JP5570803B2 - Fluorescent protein and pH measurement method - Google Patents

Description

  TECHNICAL FIELD The present invention relates to a fluorescent protein obtained by gene cloning from an organism belonging to the family Cnidaria phylumenidae, and particularly to a cactus, and a mutant thereof, and a method for measuring cell function using them.

  A gene encoding green fluorescent protein GFP (Green Fluorescent Protein) was cloned from Aequorea victoria, and it was confirmed that the recombinant GFP was expressed in Escherichia coli and mammalian cells. As a result, it is recognized that such recombinant GFP does not require a special cofactor for the formation of a fluorescent chromophore of GFP, and can be used in cells of all kinds, and protein localization and gene expression can be performed in vivo, It has come to be used as an epoch-making tool for monitoring in situ and in real time. Furthermore, it is also used at the individual level and can be observed in a noninvasive manner.

  GFP derived from Aequorea jellyfish is a 27 kD protein consisting of 238 amino acids that forms a chromophore and emits fluorescence. Wild-type GFP (wtGFP) is a protein having an excitation maximum wavelength at 395 nm in ultraviolet light (minor peak at 470 nm) and emitting green fluorescence at 509 nm. The chromophore is formed by the 64th to 69th sequence (particularly the 65th to 67th sequence) in the amino acid sequence.

  In addition, mutants of GFP protein have also been produced. Among them, the S65T mutant in which the 65th serine is substituted with threonine has an excitation maximum wavelength shifted to 490 nm and a longer wavelength side, and emits fluorescence several times stronger than wtGFP. . Since then, various GFP proteins have been modified, and so far, many mutants with brighter fluorescence, protein stability, and a device for improving solubility have been prepared.

  Clontech's EGFP (Enhanced Green Fluorescent Protein) is based on the amino acid substitution of chromophores (P64L, S65T, etc.), and the nucleotide sequence according to the frequency of human codon usage for the purpose of improving the translation efficiency in cells and plants. Has been optimized, and more than 190 mutations have been introduced as base sequences. In addition, fluorescent color variants EBFP (Blue) (Y66H amino acid substitution, etc.), ECFP (Cyan) (Y66W amino acid substitution, etc.) and EYFP (Yellow) (T203Y amino acid substitution, etc.) In addition to optimization of the combined base sequence, it is available from the company as a mutant that can be observed with a fluorescent color different from that of EGFP.

  In addition, in recent years, biological species having a GFP-like fluorescent protein have been discovered in addition to Aequorea jellyfish, and shifted from such biological species to a longer wavelength side than any of the GFP mutants produced so far. A fluorescent protein gene that emits fluorescence (red fluorescent color) has been cloned and used. DsRed is a protein of 26 kD consisting of 225 amino acids, derived from Discosoma striata, and is a protein that fluoresces itself like the jellyfish GFP. The acquisition of DsRed made it possible to use red fluorescence (excitation maximum wavelength 558 nm, fluorescence wavelength 583 nm), which was not obtained with the derivatives of Aequorea GFP.

  One characteristic of fluorescent proteins is pH sensitivity (pKa). pKa is equal to the pH value when the fluorescence intensity shows a value of 50% of the maximum value. Most GPFs are sensitive to pH (protons) and the fluorescence intensity decreases rapidly under acidic conditions. Wild-type GFP can observe fluorescence in the range of pH 5.5 to 12, but rapidly loses fluorescence below pH 5.5. Inactivation of fluorescent activity on the acidic side can be thought of as a decrease in absorbance due to protons (molar extinction coefficient) and a decrease in quantum yield, but various pH sensitivities can be achieved by subjecting GFP to artificial amino acid mutations. Modified types have been developed.

  When imaging is performed in the vicinity of neutrality, GFP having a pKa of 6 or less is generally used in order to prevent the influence of a change in fluorescence amount due to a change in intracellular pH. When imaging acidic organelles such as Golgi bodies and secretory vesicles, quantitative measurement cannot be performed without using a modified GFP with a lower pKa. GFPuv and ECFP (Clontech) are often used as pH insensitive GFP with low pKa.

  On the other hand, GFP can be used as a pH sensor due to pH sensitivity. Since GFP is a protein, unlike pH indicators (BCECF, SNARF, etc.) consisting of low molecular weight organic compounds, it can be fused with a transition signal peptide, etc., and can be localized in intracellular organelles. . Therefore, in addition to the cytoplasm and nucleus, the pH dynamics in intracellular organelles such as the Golgi apparatus, endoplasmic reticulum, mitochondria, etc. have been investigated using modified GFP exhibiting various pKa.

  For example, in Non-Patent Document 1, mitochondrial transition signal (coxIV; cytochrome oxidase subunit IV) or Golgi transition signal (GT) is fused to each of EGFP and EYFP, which have pH-dependent fluorescence activity on the alkaline side. The introduced vector is introduced into HeLa cells to express the fusion protein, and changes in fluorescence intensity of EGFP and EYFP localized in the mitochondria or Golgi apparatus are captured as changes in pH in response to various stimuli. In addition, using GT-EYFP and GT-CFP in which GT is fused to ECFP with little change in fluorescence intensity due to pH, changes in pH in the Golgi apparatus are also measured by the ratio of the fluorescence intensity of GT-EYFP and GT-ECFP. doing.

  Also, in Non-Patent Document 2, by modifying GFP derived from Aequorea jellyfish, GFP whose excitation spectrum changes depending on pH is prepared, fluorescence intensity of one wavelength by two-wavelength excitation is measured, and excitation is performed at each wavelength. Intracellular pH is measured from the ratio of fluorescence intensity. However, the fluorescence spectrum of GFP does not change with pH.

  In such a conventional fluorescent protein, in order to measure the pH change of intracellular and intracellular organelles using pH sensitivity, excitation is performed at one wavelength and the fluorescence intensity at one wavelength is monitored. In this method, since changes in pH are regarded as changes in fluorescence intensity, it is difficult to compare numerical data in different experimental systems.

  Further, the conventional fluorescent protein having pH sensitivity has fluorescence activity on the alkaline side, and the fluorescence intensity on the acidic side is extremely low. Therefore, it is difficult to cover a wide range from the acidic side to the alkaline side, and there is a problem in measuring accurately on the acidic side.

  Furthermore, as is done in Non-Patent Document 1, two types of fluorescent proteins with different pH sensitivities can be used to determine the pH from the ratio of the respective fluorescence intensities. Since the strength is low, taking the ratio does not significantly improve the accuracy on the acidic side.

Llopis et al (1998) Proc. Natl. Acad. Sci. USA 95: 6803-6808. Miesenbock et al (1998) Nature 394: 192-195.

  An object of the present invention is to provide a fluorescent protein exhibiting sufficient fluorescent activity not only on the alkaline side but also on the acidic side, and a highly accurate measurement method of cell function using the fluorescent protein.

  According to an embodiment of the present invention, fluorescent proteins derived from organisms belonging to the cnidarian genus Coleoptera Uridae, which have fluorescent activities having different fluorescence peak wavelengths in an alkaline environment and an acidic environment, respectively. Provided.

  In addition, a method for introducing such a fluorescent protein into a subject and measuring the pH inside the subject based on the fluorescence emitted from the fluorescent protein is provided.

  According to the present invention, a cnidarial flower that has two types of fluorescence characteristics in one type of fluorescent protein, that is, a fluorescence characteristic exhibiting pH dependence on the alkaline side and a fluorescence characteristic exhibiting pH dependence on the acidic side. Provided is a fluorescent protein derived from an organism belonging to the order of the genus Clevisidae (for example, Cactus), and further provides a highly accurate pH measurement method for intracellular and intracellular organelles using such a fluorescent protein. Is done. Here, these two types of fluorescence characteristics have different fluorescence wavelengths.

  By using fluorescent proteins having opposite pH characteristics, two-wavelength excitation two-wavelength fluorescence or one-wavelength excitation two-wavelength fluorescence can be measured, and a change in pH is measured as a relative fluorescence intensity ratio. It becomes possible. Therefore, the absolute difference in fluorescence intensity under different experimental conditions can be canceled and various data can be compared with each other. Moreover, by having fluorescence activity on both the alkaline side and the acidic side, the pH can be measured over a wide range, and the measurement accuracy on the acidic side can be ensured.

  In addition, the cactus-derived fluorescent protein having such properties forms a multimer in the wild-type state, but artificially amino acid substitution to form a monomer allows for intracellular aggregation and cell formation. Mutants with reduced restriction on inward movement are provided.

  Furthermore, although the wild type cactus-derived fluorescent protein has the highest formation of a fluorescent chromophore at around 25 ° C., it can be artificially subjected to amino acid substitution to a temperature suitable for culturing mammalian cells (eg, around 37 ° C.). In which the formation of a fluorescent chromophore is optimized and a strong fluorescent variant is provided.

The amino acid sequence and base sequence of the cactus fluorescent protein obtained by gene cloning. Fluorescence spectrum of sea cactus fluorescent protein under a pH 5, 7, and 9 environment when excited at 388 nm (horizontal axis: wavelength (nm), vertical axis: fluorescence intensity (arbitrary unit)). Fluorescence spectrum of sea cactus fluorescent protein under a pH 5, 7, and 9 environment when excited at 450 nm (horizontal axis: wavelength (nm), vertical axis: fluorescence intensity (arbitrary unit)). Absorption spectrum of sea cactus fluorescent protein under pH 5, 7 and 9 environment (horizontal axis: wavelength (nm), vertical axis: absorbance (arbitrary unit)). PH sensitivity (abscissa: pH, ordinate: fluorescence intensity (arbitrary unit)) of fluorescence at the 458 nm peak (excitation at 388 nm) and fluorescence at the 507 nm peak (excitation at 450 nm) of the cactus fluorescent protein. PH sensitivity (abscissa: pH, ordinate: absorbance) in absorption of the 388 nm peak and 450 nm peak of the cactus fluorescent protein. Fluorescence intensity ratio of 458 nm fluorescence (388 nm excitation) and 507 nm fluorescence (450 nm excitation) of the cactus fluorescent protein at each pH (horizontal axis: pH, vertical axis: fluorescence intensity ratio). Fluorescence intensity ratio (abscissa: pH, ordinate: fluorescence intensity ratio) of 458 nm fluorescence and 507 nm fluorescence (both excited at 388 nm) of the cactus fluorescent protein at each pH. The figure which compared the association state of wild type fluorescent protein and mutant fluorescent protein (154th cysteine is substituted with serine) by SDS-PAGE. The figure which shows the fluorescence when a mutant fluorescent protein (stabilized at 37 degreeC) is expressed in colon_bacillus | E._coli. The analysis result by the gel filtration method of the association state of wild type fluorescent protein and mutant fluorescent protein (stabilized at 37 degreeC). Bright field image (a), fluorescence image (b) at pH = 7 and fluorescence image (c) at pH = 4, and fluorescence spectra (d) of b and c, of U2OS cells expressing the cactus fluorescent protein. The fluorescence image which shows the state by which the colon_bacillus | E._coli which expressed the cactus fluorescent protein is phagocytosed by the RAW cell. The table | surface which shows the fluorescence spectrum and fluorescence intensity ratio of the cactus fluorescent protein before and behind being phagocytosed by a RAW cell.

<Fluorescent protein>
The present invention relates to a fluorescent protein derived from an organism belonging to the cnidarian genus Coleoptera Uridae, which has fluorescent activities with different fluorescence peak wavelengths in an alkaline environment and an acidic environment.

  That is, the fluorescent protein of the present invention emits fluorescence in an environment with any pH of pH> 7, and further has a fluorescence with a wavelength different from the wavelength of the fluorescence even in an environment with any pH of pH <7. Can be issued. For this reason, the fluorescent protein of the present invention can be used as an indicator of pH in the environment. In particular, since the fluorescent protein of the present invention can generate fluorescence with sufficient intensity even in an acidic environment, it is a highly accurate pH index compared to conventional fluorescent proteins.

  In addition, the fluorescent protein of the present invention is derived from an organism belonging to the genus Cleoptera: Hymenoptera Umiellae. For example, it is derived from Cavernularia obesa (Japanese name: Cypridina) belonging to the family Clematozoa phytoseiidae. Therefore, even if the organism has not yet been classified or has not yet been discovered, it is later considered to belong to the cnidarian genus Coleoptera Umiellaceae, and the fluorescent protein obtained from it belongs to the above two types. If it has peak fluorescent activity, it is included in the present invention. As used herein, “derived from” means that in addition to a wild-type fluorescent protein possessed by an organism belonging to the family Cleoptera: Hymenoptera Umiellae, the mutant is also included.

  A preferred example of the fluorescent protein of the present invention is a fluorescent protein comprising the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6. A preferred example of the fluorescent protein of the present invention is a fluorescent protein containing an amino acid sequence containing a mutation in the amino acid sequence represented by these SEQ ID NOs.

<Wild type>
FIG. 1 shows an amino acid sequence (SEQ ID NO: 1) and a base sequence (SEQ ID NO: 2) of an example of such a fluorescent protein. The gene for this fluorescent protein was cloned from Caberularia obesa. In addition, the fluorescent protein usually forms a dimer in the cell.

  2a and 2b show the fluorescence spectra of the fluorescent proteins whose amino acid sequences are shown in FIG. FIG. 2a is a fluorescence spectrum when the fluorescent protein is excited by light having a wavelength of 388 nm in an environment of pH 5, 7, and 9. FIG. In this case, the peak near 458 nm increases as the pH is shifted from 9 to 5. In particular, at pH 5, although a peak near 506 nm remains, a peak at 458 nm is generated with a stronger intensity. On the other hand, FIG. 2b is a fluorescence spectrum when the fluorescent protein is excited by light having a wavelength of 450 nm in an environment of pH 5, 7, and 9. In this case, the peak around 506 nm increases as the pH is shifted from 5 to 9. In particular, at pH 9, a single peak occurs around 506 nm. From these facts, it can be seen that the fluorescent protein emits fluorescence having a maximum peak near 458 nm on the acidic side and emits fluorescence having a peak near 506 nm on the alkaline side.

  FIG. 3 shows the absorption spectrum of the fluorescent protein whose amino acid sequence is shown in FIG. 1 under the pH 5, 7, and 9 environment. From this figure, it can be seen that the fluorescent protein has a main absorption peak at around 498 nm at pH 7 and 9, and has a maximum absorption peak at around 388 nm at pH 5 and also has an absorption peak at around 498 nm.

  4 and 5 show the pH sensitivity of fluorescence and absorption of the fluorescent protein whose amino acid sequence is shown in FIG.

  FIG. 4 shows the relationship between the change in pH and the change in fluorescence intensity near 458 nm or 507 nm, with the horizontal axis representing pH and the vertical axis representing fluorescence intensity. The fluorescence intensity near 458 nm was measured using excitation light near 388 nm, and the fluorescence intensity near 507 nm was measured using the fluorescence intensity near 450 nm. From this figure, it can be seen that the fluorescence peak near 507 nm has activity on the alkaline side and the fluorescence peak near 458 nm has activity on the acidic side. At this time, the pKa at the fluorescence peak near 507 nm (that is, the pH at which the fluorescence intensity becomes 50% of the maximum value) is 6.5, and the pKa at the fluorescence peak near 458 nm is 6.0. That is, the fluorescence near 507 nm exhibits a fluorescence intensity exceeding 50% of the maximum value on the alkaline side of pH 6.5, while the fluorescence near 458 nm exhibits 50% of the maximum value on the acidic side of pH 6.0. Exceeds fluorescent intensity. This shows that these fluorescence intensity peaks are separated appropriately.

  FIG. 5 shows the relationship between the change in pH and the change in absorption of excitation light near 388 nm or 498 nm, with the horizontal axis representing pH and the vertical axis representing absorbance. From this figure, it can be seen that the excitation light near 498 nm is absorbed on the alkaline side, and the excitation light near 388 nm is absorbed on the acidic side.

  6 and 7 show the ratio of the fluorescence intensity near 458 nm to the fluorescence intensity near 507 nm at each pH. FIG. 6 shows a case where two excitation lights are used, that is, fluorescence near 458 nm is detected using excitation light around 388 nm and fluorescence near 507 nm is detected using excitation light around 450 nm. On the other hand, FIG. 7 shows a case where one excitation light is used, that is, fluorescence near 458 nm and 507 nm is detected using excitation light near 388 nm. When two excitation lights are used (FIG. 6), it can be seen that the ratio of 507 nm / 458 nm increases on the alkaline side and the ratio of 458 nm / 507 nm increases on the acidic side around pH 6. On the other hand, when one excitation light is used (FIG. 7), it can be seen that the ratio of 506 nm / 458 nm increases on the alkaline side and the ratio of 458 nm / 506 nm increases on the acidic side around pH 5.5.

  In general, when the fluorescence activity of a fluorescent protein is measured in an independent experimental system, the value of the detected fluorescence intensity may vary even if the measurement conditions are the same as much as possible. For example, the absolute value of the detected fluorescence intensity varies depending on the state of the excitation light source used. Further, the background may rise or fall depending on the state of the cell to be measured and the state of the culture solution. In such a case, it is not appropriate to directly compare the fluorescence intensity values obtained from these experimental systems. On the other hand, if two fluorescence intensities are acquired in a single experimental system and the ratio is obtained, fluctuations in the value of the fluorescence intensity can be canceled, and the ratio obtained under the same conditions is It is considered to be almost constant between experimental systems. In this regard, the graphs shown in FIGS. 6 and 7 can be used as a calibration curve for the fluorescence intensity ratio.

<Variants>
In addition, the fluorescent protein of the present invention may be various mutants of wild-type sea cactus fluorescent protein. The mutant may be any mutant as long as it maintains the characteristics of having fluorescence activities with different fluorescence peak wavelengths in an alkaline environment and an acidic environment. Here, the mutant refers to a fluorescent protein in which a mutation (for example, amino acid substitution, deletion and / or addition, etc.) has occurred in the amino acid sequence of the wild-type fluorescent protein. This mutation is a mutation of one or more amino acids in the amino acid sequence of the wild-type fluorescent protein, preferably a mutation of 1 to 20 amino acids in the amino acid sequence of the wild-type fluorescent protein, a mutation of 1 to 15 amino acids, From 1 to 10 amino acid mutations or from 1 to 5 amino acid mutations. Preferably, the amino acid sequence of the mutant is 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more with respect to the amino acid sequence of the wild-type fluorescent protein, It has 98% or more or 99% or more homology.

  Moreover, the fluorescent protein of the present invention includes a mutant in which characteristics other than the bimodal fluorescent activity are changed as described above. In particular, such a mutation is preferably a mutation that improves operability as a fluorescent protein.

  For example, the fluorescent protein of the present invention includes mutants that can emit fluorescence with higher intensity than the wild type. This mutant can provide sufficient fluorescence intensity even when a measurement system with low sensitivity is used or when measurement is performed on cells with weak protein expression. Such a mutant can be obtained by using a conventional method in the art. For example, after a mutation is randomly introduced into a nucleic acid encoding a wild-type fluorescent protein, it is expressed in Escherichia coli or the like. It can be obtained by irradiating excitation light and selecting a strain that emits fluorescence stronger than a strain that expresses wild-type fluorescent protein. An example of such a variant is a fluorescent protein having the amino acid sequence shown in SEQ ID NO: 3. This fluorescent protein is obtained by replacing cysteine at the 154 locus in the amino acid sequence shown in FIG. 1 with arginine. Although this fluorescent protein maintains the property of forming a dimer, the fluorescence intensity is improved as compared with the wild type.

  Moreover, the fluorescent protein of the present invention includes mutants that can exist as monomers in cells. When the fluorescent protein forms a dimer, aggregation may occur in the cell or movement within the cell may be inhibited. Such a problem can be avoided by monomerization. In particular, when another protein is fused to the fluorescent protein, the influence on the original function of the other protein can be minimized. Such a monomerized mutant is randomly monomerized and loses fluorescent activity from a library containing such candidate mutants after introducing mutations randomly into the gene of the wild-type fluorescent protein. It can be obtained by screening what is not. Alternatively, it can be obtained by mutating an amino acid that is likely to contribute to dimer formation of a fluorescent protein, and then confirming that it has been monomerized and has not lost its fluorescent activity. An example of such a monomerized variant is a fluorescent protein having the amino acid sequence shown in SEQ ID NO: 4. The fluorescent protein is a protein in which cysteine at the 154 position in the amino acid sequence shown in FIG. 1 is substituted with serine. As shown in FIG. 8, this fluorescent protein does not form a dimer and exists as a monomer (the right lane is the band of the mutant and dimer disappears).

  In addition, the fluorescent protein of the present invention includes mutants having high stability under specific conditions. Such proteins include, for example, mutants with high formation efficiency of fluorescent chromophores at a temperature suitable for culturing cells to be measured. Since wild-type fluorescent proteins are derived from the family Cactaceae, the fluorescent proteins are likely to be most stable in the living environment of the organism. When conditions such as temperature in the living environment are significantly different from experimental conditions, the stability of the fluorescent protein may be impaired. Therefore, obtaining a highly stable fluorescent protein mutant, particularly under the conditions used in the experiment, is advantageous in performing highly accurate measurement. Such a mutant is obtained by randomly mutating a wild type whose amino acid sequence is shown in FIG. 1 or a monomerized mutant having the amino acid sequence shown in SEQ ID NO: 4 They can be obtained by expressing them in Escherichia coli and selecting mutants that exhibit the desired stability under specific conditions.

  A more specific example of such a mutant is a mutant having a higher fluorescence intensity than a wild-type fluorescent protein at a temperature suitable for culturing mammalian cells (for example, around 37 ° C.). An example of this is a fluorescent protein having the amino acid sequence shown in SEQ ID NO: 5. In the fluorescent protein, asparagine at the 126th locus in the amino acid sequence shown in FIG. 1 is substituted with tyrosine, cysteine at the 154th locus is substituted with serine, and tyrosine at the 166th locus is substituted with phenylalanine. Another example is a fluorescent protein having the amino acid sequence represented by SEQ ID NO: 6. In the fluorescent protein, serine at the 129 locus in the amino acid sequence shown in FIG. 1 is substituted with glycine, cysteine at the 154 locus is substituted with serine, aspartic acid at the 156 locus is substituted with glycine, and lysine at the 204 locus is isoleucine. And asparagine at the 209 locus is substituted with tyrosine. These two mutants exist as monomers because they contain a mutation in which cysteine at the 154 locus is substituted with serine as in the monomerized mutant described above.

<Nucleic acid>
The present invention further relates to a nucleic acid comprising a base sequence encoding a wild-type fluorescent protein or a mutant fluorescent protein as described above. Such a base sequence may be a base sequence derived from an organism belonging to the family Cnidaria genus Coleoptera Umiellae. “Derived” in this context means that in addition to the wild-type base sequence originally possessed by organisms belonging to the genus Coleoptera, Hymenoptera, Cactaceae, it also includes a base sequence in which a mutation has occurred. . The mutation herein refers to substitution, deletion and / or addition of a specific base in the base sequence. The nucleotide sequence mutation includes a mutation that does not cause a change in the encoded amino acid sequence. The nucleic acid particularly refers to DNA or RNA.

  Preferred examples of the nucleic acid of the present invention include a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 2 encoding a wild-type fluorescent protein derived from sea cactus, and a SEQ ID NO: encoding a variant (C154R) having an increased fluorescence intensity as compared to the wild-type protein. A nucleic acid comprising the nucleotide sequence of SEQ ID NO: 8, encoding a nucleic acid comprising the nucleotide sequence of 7; a mutant obtained by monomerizing (C154S) the wild-type fluorescent protein; and monomerizing the wild-type fluorescent protein; A nucleotide sequence of SEQ ID NO: 9 or SEQ ID NO: 10 encoding a mutant (N126Y, C154S, Y166F) (S129G, C154S, D156G, K204I, N209Y) having increased stability at a temperature suitable for mammalian cell culture Containing nucleic acids.

  The present invention also includes vectors containing these nucleic acids. The vector may contain, in addition to a nucleic acid encoding a fluorescent protein, a nucleic acid containing a sequence for regulating expression or a marker gene sequence.

<PH measurement method>
The present invention also relates to a method for introducing the fluorescent protein according to the present invention into a subject and measuring the pH inside the subject based on the fluorescence emitted by the fluorescent protein.

  That is, in the method of the present invention, after the fluorescent protein is introduced into the target, the fluorescence emitted from the fluorescent protein is detected by irradiating the excitation light, and the pH is specified based on the wavelength of the fluorescence.

  Here, the subject may be a cell such as a bacterial cell, yeast cell, fungal cell, insect cell or mammalian cell. Furthermore, the subject may be a tissue or an individual. The cells may be fixed or alive. Fixing can be performed by a general method using formalin, methanol or the like. Moreover, the individual as a target may be an individual other than a human. Furthermore, the subject may be a solution commonly used in biological experiments. There are no particular limitations on the target cells, tissues, and individuals, and those obtained by conventional acquisition methods can be used.

  Any method common in the art for introducing proteins into cells or the like may be used to introduce fluorescent proteins into a subject. For example, when the object is a cell, the fluorescent protein may be directly injected into the cell by a microinjection method. Alternatively, it may be introduced by introducing an expression vector containing a fluorescent protein gene into a cell and appropriately expressing it.

  Fluorescence detection can be performed using conventional methods or devices that are capable of measuring fluorescence at specific wavelengths. For example, it is performed by observing a cell into which a fluorescent protein has been introduced under a fluorescent microscope. In one example of such a method, the detection of fluorescence is performed in an inverted fluorescence microscope equipped with a fluorescence cube with a filter set corresponding to 388 nm excitation-458 nm fluorescence and 498 nm excitation-506 nm fluorescence, and the fluorescence of samples at 458 nm and 506 nm peaks. Images are taken with a CCD camera. The pH can be obtained by quantifying the fluorescence intensity of the pH measurement target area in the captured image. At this time, it is also possible to acquire a fluorescent image temporally by stimulating the cells under various conditions and then capturing images at regular intervals. Furthermore, the measurement of fluorescence can measure not only wavelengths near 458 nm and 506 nm, but also fluorescence spectra. In this case, specifically, the measurement can be performed by connecting an optical fiber to the camera port of the microscope and measuring the fluorescence spectrum of the measurement target region with a spectrophotometer.

  In addition, the pH can be calculated based on a calibration curve created from the values of the fluorescence intensity at 458 nm and 506 nm for each pH and the ratio thereof. A calibration curve can be created by measuring the fluorescence intensity at 458 nm and the fluorescence intensity at 506 nm for each pH in advance, and determining the ratio thereof and plotting it on a graph as shown in FIG. 6 or FIG. Thereafter, the fluorescence intensity at 458 nm and 506 nm can be measured in the subject to be measured, and the ratio can be applied to a calibration curve to identify the pH in the subject. By specifying the pH based on the fluorescence intensity ratio, regardless of the absolute value of the fluorescence intensity, it becomes possible to cancel the fluctuations between the fluorescence intensity values obtained from independent experiments. It is possible to compare the results obtained from independent experiments.

  The method of the present invention is not limited to the case where a fluorescent protein is introduced into a subject alone, but also includes a method of introducing a fusion protein comprising a fluorescent protein and a protein different from the fluorescent protein into the subject. For example, when the “different protein” is a protein that is originally expressed in the target cell, the fusion protein of the present invention may also be localized at a site in the cell where the protein is originally localized. is expected. In this state, by detecting the fluorescence of the fluorescent protein, it is possible to measure the pH of the specific site corresponding to the “different protein”. “Different proteins” can be selected according to the site to be measured and the purpose of the experiment. For example, a mitochondrial translocation signal (coxIV) or a Golgi translocation signal (GT) can be used.

  In the pH measurement method of the present invention, the fluorescent protein can be excited by irradiating two excitation lights having different wavelengths. Although the pH measurement method of the present invention includes measuring two fluorescences having different wavelengths, two excitation lights having different wavelengths corresponding to the two fluorescences can be used. For example, when using the fluorescent protein of FIG. 1, excitation light near 388 nm and 450 nm can be used to generate fluorescence near 458 nm and 506 nm (FIGS. 2a and 2b). In the pH measurement method of the present invention, the fluorescent protein can be excited by irradiating with excitation light having a single wavelength. For example, when using the fluorescent protein of FIG. 1, excitation light around 388 nm can be used to generate fluorescence around 458 nm and 506 nm (FIG. 2a). By using a single excitation light, it is possible to simplify the apparatus for measurement.

[Example 1: Cloning of the cactus fluorescent protein gene]
After extracting and purifying the fluorescent protein from the cactus (Cavernularia obesa) and reading the partial amino acid sequence, the fluorescent protein gene was cloned by determining the gene sequence based on the sequence.

Extraction and Purification of Fluorescent Protein and Amino Acid Sequence Analysis Fifteen cactus (approximately 200 g) collected in the Shimane sea were ground in 500 ml of SDS-glycine buffer to extract a soluble protein containing a protein having fluorescence activity. The residue was removed using a centrifuge, and a solution containing a protein having fluorescent activity was extracted. Ammonium sulfate was added to this extracted solution so as to have a final concentration of 80%, and ammonium sulfate precipitation was performed. Specifically, 262 g of ammonium sulfate was added to 500 ml of the extraction solution. The obtained precipitate was redissolved in 50 ml of Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl). To this was added twice the amount of ethanol to precipitate the protein again. Further, Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl) was added to the precipitate and redissolved. 50 ml of this solution was dialyzed using a sufficient amount of Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl) and a dialysis membrane 27/32 (Sanko Junyaku Co., Ltd.). The solution after dialysis was purified by ion exchange separation using a chromatography system AKTAexplorer (GE Healthcare Bioscience) equipped with a DEAE Sepharose CL-6B column (GE Healthcare Bioscience). In this ion exchange, after sufficiently equilibrating with a low salt concentration Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl), a sample is added and a high salt concentration Tris buffer (20 mM Tris-HCl (pH 7. 0) and 1M NaCl) to increase the NaCl concentration to 0.4M. As a result, fractions having fluorescence activity were collected. Selection of the fraction containing the protein with fluorescence activity was performed using UV / BLUE CONVERTER PLATE (UVP). The obtained fraction was dialyzed using a sufficient amount of Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl) and a dialysis membrane 27/32 (Sanko Junyaku Co., Ltd.). The solution after dialysis was concentrated using ultrafiltration Amicon Ultra: molecular weight cut off 30 kDa (Nippon Millipore Corporation). Next, gel filtration was performed using Sephacryl S-200 High Resolution (GE Healthcare Bioscience) and Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl). After gel filtration, the obtained fluorescently active fraction was subjected to ion exchange separation with monoQ 5/50 (GE Healthcare Bioscience). In this ion exchange, after sufficiently equilibrating with a low salt concentration Tris buffer (20 mM Tris-HCl (pH 7.0), 20 mM NaCl), a sample is added and a high salt concentration Tris buffer (20 mM Tris-HCl (pH 7. 0) and 1M NaCl) to increase the NaCl concentration to 0.4M. As a result, a fluorescently active fraction was obtained. This active fraction was concentrated using ultrafiltration Amicon Ultra: molecular weight cut off 30 kDa (Nippon Millipore Corporation), and then Superdex 75 10/300 GL (GE Healthcare Bioscience) and Tris buffer (20 mM Tris- Gel filtration separation was performed using HCl (pH 7.0), 20 mM NaCl) to obtain a fraction having fluorescence activity. The sample was separated by SDS-polyacrylamide gel electrophoresis and analyzed for amino acid sequence. As a result of the analysis, an amino acid sequence of 22 residues (IPD YFV QSF PEG FTF ERT LSF E: SEQ ID NO: 11) could be determined.

Cloning of fluorescent protein gene For cloning of the full length fluorescent protein gene, 3'-RACE PCR was performed as follows. A mixed primer for cloning a fluorescent protein gene was prepared by the Rapid Amplification of cDNA End method (hereinafter abbreviated as RACE). Of the amino acid sequences IPD YFV QSF PEG FTF ERT LSF E (SEQ ID NO: 11) obtained by amino acid sequence analysis, attention was paid to the amino acid regions of IPDYFV and EGFTFER with few codon base combinations. Base sequences encoding these amino acid regions were predicted, and fluorescent protein-specific mixed primers (12 types in total) used for 3′-end RACE polymer chain chain reaction (hereinafter abbreviated as PCR) were prepared as follows. As primers that bind to the IPDYFV amino acid region, COGFP-TTT (5′-ATH CCN GAT TAT TTT GT-3 ′) (SEQ ID NO: 12), COGFP-TTC (5′-ATH CCN GAT TAT TTC GT-3 ′) ( SEQ ID NO: 13), COGFP-TCT (5′-ATH CCN GAT TAC TTT GT-3 ′) (SEQ ID NO: 14), COGFP-TCC (5′-ATH CCN GAT TAC TTC GT-3 ′) (SEQ ID NO: 15) COGFP-CTT (5′-ATH CCN GAC TAT TTT GT-3 ′) (SEQ ID NO: 16), COGFP-CTC (5′-ATH CCN GAC TAT TTC GT-3 ′) (SEQ ID NO: 17), COGFP-CCT (5′-ATH CCN GAC TAC TTT GT-3 ′) (SEQ ID NO: 18) and CO GFP-CCC (5′-ATH CCN GAC TAC TTC GT-3 ′) (SEQ ID NO: 19) was prepared, and COGFP-ATTAA (5′-GAA GGN TTT ACN TTT GAA was used as a primer that binds to the EGFTFER amino acid region. AG-3 ′) (SEQ ID NO: 20), COGFP-ACCAA (5′-GAA GGN TTC ACN TTC GAA AG-3 ′) (SEQ ID NO: 21), COGFP-ATTGA (5′-GAG GGN TTT ACN TTT GAG AG- 3 ′) (SEQ ID NO: 22) and COGFP-ACCGA (5′-GAG GGN TTC ACN TTC GAG AG-3 ′) (SEQ ID NO: 23). T, H and N in the primer indicate mixed bases.

  Twelve specific mixed primers and 3 ′ end-specific primers were prepared by predicting from the amino acid sequence of a fluorescent protein using a full-length cDNA library prepared using GeneRacer (Invitrogen) as a template and using the full-length cDNA synthesis reagent GeneRacer (Invitrogen) as a template. GeneRacer 3 'Primer (5'-GCT GTC AAC GAT ACG CTA CGT AAC G-3') (SEQ ID NO: 24) and GeneRacer 3 'Nested Primer (5'-CGC TAC GTA ACG GCA TGA CAG-3 sequence) 25) was used to perform 3′-RACE PCR. GeneRacer 3 'Primer and GeneRacer 3' Nested Primer are included in the full-length cDNA synthesis reagent GeneRacer kit (Invitrogen) and used. In order to effectively amplify the fluorescent protein gene by 3'-RACE PCR, a nested PCR was carried out in which the gene amplified once by PCR was used as a template and the gene was amplified more specifically by the inner primer pair. PCR was performed according to the manual using polymerase Ex-Taq (Takara Bio Inc.).

The first PCR was performed using any of the eight types of primers (COGFP-TTT, COGFP-TTC, COGFP-TCT, COGFP-TCT, COGFP-CTT, COGFP-CTC, COGFP-CCT, COGFP-CCC) prepared in the IPDYFV amino acid region. The fluorescent protein gene was amplified with a total of 8 primer pairs of KA and GeneRacer 3 ′ Primer. 10 × Ex Taq Buffer (added with 20 mM Mg ²⁺ ) at the same final concentration, dNTP Mixture (2.5 mM each) at a final concentration of 0.2 mM, TaKaRa Ex Taq (5 U / μl) at a final concentration of 0.05 U / μl, A 20 μl PCR reaction solution was prepared with one of the 8 primers at a final concentration of 0.4 μM and a GeneRacer 3 ′ Primer at a final concentration of 0.4 μM, and 0.2 μl of the cactus full-length cDNA library solution was added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, a cycle of 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 2 minutes is performed 30 times, and finally an extension reaction at 72 ° C. for 5 minutes. Went. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% Tris acetate buffer (hereinafter abbreviated as TAE) agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation. Since gene amplification was slightly observed in the eight reaction solutions, a nested PCR reaction was performed using this PCR reaction solution as a template.

Nested PCR is the amplification of the fluorescent protein gene with four primer pairs of GeneRacer3'Nested Primer and any of the four types of primers (COGFP-ATTAA, COGFP-ACCAA, COGFP-ATTGA, COGFP-ACCGA) created in the EGFERFER amino acid region. Went. 10 × Ex Taq Buffer (added with 20 mM Mg ²⁺ ) at the same final concentration, dNTP Mixture (2.5 mM each) at a final concentration of 0.2 mM, TaKaRa Ex Taq (5 U / μl) at a final concentration of 0.05 U / μl, Make 10 μl of nested PCR reaction solution with 0.4 μM final concentration of one of the four primers and 0.4 μM final concentration of GeneRacer 3 ′ Nested Primer, and 0.2 μl using the first PCR reaction solution as a template. added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, a cycle of 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 2 minutes is performed 30 times, and finally an extension reaction at 72 ° C. for 5 minutes. Went. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation.

  As a result, as a first PCR reaction, a primer pair of COGFP-TTC and GeneRacer 3 ′ Primer was used, and as a nested PCR reaction, the obtained PCR reaction solution was used as a template for COGFP-ACCAA and GeneRacer 3 ′ Nested Primer. When this primer pair was used, remarkable gene amplification could be confirmed. The base sequence of this amplified gene was determined and used as the base sequence (SEQ ID NO: 26) on the 3′-end side of the sea cactus fluorescent protein gene.

  5'-RACE for 5 'end cloning of fluorescent proteins was performed as follows. Primers used for 5'-RACE for 5 'terminal cloning were prepared based on the 3' terminal nucleotide sequence of the cactus fluorescent protein gene obtained by a series of 3'-RACE analyses. The prepared primers for 5 ′ terminal cloning were COGFP-A-R1 (5′-GCT ATA GCC GTC TCA TGT TGC TCG T-3 ′) (SEQ ID NO: 27), COGFP-A-R2 (5′-AGC CGT). CTC ATG TTG CTC GTA GTA G-3 ′) (SEQ ID NO: 28) and COGFP-A-R3 (5′-ATG TTG CTC GTA GTA GTT GCC TTC CTC GAC-3 ′) (SEQ ID NO: 29) . COGFP-A-R1, COGFP-A-R2, and COGFP-A-R3 bind in the order close to the 5 'end, and are sequentially used as primers for the nested PCR reaction.

  GeneRacer 5 'Primer (5'-CGA CTG GAG), which is a 5'-end specific primer and 5'-end specific primer, using a full-length cDNA library prepared by using full-length cDNA synthesis reagent GeneRacer as a template 5'-RACE PCR using CAC GAG GAC ACT GA-3 ') (SEQ ID NO: 30) and GeneRacer 5' Nested Primer (5'-GGA CAC TGA CAT GGA CTG AAG GAG TA-3 ') (SEQ ID NO: 31) Went. GeneRacer 5 'Primer and GeneRacer 5' Nested Primer are included in the full-length cDNA synthesis reagent GeneRacer kit (Invitrogen) and used. In order to effectively amplify the fluorescent protein gene by 5'-RACE PCR, a nested PCR was performed in which the gene amplified once by PCR was used as a template and the gene was amplified more specifically by the inner primer pair. PCR was performed according to the manual using polymerase Ex-Taq.

As the first 5′-RACE PCR, a fluorescent protein gene was amplified using a primer pair of COGFP-A-R1 and GeneRacer 5 ′ Primer prepared based on the base sequence of the gene amplified by 3′-RACE. . 10 × Ex Taq Buffer (20 mM Mg ²⁺ added) is the same final concentration, dNTP Mixture (each 2.5 mM) is 0.2 mM final concentration, and TaKaRa Ex Taq (5 U / μl) is final concentration 0.05 U / μl. 10 μl of PCR reaction solution was prepared with COGFP-A-R1 at a final concentration of 0.4 μM, GeneRacer 5 ′ Primer at a final concentration of 0.4 μM, and 0.2 μl of a cactus full-length cDNA library solution was added. . As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, 30 cycles of 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 2 minutes are performed, and finally extension at 72 ° C. for 5 minutes is performed. Reaction was performed. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation. Since gene amplification was slightly observed in this 5′-RACE, a nested PCR reaction was performed using this PCR reaction solution as a template.

As a nested PCR, a fluorescent protein GFP gene was amplified using a primer pair of COGFP-A-R2 and GeneRacer 5 ′ Nested Primer. 10 × Ex Taq Buffer (20 mM Mg ²⁺ added) is the same final concentration, dNTP Mixture (each 2.5 mM) is 0.2 mM final concentration, and TaKaRa Ex Taq (5 U / μl) is final concentration 0.05 U / μl. 1 μl, COGFP-A-R2 to a final concentration of 0.4 μM, GeneRacer 5 ′ Nested Primer to a final concentration of 0.4 μM, 10 μl of PCR reaction solution is prepared, and 0.2 μl of the first PCR reaction solution is used as a template. added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, 30 cycles of 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 2 minutes are performed, and finally extension at 72 ° C. for 5 minutes is performed. Reaction was performed. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation.

  As a result, as a first PCR reaction, a primer pair of COGFP-A-R1 and GeneRacer 5 ′ Primer was used, and as a nested PCR reaction, the obtained PCR reaction solution was used as a template for COGFP-A-R2 and GeneRacer 5 'Significant gene amplification could be confirmed when performed using primer pairs with Nested Primer. However, since amplification of a plurality of non-specific genes was observed, a nested PCR reaction was performed again using this PCR reaction solution as a template and different primer pairs.

As a second nested PCR, a GFP gene was amplified using a primer pair of COGFP-A-R3 and GeneRacer 5 ′ Nested Primer. 10 × Ex Taq Buffer (20 mM Mg ²⁺ added) is the same final concentration, dNTP Mixture (each 2.5 mM) is 0.2 mM final concentration, and TaKaRa Ex Taq (5 U / μl) is final concentration 0.05 U / μl. 20 μl of a nested PCR reaction solution was prepared using COGFP-A-R3 at a final concentration of 0.4 μM, GeneRacer 5 ′ Nested Primer at a final concentration of 0.4 μM, and the first nested PCR reaction solution as a template. 4 μl was added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, 30 cycles of 94 ° C. for 30 seconds, 45 ° C. for 30 seconds and 72 ° C. for 2 minutes are performed, and finally extension at 72 ° C. for 5 minutes is performed. Reaction was performed. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation. As a result, remarkable gene amplification could be confirmed by a series of nested PCR reactions. The base sequence of this amplified gene was determined and used as the base sequence (SEQ ID NO: 32) on the 5 ′ end side of the sea cactus fluorescent protein gene.

  Next, full-length amplification of the fluorescent protein gene was performed as follows. Based on the nucleotide sequence at the 5 ′ end of the fluorescent protein gene derived from sea cactus obtained by the above 3′-RACE and 5′-RACE analysis, it is used for 3′-RACE for cloning of the full-length fluorescent protein gene. Primers were created. Primers for cloning the full-length GFP gene prepared were COGFP-A-Full-F3 (5′-ATT TAG GTG GCT GCG TAC AG-3 ′) (SEQ ID NO: 33), COGFP-A-Full-F4 (5 ′ -ATT TAG GTG GCT GCG TAC AGT TAA CAC-3 ') (SEQ ID NO: 34). It binds to a position close to the 3 'end in the order of COGFP-A-Full-F3 and COGFP-A-Full-F4. COGFP-A-Full-F4 is used as a primer for the nested PCR reaction.

  GeneRacer 3 ′ Primer (5′-GCT), which is a primer for cloning two kinds of full-length fluorescent protein genes and 3 ′ end-specific primer, using a full-length cDNA library prepared using GeneRacer as a full-length cDNA synthesis reagent as a template. GTC AAC GAT ACG CTA CGT AAC G-3 ′) (SEQ ID NO: 24) and GeneRacer 3 ′ Nested Primer (5′-CGC TAC GTA ACG GCA TGA CAG TG-3 ′) (SEQ ID NO: 25) RACE PCR was performed. GeneRacer 3 'Primer and GeneRacer 3' Nested Primer were used as they are included in the full-length cDNA synthesis reagent GeneRacer kit (Invitrogen). In order to effectively amplify the full-length fluorescent protein gene by 3'-RACE PCR, a nested PCR was performed in which the gene amplified once by PCR was used as a template and the gene was amplified more specifically by the inner primer pair. PCR was performed according to the manual using polymerase Ex-Taq.

As the first PCR, a fluorescent protein gene was amplified using a primer pair of COGFP-A-Full-F3 and GeneRacer 3 ′ Primer. 10 × Ex Taq Buffer (20 mM Mg ²⁺ added) is the same final concentration, dNTP Mixture (each 2.5 mM) is 0.2 mM final concentration, and TaKaRa Ex Taq (5 U / μl) is final concentration 0.05 U / μl. 1 μl, COGFP-A-Full-F3 at a final concentration of 0.4 μM, GeneRacer 3 ′ Primer at a final concentration of 0.4 μM, 10 μl of a nested PCR reaction solution is prepared, and the cactus full-length cDNA library solution is 0.2 μl. Was added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, 30 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds and 72 ° C. for 1 minute are performed, and finally, extension at 72 ° C. for 5 minutes is performed. Reaction was performed. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation. Since gene amplification was slightly observed in the first 5′-RACE, a nested PCR reaction was performed using this PCR reaction solution as a template.

The fluorescent protein gene was amplified using a primer pair of COGFP-A-Full-F4 and GeneRacer 5 ′ Nested Primer as nested PCR. 10 × Ex Taq Buffer (20 mM Mg ²⁺ added) is the same final concentration, dNTP Mixture (each 2.5 mM) is 0.2 mM final concentration, and TaKaRa Ex Taq (5 U / μl) is final concentration 0.05 U / μl. 1 μl, COGFP-A-Full-F4 to a final concentration of 0.4 μM, GeneRacer 5 ′ Nested Primer to a final concentration of 0.4 μM, 10 μl of a nested PCR reaction solution is prepared, and the first PCR reaction solution is used as a template. 2 μl was added. As PCR reaction conditions, first heat denaturation at 94 ° C. for 1 minute is performed, then, 30 cycles of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds and 72 ° C. for 1 minute are performed, and finally, extension at 72 ° C. for 5 minutes is performed. Reaction was performed. After the PCR reaction, 2 μl of the PCR reaction solution was electrophoresed using a 1% TAE agarose gel, stained with ethidium bromide, and the amplified gene band was observed under ultraviolet irradiation. As a result, significant gene amplification was confirmed. The base sequence of this amplified gene was determined and used as the base sequence (SEQ ID NO: 35) on the 5 ′ end side of the full-length sea cactus fluorescent protein gene.

  The base sequence of the open reading frame of the sea cactus GFP gene was predicted from the base sequence of the obtained full-length sea cactus fluorescent protein using the sequence information analysis software DNASIS Pro (SEQ ID NO: 2). Furthermore, the open reading frame was translated to obtain the amino acid sequence of the cactus fluorescent protein (SEQ ID NO: 1). This amino acid sequence was purified from the sea cactus and contained the 22-residue sequence (SEQ ID NO: 11) obtained by amino acid analysis in a completely identical state, so that it was determined to be a fluorescent protein gene derived from the sea cactus. This gene was incorporated into a pRSET vector (Invitrogen), transformed into Escherichia coli, and observed with UV / BLUE CONVERTER PLATE (UVP), which showed remarkable fluorescence activity.

[Example 2: Enhancement of fluorescence intensity of sea cactus fluorescent protein]
Mutations were randomly introduced into the wild-type cactus fluorescent protein gene, and they were expressed in Escherichia coli to screen for mutants having a fluorescence intensity stronger than that of the wild-type.

  For the introduction of the mutation, GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) was used. Pirset 1 (ATGAGTATTCCAGGAAATTCGGGCTTAACAG) (SEQ ID NO: 38) and Primer 2 (TCATGGTTTAGCTATGCCCGCTCTCCATG) (added to SEQ ID No. 39 and Kit No. 39) PCR reaction was performed according to the manual. After the PCR reaction, electrophoresis was performed using 1% agarose gel, and the target PCR product was purified using Wizard SV Gel and PCR Clean-Up (Promega). After purification, PCR reaction was performed according to the manual, and after treatment with DpnI at 37 ° C., ethanol precipitation was performed. After precipitation, DNA was dissolved in a small amount of distilled water and transformed into JM109 (DE3) by electroporation using MicroPulser (BioRad). The transformed E. coli was inoculated on a 25 cm square LB (50 ng / ml ampicillin added) plate and cultured at 37 ° C. to form colonies. After colony formation, using UV / BLUE CONVERTER PLATE (UVP), colonies that emit strong fluorescence compared to colonies expressing wild-type fluorescent protein were selected and cultured again. Thereafter, the base sequence of the plasmid it retained was determined (SEQ ID NO: 7).

  Furthermore, as a result of converting this base sequence into an amino acid sequence (SEQ ID NO: 3) and comparing it with the wild-type amino acid sequence, it was found that the 154th cysteine was substituted with arginine.

[Example 3: Monomerization of sea cactus fluorescent protein]
The cysteine at position 154 in the amino acid sequence of the wild type fluorescent protein was substituted with serine by the following method. For the introduction of the mutation, QuickChange II Site-Directed Mutagenesis Kit (Stratagene) was used. Using a plasmid obtained by cloning a cactus fluorescent protein gene in pRSET-A (Invitrogen) as a template, and using Pilmer1 (CAATGTATGTCGCGACGACACTTTGG) and Primer2 (CCAAAGGTGTGTCCGATACATACATTG) (SEQ ID NO: 37) PCR reaction was performed according to the manual. After the reaction, it was treated with DpnI at 37 degrees and transformed into Escherichia coli JM109 (DE3) strain.

  The transformed bacteria were cultured, the vector was taken out, and the nucleotide sequence of the fluorescent protein gene was read with a sequencer. As a result, the sequence of SEQ ID NO: 8 was obtained, and it was confirmed that the mutation could be introduced as intended. From this gene, a fluorescent protein (SEQ ID NO: 4) in which the 154th is substituted with serine is expressed.

  Further, the transformed Escherichia coli was cultured at 28 degrees and then lysed to prepare lysate. SDS-PAGE sample buffer was added thereto, a sample was prepared without applying heat, and SDS-PAGE was performed. The result is shown in FIG. FIG. 8 shows that the dimer band that appears in the wild-type fluorescent protein (left lane) disappears in the mutant fluorescent protein (right lane). This confirmed that the fluorescent protein was monomerized.

[Example 4: Modification of chromophore formation temperature of sea cactus fluorescent protein]
Mutations were randomly introduced into the monomeric mutant fluorescent protein obtained in Example 3 and screened for mutants that stabilize chromophore formation at 37 ° C.

  For the introduction of mutation, GeneMorph II EZClone Domain Mutagenesis Kit (Stratagene) was used. Using a plasmid in which a monomerized mutant gene (the 154th cysteine is replaced with serine) as a template in pRSET-A (Invitrogen) was used as a template, Pilmer1 (ATGAGTATTCCAGGAATTCGGGCTTAACAG) (SEQ ID NO: 38) and Primer2 (TCATGGTTTAGCTATGGCCGTCTGCTGTCTCTC SEQ ID NO: 39) was added, and PCR was performed according to the manual attached to the kit. After the PCR reaction, electrophoresis was performed using 1% agarose gel, and the target PCR product was purified using Wizard SV Gel and PCR Clean-Up (Promega). After purification, PCR reaction was performed according to the manual, and after treatment with DpnI at 37 ° C., ethanol precipitation was performed. After precipitation, DNA was dissolved in a small amount of distilled water and transformed into JM109 (DE3) by electroporation using MicroPulser (BioRad). The transformed E. coli was inoculated on a 25 cm square LB (50 ng / ml ampicillin added) plate and cultured at 37 ° C. to form colonies. After colony formation, use UV / BLUE CONVERTER PLATE (UVP) to select two colonies that emit strong fluorescence (named mutant 1 and mutant 2, respectively) compared to colonies expressing wild-type fluorescent protein And cultured again. Then, the base sequence of the plasmid which they hold was determined. The respective sequences are shown in SEQ ID NO: 9 and SEQ ID NO: 10.

  Furthermore, these base sequences were converted into amino acid sequences (SEQ ID NO: 5 for variant 1 and SEQ ID NO: 6 for variant 2), and compared with the wild-type amino acid sequence. Mutant 1 was found to have 126th asparagine replaced with tyrosine, 154th cysteine replaced with serine, and 166th tyrosine replaced with phenylalanine. In variant 2, 129th serine is replaced with glycine, 154th cysteine is replaced with serine, 156th aspartic acid is replaced with glycine, 204th lysine is replaced with isoleucine, 209th asparagine Was replaced by tyrosine.

  In addition, the stability of chromophore formation at 37 ° C. of mutants 1 and 2 was compared with wild-type fluorescent protein and monomeric fluorescent protein. The wild type gene, the monomerized mutant gene prepared in Example 3, the gene of mutant 1 and the gene of mutant 2 were cloned into pRSET-A (Invitrogen), respectively, and the JM109 (DE3) strain, respectively. Transformed into. These strains were applied to plates and cultured at 37 ° C. to express fluorescent proteins. The state was observed with UV / BLUE CONVERTER PLATE (UVP), and an image was taken. FIG. 9 is an image representing it in monochrome. Although fluorescence was observed as green light in an actual image, it is shown in white in FIG. 9, and the darker the white, the higher the fluorescence intensity. It can be seen that mutants 1 and 2 fluoresce very strongly compared to the wild type and monomeric mutants. In particular, it can be seen that mutant 2 emits stronger fluorescence than mutant 1.

  Next, the association state of the fluorescent protein was examined by gel filtration chromatography. Fluorescent proteins were purified and analyzed from E. coli expressing wild type fluorescent protein and E. coli expressing mutant 2. The result is shown in FIG. In the wild type, a peak was obtained in the vicinity of 66 kDa, whereas in mutant 2, a peak was obtained in the vicinity of 37 kDa. These results suggest that the fluorescent protein of variant 2 forms a monomer while the wild-type fluorescent protein forms a dimer.

[Example 5: Measurement of intracellular pH in fixed cells]
In the fixed cells, the fluorescence of the wild type cactus fluorescent protein was measured.

  The cDNA of wild type cactus fluorescent protein was incorporated into a mammalian cell expression vector pCDA3.1 (Invitrogen). The prepared plasmid was introduced into U2OS cells using Lipofectamine 2000 (Invitrogen). Lipofectamine 2000 was used according to the instruction manual.

  The U2OS cells were cultured all day and night, then fixed by 3% neutral formalin fixation, and a bright field image was taken with a fluorescence microscope (IX70 manufactured by Olympus) (FIG. 11a). Thereafter, the cells were washed with a phosphate buffer (pH = 7), and fluorescence was obtained using a fluorescent cube NIBA for IB excitation (Olympus: excitation filter 470-490 nm, dichroic mirror 505 nm, fluorescence filter 510-550 nm). I took a picture. FIG. 11b is an image representing it in monochrome. The fluorescence observed in green in the actual image is shown in white in FIG. 11b. Next, the cells are washed with an acetate buffer (pH = 4), and a fluorescence image is obtained using a fluorescent cube WU for excitation U (Olympus: excitation filter 330-385 nm, dichroic mirror 400 nm, fluorescence filter 420 nm long pass). I took a picture. FIG. 11c is an image representing it in monochrome. The fluorescence observed in blue in the actual image is shown in white in FIG. 11c. From these images, it was shown that the cactus fluorescent protein of the present invention can generate fluorescence even in formalin-fixed cells, and further change its wavelength according to pH.

  Furthermore, the fluorescence spectrum at each pH was measured (FIG. 11d). A multi-channel detector PMA-11 manufactured by Hamamatsu Photonics was used for the measurement. As a result, a spectrum having a maximum wavelength at 472 nm at pH 4 and at 509 nm at pH 7 was obtained.

[Example 6: Measurement of pH in phagocytic cells]
The intracellular pH was estimated by measuring the fluorescence of the wild type cactus fluorescent protein in living cells.

  Wild-type cactus fluorescent protein cDNA was incorporated into E. coli expression vector pRSET (Invitrogen). The prepared plasmid was transformed into E. coli and cultured at 25 ° C. to express the wild type cactus fluorescent protein in E. coli. This Escherichia coli was added to a culture vessel of a mouse-derived macrophage RAW264.7 cell line and cultured overnight. In addition, it is generally known that Escherichia coli is digested by organelle lysosomes in an acidic environment in RAW cells after phagocytosis by RAW cells.

  Prior to observation with a fluorescence microscope, the culture medium was replaced with a phosphate buffer (pH = 7). Thereafter, RAW cells phagocytosing E. coli were photographed using a fluorescent cube NIBA (Olympus: excitation filter 470-490 nm, dichroic mirror 505 nm, fluorescence filter 510-550 nm) for IB excitation. FIG. 12A shows an image representing it in monochrome. When the fluorescent cube NIBA is used, mainly only green fluorescence can be detected, but in FIG. 12a, the green fluorescence is represented in white. Furthermore, it image | photographed using the fluorescence cube WU (The Olympus company make: excitation filter 330-385 nm, dichroic mirror 400 nm, fluorescence filter 420 nm long pass) for U excitation. FIG. 12B is an image representing it in monochrome. When the fluorescent cube WU is used, fluorescence of 420 nm or more including green and blue can be detected. However, in FIG. 12b, both green and blue fluorescence are expressed in white.

  According to FIG. 12a, scattered light can be observed, but the shape of RAW cells cannot be recognized. From the comparison with the bright-field image (not shown), it can be seen that this observed light is derived from E. coli present in the culture solution before being phagocytosed by RAW cells. From this, it was found that the fluorescent protein in E. coli present in the neutral culture medium emits green fluorescence.

  As shown in FIG. 12b, it was also observed that a lot of light gathered to form a RAW cell shape in addition to scattered light. The scattered light is light derived from E. coli in the culture solution before phagocytosis, as in FIG. 12a. On the other hand, the light forming the RAW cell shape is light derived from E. coli phagocytosed and taken into lysosomes in the RAW cell. Here, according to an actual image, scattered light was observed in green, and light forming a RAW cell shape was observed in blue. From these results, it was found that the cactus fluorescent protein emits green fluorescence in a neutral culture solution, but emits blue fluorescence when transferred into acidic lysosomes.

  Furthermore, the fluorescence spectrum of the fluorescent protein before and after phagocytosis by RAW cells in FIG. 12b is shown in FIG. A ratio was determined based on the fluorescence intensities of 458 nm and 506 nm obtained from this fluorescence spectrum, and applied to the calibration curve shown in FIG. 7 to estimate the pH in the culture solution and in the lysosome (lower table in FIG. 13). The estimated pH almost reflects the pH in the culture and the pH in the lysosome.

  From the above results, it was shown that the cactus fluorescent protein can change the wavelength of the fluorescence emitted by moving from a neutral environment to an acidic environment even in living heterogeneous cells. Furthermore, it was shown that the pH in the environment where the cactus fluorescent protein exists can be obtained satisfactorily based on the fluorescence intensity at that time.

Claims (9)

Was derived from an organism belonging to Cnidaria Anthozoa Umiera eyes Umisaboten family, in an alkaline environment and acidic environment, possess respectively different fluorescent activity fluorescence peak wavelengths from each other, SEQ ID NO: 1, 3, 4, 5 or A fluorescent protein comprising the amino acid sequence represented by 6 .   The fluorescence activity in an alkaline environment has a fluorescence peak wavelength near 506 nm and pKa = 6.5, and the fluorescence activity in an acidic environment has a fluorescence peak wavelength near 458 nm and pKa = 6.0. The fluorescent protein according to 1. A nucleic acid comprising a base sequence encoding the fluorescent protein according to claim 1 or 2 . A method for introducing the fluorescent protein according to claim 1 or 2 into cultured cells and measuring the pH inside the object based on fluorescence emitted by the fluorescent protein. A method for introducing a fusion protein comprising the fluorescent protein according to claim 1 or 2 and a protein different from the fluorescent protein into cultured cells , and measuring the pH inside the object based on fluorescence emitted from the fluorescent protein. . The method according to claim 4 or 5 , wherein the cell is a fixed cell or a living cell. The method according to any one of claims 4 to 6 , wherein the measurement is performed based on a ratio between a fluorescence intensity near 506 nm and a fluorescence intensity near 458 nm. The two excitation lights having different wavelengths is irradiated to the fluorescent protein, the method according to any one of claims 4 7 for measuring the pH of the interior of the cells based on fluorescence emitted from the fluorescent protein. Irradiated with excitation light of a single wavelength to the fluorescent protein, the method according to any one of claims 4 7 for measuring the pH of the interior of the cells based on fluorescence emitted from the fluorescent protein.

Images