgccaggcagcctgacctcttgacctgcgacgatgag

ccgatccatatccccggggtgccatccaaccgcatggactgctgctcgccctcgccgccgac

atgacgatcgttgccggcagcgacaaccttcccgaactcaccggactggcgatcggcgcc

ctgatcggccgctctgcggccgatgtcttcgactcggagacgcacaaccgtctgacgatc

gccttggccgagcccggggcggccgtcggagcaccgatcactgtcggcttcacgatgcga

aaggacgcaggcttcatcggctcctggcatcgccatgatcagctcatcttcctcgagctc

gagcctccccagcgggacgtcgccgagccgcaggcgttcttccgccgcaccaacagcgcc

atccgccgcctgcaggccgccgaaaccttggaaagcgcctgcgccgccgcggcgcaagag

gtgcggaagattaccggcttcgatcgggtgatgatctatcgcttcgcctccgacttcagc

ggcgaagtgatcgcagaggatcggtgcgccgaggtcgagtcaaaactaggcctgcactat

cctgcctcaaccgtgccggcgcaggcccgtcggctctataccatcaacccggtacggatc

attcccgatatcaattatcggccggtgccggtcaccccagacctcaatccggtcaccggg

cggccgattgatcttagcttcgccatcctgcgcagcgtctcgcccgtccatctggaattc

atgcgcaacataggcatgcacggcacgatgtcgatctcgattttgcgcggcgagcgactg

tggggattgatcgtttgccatcaccgaacgccgtactacgtcgatctcgatggccgccaa

gcctgcgagctagtcgcccaggttctggcctggcagatcggcgtgatggaagag

SEQ ID NO: 11 The nucleotide sequence of the fluorescent biosensor NiRFP-kasp-iRFP

dna

atgggagaggatagcgagctgatctccgagaacatgcacacgaaactgtacatggagggc

accgtgaacggccaccacttcaagtgcacatccgagggcgaaggcaagccctacgagggc

acccagacctgtaagatcaaggtggtcgagggcggccctctccccttcgccttcgacatc

ctggctaccagcttcatgtacggcagcaaaacctttatcaaccacacccagggcatcccc

gacttctttaagcagtccttccctgagggcttcacatgggagaggatcaccacatacgaa

gacgggggcgtgctgaccgctacccaggacaccagcctccagaacggctgcctcatctac

aacgtcaagatcaacggggtgaacttcccatccaacggccccctgtgatgcagaagaaaaca

ctcggctgggaggccaacaccgagatgctgtaccccgctgacagcggtctgagaggccat

aatcagatggccctgaagctcgtgggcgggggctacctgcactgctccctcaagaccaca

tacagatccaagaaacccgctaagaacctcaagatgcccggcttctacttcgtggaccgt

aaactggaaagaatcaaggaggccgacaaagagacctacgtcgagcagcacgagatggct

gtggccaggtactgcgacctgcctagcaaactggggcacagcgagctcggtaccgaattc

ggtggttctggttctgatgaagttgataagcttggtggttctggttctatggctagcatg

actggtggacagcaaatgggtcgggatctgtacgacgatgacgataaggatccgagctcg

agatctatgacagaaggatccgtcgccaggcagcctgacctcttgacctgcgacgatgag

ccgatccatatccccggggtgccatccaaccgcatggactgctgctcgccctcgccgccgac

atgacgatcgttgccggcagcgacaaccttcccgaactcaccggactggcgatcggcgcc

ctgatcggccgctctgcggccgatgtcttcgactcggagacgcacaaccgtctgacgatc

gccttggccgagcccggggcggccgtcggagcaccgatcactgtcggcttcacgatgcga

aaggacgcaggcttcatcggctcctggcatcgccatgatcagctcatcttcctcgagctc

gagcctccccagcgggacgtcgccgagccgcaggcgttcttccgccgcaccaacagcgcc

atccgccgcctgcaggccgccgaaaccttggaaagcgcctgcgccgccgcggcgcaagag

gtgcggaagattaccggcttcgatcgggtgatgatctatcgcttcgcctccgacttcagc

ggcgaagtgatcgcagaggatcggtgcgccgaggtcgagtcaaaactaggcctgcactat

cctgcctcaaccgtgccggcgcaggcccgtcggctctataccatcaacccggtacggatc

attcccgatatcaattatcggccggtgccggtcaccccagacctcaatccggtcaccggg

cggccgattgatcttagcttcgccatcctgcgcagcgtctcgcccgtccatctggaattc

atgcgcaacataggcatgcacggcacgatgtcgatctcgattttgcgcggcgagcgactg

tggggattgatcgtttgccatcaccgaacgccgtactacgtcgatctcgatggccgccaa

gcctgcgagctagtcgcccaggttctggcctggcagatcggcgtgatggaagag

Claims (1)

 A nucleic acid encoding a FRET-based far-red fluorescence biosensor for measuring caspase 3 activity inside cells, where the analytical signal of the fluorescence biosensor is fluorescence in the far-red region of the spectrum and the iRFP protein acts as an acceptor, and the far-red is the donor a fluorescent protein of the GFP family, where the amino acid sequence of the far-red fluorescent biosensor is selected from the group of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7.

Images