CN110205333B - Corn dwarf disease induction gene P3a and construction method and application of genetic transformation system thereof - Google Patents
Corn dwarf disease induction gene P3a and construction method and application of genetic transformation system thereof Download PDFInfo
- Publication number
- CN110205333B CN110205333B CN201910367593.8A CN201910367593A CN110205333B CN 110205333 B CN110205333 B CN 110205333B CN 201910367593 A CN201910367593 A CN 201910367593A CN 110205333 B CN110205333 B CN 110205333B
- Authority
- CN
- China
- Prior art keywords
- maize
- gene
- expression vector
- dwarf
- plant expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/00022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Abstract
The invention discloses a corn dwarf virus induction gene P3a and a construction method and application of a genetic transformation system thereof, belonging to the technical field of genetic engineering, wherein the corn dwarf virus induction gene P3a has a nucleotide sequence shown as SEQ ID NO.1, and the genetic transformation system of the corn dwarf virus induction gene P3a can induce the dwarfing of corn plants, which indicates that the gene is a key gene for inducing the corn dwarf virus. The discovery of the gene fills the blank of the research on the pathogenic mechanism of the maize dwarf disease and provides a theoretical basis for the later research on the molecular mechanism of the maize dwarf disease.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a maize dwarf disease induced gene P3a and a construction method and application of a genetic transformation system thereof.
Background
Corn is one of the crops with the largest planting area in China and is an important economic crop in China. Maize dwarf disease is a group of diseases caused by insect-borne viruses, including: the dwarf plants caused by maize rough dwarf disease are obviously shorter than normal plants, the leaves are dark green, the leaves are wide, short and thick, the internodes at the upper part are shortened, and the ears cannot be sprouted and fructified; secondly, dwarf plants caused by maize dwarf mosaic disease only have green leaf veins, other parts are yellow, the yellow and green stripes are shown, and leaf tissues are hard, brittle and easy to break.
The corn suffers from dwarfing disease in the whole growth cycle, the influence on the yield is large, and the influence on the yield is serious as the corn is infected earlier, and the current prevention and treatment method comprises the following steps: resistant varieties are selected, poison sources are reduced, virus propagation is eliminated, and the like, wherein the two latter schemes need to invest a large amount of manpower and material resources in breeding management, and the management has certain difficulty. The selection of the resistant variety is generally considered to be a more economic and environment-friendly solution, but the breeding period of the resistant variety is longer, the variety is fewer, and other performances of the resistant variety can not necessarily meet the requirements of people.
At present, most of dwarf-resistant varieties are bred in a field hybridization mode, and few genetic breeding means are used, the main reason is that the research on the pathogenic molecular mechanism of the maize dwarf is still in a preliminary stage at present, so that the important significance is realized for understanding the toxicity and pathogenic genetic basis of the maize dwarf virus. The invention starts from the pathogeny, provides a theoretical basis for the research of the pathogenesis of the maize dwarf disease by finding the pathogenic gene capable of causing the maize dwarf disease, and provides possibility for further developing a more efficient prevention and treatment means.
A paper published by Sha Chen et al in the journal of Viruses in 2016, entitled "Breeding of a Novel Polerovirus infection Maize in China", discloses a Novel virus, Maize yellow mosaic virus MaYMV, which infects Maize and causes dwarf and yellowing symptoms in Maize, and seriously affects the yield and quality of Maize. At present, the maize harming MaYMV is detected in Yunnan, Guizhou, Anhui and other places in China, and the MaYMV is also harmed in the east Africa and other countries.
Disclosure of Invention
The invention aims to provide a maize dwarf induction gene P3a and a construction method and application of a genetic transformation system thereof, so as to provide a maize dwarf induction related gene and lay a foundation for researching the pathogenesis of maize dwarf and a control method of maize dwarf.
The invention is realized by the following technical scheme:
the invention provides a maize dwarf inducing gene P3a, which has a nucleotide sequence shown in SEQ ID NO.1 and a total length of 135bp, wherein the P3a gene is derived from maize yellow mosaic virus (MaYMV) and is used for coding a protein of the MaYMV.
The invention also provides a construction method of the genetic transformation system of the maize dwarf inducing gene P3a, the genetic transformation system is a plant expression vector which is sequentially connected with a promoter, the maize dwarf inducing gene P3a and a terminator in cis form on a multiple cloning site, and the construction method comprises the following steps:
step S1: cloning of maize dwarf-inducing gene P3 a;
step S2: and constructing a plant expression vector to obtain a genetic transformation system of the maize dwarf inducing gene P3 a.
Further preferably, in the step S1, the cloning method of P3a includes: with the primer F: GCGATATCATAGATTGGAAACTCTTTTGC and R: ATCTATAG CCTCCCGTATTCATTCACAAT amplifying P3a gene in maize yellow mosaic virus, connecting the amplified target sequence to pMD19-T vector by using EcoRV enzyme cutting site and storing for later use.
Further preferably, the plant expression vector is a plant expression vector pCambia3301, wherein a 35S promoter, a P3a gene, a Flag tag and a terminator are sequentially connected to a multiple cloning site in cis, namely a 35S: MaYMV P3a-Flag plant expression vector;
the construction and transformation method of the plant expression vector comprises the following steps:
using a primer:
F：CATACCATTTACGAACGATAGGTCGACATACAGAAGCTTCGAAGATAGC
R：GTCGTGGTCCTTATAGTCGTCGACCCTCCCGTATTCATTCACAAT
amplifying a P3a gene in maize yellow mosaic virus, connecting the amplified target sequence to a pUC19-2X35S-3XFLAG vector by using a one-step cloning method to construct a P3a plant expression vector with a Flag label for storage and later use;
using a primer:
F：CATGCCATGGATACAGAAGCTTCGAAGATAGC
R：CTGGTCACCCTTATCGTCATCGTCTTTG
amplifying the P3a plant expression vector with Flag tag obtained by the preparation to obtain a target gene P3a + Flag sequence with Flag tag, connecting the P3a + Flag sequence to a plant expression vector pCambia3301 by using NcoI and BstEII enzyme cleavage sites, and constructing 35S, namely a MaYMV P3a-Flag plant expression vector, namely a genetic transformation system of the maize dwarf disease inducing gene P3 a.
The invention also provides application of the maize dwarf disease induction gene P3a in regulating and controlling maize growth and development.
The invention also provides application of the maize dwarf disease induction gene P3a in reducing the pathogenicity of maize dwarf disease.
Compared with the prior art, the invention has the following advantages: the invention provides a corn dwarf gene P3a and a construction method and application of a genetic transformation system thereof, the corn dwarf gene P3a can induce corn dwarf and is a key gene for inducing corn dwarf, the discovery of the gene fills the blank of the research of the pathogenic mechanism of the corn dwarf disease and provides a theoretical basis for the later-stage research of the molecular mechanism of the corn dwarf disease, the development of new varieties of corn dwarf resistant diseases and the research of new methods for preventing and treating the corn dwarf disease.
Drawings
FIG. 1 is a diagram showing the PCR detection result of T1 generation maize regenerated seedlings mediated by agrobacterium;
FIG. 2 is a diagram showing the results of the comparison of plant heights of transgenic maize and normal maize;
FIG. 3 shows the test paper strip for detecting positive seedlings of transgenic corn.
Detailed Description
Example 1
1. Material
The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used therein are commercially available products unless otherwise specified.
2. Method of producing a composite material
2.1 RNA extraction of maize yellow mosaic Virus strains
Taking a living corn plant infected with maize yellow mosaic virus, extracting total RNA of leaves of a infected plant by using an RNA extraction kit, and reversely transcribing the RNA into cDNA.
2.2 cloning of maize dwarf-inducing Gene P3a
With the primer F: CATACCATTTACGAACGATAGGTCGACATACAGAAGCTTCGAAGATAGC and R: GTCGTGGTCCTTATAGTCGTCGACCCTCCCGTATTCATTCACAAT, amplifying the P3a gene by taking cDNA as a template, connecting the amplified P3a gene to a pUC19-2X35S-3XFLAG vector with a Flag tag, constructing and obtaining a plant expression vector with the Flag tag, and sending the plant expression vector to Shanghai biological engineering technical service company Limited for sequencing.
2.3 construction of genetic transformation System
The genetic transformation system is a pCambia3301 vector which is sequentially and cis-connected with a 35S promoter, a P3a gene with a Flag tag and a terminator on a multiple cloning site, namely 35S, a MaYMV P3a-Flag plant expression vector, and the construction method of the plant expression vector comprises the following steps:
2.3.1 ligation of the 35S promoter into the multiple cloning site of the pCambia3301 vector;
2.3.2 Using primer F: CATGCCATGGATACAGAAGCTTCGAAGATAGC and R: CTGGTCACCCTTATCGTCATCGTCTTTG amplifying the plant expression vector with Flag label obtained by the preparation, obtaining the target gene P3a + Flag sequence with Flag label, and connecting the P3a + Flag sequence to the plant expression vector pCambia3301 by using NcoI and BstEII enzyme cutting sites.
The operation is carried out by referring to a gene engineering experiment manual, and a 35S MaYMV P3a-Flag plant expression vector, namely a genetic transformation system of the maize dwarf inducing gene P3a is constructed and used for a transgenic test.
2.4 transformation
Transferring the vector plasmid into agrobacterium EHA105 by an electric shock method, and identifying by PCR to obtain an agrobacterium genetic transformation system containing P3a gene.
2.5 Agrobacterium mediated genetic transformation of maize
Entrusted to the Rice Biotechnology (Jiangsu) Co Ltd for corn genetic transformation, the specific operation steps include: taking freshly stripped young maize embryos of about 1mm as a material, putting the stripped young maize embryos into a 2mL plastic centrifuge tube containing 1.8mL of suspension, and treating about 150 immature young embryos within 30 min; the suspension was aspirated off, the remaining corn embryos were placed in a tube and then 1.0ml of the Agrobacterium suspension from step 2.4 was added and left for 5 min. The young embryos in the centrifuge tube are suspended and poured onto a co-culture medium, and the surplus agrobacterium liquid on the surface is sucked by a liquid transfer device and is cultured for 3 days in the dark at the temperature of 23 ℃. After co-cultivation, the young embryos are transferred to a resting medium, cultured in the dark at 28 ℃ for 6 days, placed on a screening medium containing bialaphos, and screened and cultured for two weeks, and then screened and cultured on a new screening medium for 2 weeks. Transferring the resistant callus to a differentiation culture medium, and culturing for 3 weeks at 25 ℃ and 5000lx under illumination; transferring the differentiated plantlets to a rooting culture medium, and culturing at 25 ℃ and 5000lx by illumination until the plantlets are rooted; transferring the plantlets into small pots for growth, transplanting the plantlets into a greenhouse after a certain growth stage, and harvesting progeny seeds after 3-4 months.
Detecting a transgenic corn screening marker bar gene by using a PCR method on T1 regenerated seedlings, wherein a PCR primer F: TAGGTCGACATACAGAAGCT and R: TGCCCTCCCAGCTGCT, the size of the target band is 269bp, and the negative control is empty vector maize. The results are shown in FIG. 1, which shows that the number of positive transgenic seedlings obtained by bar gene screening is more than 50.
2.6 transgenic maize dwarf trait detection
And (3) selecting 50 positive transgenic seedlings detected in the step (2.5), marking, and then mixing with normal empty vector-transferred wild-type seedlings of the same age to plant in a field, and finding that 32 of the 50 positive transgenic seedlings show dwarfing symptoms, as shown in figure 2, the gene is proved to have the effect of causing dwarfing diseases on corn.
And then, detecting 32 transgenic plants by using a screening marker bar gene detection test strip, and taking wild corn as a control, wherein the result is shown in figure 3, the wild corn has no bar gene strip, the transgenic plants detect the bar gene, and figure 3 illustrates that the exogenous gene P3a is transferred into the corn plants, and the corn is dwarfed.
2.7 application of maize dwarf inducing gene P3a
As can be seen from the above experimental results, the corn dwarf can be induced after the corn dwarf inducing gene P3a invades the corn genome, and for this, the corn protein interacting with the pathogenic protein P3a in the corn can be screened by using the gene interaction technology, and then the expression of the interacting protein in the susceptible corn plant can be regulated and controlled by using the gene silencing technology, or the gene interacting with P3a in the corn is modified, so that the corn is not affected by the P3a pathogenicity, and the purpose of resisting virus is achieved. The research content provides a theoretical basis for later-stage formulation of the antiviral breeding strategy of the corn.
The above is a detailed embodiment and a specific operation process of the present invention, which are implemented on the premise of the technical solution of the present invention, but the protection scope of the present invention is not limited to the above-mentioned examples.
Claims (6)
1. The application of a maize dwarf inducing gene P3a in regulating and controlling maize growth and development refers to maize dwarf development, and is characterized in that the maize dwarf inducing gene P3a has a nucleotide sequence shown as SEQ ID No. 1.
2. The use of the maize dwarf inducing gene P3a in the regulation of maize growth and development according to claim 1, wherein the cloning method of P3a comprises: with the primer F: GCGATATCATAGATTGGAAACTCTTTTGC and R: ATCTATAG CCTCCCGTATTCATTCACAAT the P3a gene was amplified in maize yellow mosaic virus.
3. The use of the maize dwarf inducing gene P3a in the regulation of maize growth and development according to claim 1, wherein the maize growth and development is regulated by constructing a genetic transformation system of the maize dwarf inducing gene P3 a.
4. The use of the maize dwarf inducing gene P3a in the regulation of maize growth and development according to claim 3, wherein the method for constructing the genetic transformation system of the maize dwarf inducing gene P3a comprises the following steps:
step S1: cloning of maize dwarf-inducing gene P3 a;
step S2: and constructing a plant expression vector to obtain a genetic transformation system of the maize dwarf inducing gene P3 a.
5. The application of the maize dwarf inducing gene P3a in regulating and controlling the growth and development of maize according to claim 4, wherein the plant expression vector is a plant expression vector pCambia3301 with a 35S promoter, a P3a gene, a Flag tag and a terminator connected in sequence and in cis on a multiple cloning site, namely a 35S: MaYMV P3a-Flag plant expression vector.
6. The application of the maize dwarf disease inducing gene P3a in regulating and controlling the growth and development of maize according to claim 4, wherein the construction and transformation method of the plant expression vector comprises the following steps:
using a primer:
F：CATACCATTTACGAACGATAGGTCGACATACAGAAGCTTCGAAGATAGC
R：GTCGTGGTCCTTATAGTCGTCGACCCTCCCGTATTCATTCACAAT
amplifying a P3a gene in maize yellow mosaic virus, connecting the amplified target sequence to a pUC19-2X35S-3XFLAG vector by using a one-step cloning method to construct a P3a plant expression vector with a Flag label for storage and later use;
using a primer:
F：CATGCCATGGATACAGAAGCTTCGAAGATAGC
R：CTGGTCACCCTTATCGTCATCGTCTTTG
amplifying the P3a plant expression vector with Flag tag obtained by the preparation to obtain a target gene P3a + Flag sequence with Flag tag, connecting the P3a + Flag sequence to a plant expression vector pCambia3301 by using NcoI and BstEII enzyme cleavage sites, and constructing 35S, namely a MaYMV P3a-Flag plant expression vector, namely a genetic transformation system of the maize dwarf disease inducing gene P3 a.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910367593.8A CN110205333B (en) | 2019-05-05 | 2019-05-05 | Corn dwarf disease induction gene P3a and construction method and application of genetic transformation system thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910367593.8A CN110205333B (en) | 2019-05-05 | 2019-05-05 | Corn dwarf disease induction gene P3a and construction method and application of genetic transformation system thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110205333A CN110205333A (en) | 2019-09-06 |
| CN110205333B true CN110205333B (en) | 2021-01-01 |
Family
ID=67786844
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910367593.8A Active CN110205333B (en) | 2019-05-05 | 2019-05-05 | Corn dwarf disease induction gene P3a and construction method and application of genetic transformation system thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110205333B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114989268B (en) * | 2022-03-14 | 2023-07-18 | 安徽省农业科学院植物保护与农产品质量安全研究所 | Plant virus movement protein and application thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112980842B (en) * | 2021-02-01 | 2023-07-18 | 安徽省农业科学院烟草研究所 | Non-coding nucleotide sequence and application thereof in improving expression level of exogenous gene |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9198434B1 (en) * | 2014-09-25 | 2015-12-01 | King Saud University | Method of inhibiting plant virus using gold nanoparticles |
| CN107557384B (en) * | 2017-09-12 | 2020-09-01 | 黔南民族师范学院 | Genetic transformation system for inducing plant dwarfing and construction and application thereof |
-
2019
- 2019-05-05 CN CN201910367593.8A patent/CN110205333B/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114989268B (en) * | 2022-03-14 | 2023-07-18 | 安徽省农业科学院植物保护与农产品质量安全研究所 | Plant virus movement protein and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110205333A (en) | 2019-09-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sharma et al. | An efficient method for the production of transgenic plants of peanut (Arachis hypogaea L.) through Agrobacterium tumefaciens-mediated genetic transformation | |
| CN112063626B (en) | Corn gene ZmRAVL1 and functional site and application thereof | |
| WO2020221029A1 (en) | Zea mays receptor-like kinase gene zmrlk7 and use thereof | |
| Ge et al. | Efficient genotype‐independent cotton genetic transformation and genome editing | |
| CN106480163B (en) | A method of joint apple callus cell culture and genetic transformation identify apple disease-resistant gene | |
| CN110205333B (en) | Corn dwarf disease induction gene P3a and construction method and application of genetic transformation system thereof | |
| CN106337059A (en) | Method for improving citrus huanglongbing resistance | |
| CN104450711A (en) | Application of OsmiR156f gene in rice effective tillering increasing | |
| CN113248586B (en) | Application of brown planthopper PIB14 protein and coding gene thereof in regulation and control of plant brown planthopper resistance | |
| CN114058640A (en) | Efficient agrobacterium-mediated sugarcane genetic transformation method | |
| CN113604497A (en) | Genetic transformation method of gramineous plants | |
| CN110106269A (en) | Bna-miR156d is in the control developmental application of cabbage type rape branch | |
| CN110204600A (en) | BnSPL14 gene, albumen and its application in control cabbage type rape plant type | |
| KR100804766B1 (en) | Transgenic hot pepper tolerant to cmv pathotype | |
| CN113151258B (en) | Flanking sequence of exogenous insertion fragment of insect-resistant transgenic maize AM63 insertion site and application thereof | |
| Lei et al. | Agrobacterium-mediated transformation of cotton shoot apex with SNC1 gene and resistance to cotton Fusarium wilt in T1 generation | |
| CN112538486A (en) | Gene for controlling corn plant height, protein coded by gene and application of gene | |
| CN110129322A (en) | Application of Bna-miR393 during regulating and controlling cabbage type rape reproductive development | |
| Jia et al. | Genetic engineering of Chinese potato cultivars by introducing antibacterial polypeptide gene | |
| CN117305266B (en) | Gene OsBDG1 related to rice stress resistance and application of coded protein thereof | |
| CN117126880B (en) | Application of NbKTI1 gene of Nicotiana benthamiana in regulation and control of plant virus resistance and transgenic plant cultivation method | |
| CN115786371B (en) | Application of tomato gene SlLyk4 in regulation and control of soil-borne disease resistance of crops | |
| NL2030997B1 (en) | Zea mays receptor-like kinase 7 (zmrlk7) gene related to kernel and plant type development of maize and use thereof | |
| CN110511932B (en) | Cotton fiber length-related microRNA477, precursor DNA thereof and application thereof | |
| CN109777823B (en) | Method for obtaining new variety of poplar with high-resistance willow leaf beetle plastid Bt-transferring gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |