CN112538486A

CN112538486A - Gene for controlling corn plant height, protein coded by gene and application of gene

Info

Publication number: CN112538486A
Application number: CN202011490418.7A
Authority: CN
Inventors: 苟明月; 荆腾; 武玉莹; 范田源; 李见坤
Original assignee: Henan Agricultural University
Current assignee: Henan Agricultural University
Priority date: 2020-12-16
Filing date: 2020-12-16
Publication date: 2021-03-23
Anticipated expiration: 2040-12-16
Also published as: CN112538486B

Abstract

The invention relates to the fields of biotechnology and genetic breeding, in particular to a gene for controlling the height of a corn plant, a protein coded by the gene and application of the gene. The gene is ZmBON1, the nucleotide sequence of the gene is shown in SEQ ID NO.1, the application refers to the application in the breeding of maize dwarf materials, and the method is characterized in that the CRISPR/Cas9 gene editing means is utilized to carry out site-directed mutation on the maize ZmBON1 gene, so that the maize ZmBON1 gene function is lost, and the genetic improvement on the maize plant height is realized. The research provides a new dwarf breeding gene resource, and the plant type of an important maize inbred line can be improved through the gene in the future, so that the gene can be popularized and applied in production.

Description

Gene for controlling corn plant height, protein coded by gene and application of gene

Technical Field

The invention relates to the fields of biotechnology and genetic breeding, in particular to a gene for controlling the height of a corn plant, a protein coded by the gene and application of the gene.

Background

Dwarfing breeding promoted the "first green revolution". The short-stalk corn has compact plant type, is suitable for high-density planting, and can make crops have stronger lodging resistance and higher light energy utilization rate. The plant height of maize is determined by the length of the stem and the internode number, and in general, the smaller the internode number, the smaller the internode length, and the lower the plant height of maize. In a certain growth period, the height of the corn can be effectively reduced by shortening the internode length, and the corn can be divided into a polygene system and a monogene system according to the genetic characteristics of the plant height. The polygenic dwarf system consists of accumulated effects of a plurality of micro-effect genes and belongs to quantitative trait inheritance. The shortening effect of each dwarf gene on internodes of plants is almost the same, the effect accumulation of a plurality of micro-effect dwarf genes plays a role in the dwarfing of the plants together, and the more the accumulation effect is, the shorter the plants are. The single-gene dwarf system is a system for reducing maize plants caused by a major dwarf gene. Since the 20 th century, approximately 70 maize dwarf genes have been found, such as br1, br2, bv1, ct1, ct2, D8, D9, RPH1 and the like. And most of the dwarf genes are cloned and excavated by constructing map bits of genetic populations, so that the workload is large and the period is long. Recent studies have predicted the homologous protein ZmRPH1 in maize using the Arabidopsis thaliana microtubule-associated protein QWRF as an index, and overexpression of the CDS sequence of this gene in maize has resulted in dwarf transgenic lines.

Scientists have now cloned a large number of plant growth and defense response genes from the model plant Arabidopsis thaliana and have extensively analyzed their molecular mechanisms. However, there are few reports that apply the results of these gene theory studies directly to crop molecular breeding. How to clone the plant height related gene in corn rapidly and create a breeding material which can be popularized and applied is a very important problem for all corn molecular breeders.

Disclosure of Invention

The first purpose of the invention is to provide a gene for controlling the height of a corn plant, a protein coded by the gene and application of the gene.

In order to achieve the above object, in a first aspect, the present invention provides a gene for controlling the plant height of maize, wherein the gene is ZmBON1, and the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

In a second aspect, the invention provides a protein for controlling the height of a corn plant, wherein the protein is encoded by a gene shown in SEQ ID NO. 1.

In a third aspect, the invention provides application of the gene for controlling the corn plant height in corn dwarf material breeding, which is to perform site-specific mutation on a corn ZmBON1 gene by using a CRISPR/Cas9 gene editing means so as to delete the corn ZmBON1 gene function and realize genetic improvement on the corn plant height.

Further, a target gene ZmBON1 in the corn is designed into a sgRNA sequence based on CRISPR/Cas9, a DNA fragment containing the sgRNA sequence is connected into a vector carrying Bar, the constructed vector is used for transforming the corn, the site-specific mutation of ZmBON1 is realized, and then a transgenic corn plant with the ZmBON1 gene function deletion is obtained.

Further, sgRNA sequences for the target gene ZmBON1 action site in maize were 5'-GATCGCTTTCTCCGCTCCCG-3' and 5'-GTTCAGGCTGAAGAAAGTTC-3'.

Further, two sgRNA sites were connected in series to the same vector via different expression cassettes.

Further, the Bar carrying vector is pBUE 411.

Furthermore, corn is transformed by an agrobacterium-mediated method.

Further, the corn is an inbred line KN 5585.

Compared with the prior art, the invention has the following beneficial effects:

the invention discloses the biological function of the corn ZmBON1 gene for the first time, carries out gene editing on the corn ZmBON1 gene by a CRISPR/Cas9 technology, and further obtains a corn dwarfing material without exogenous gene insertion.

Drawings

FIG. 1 shows the alignment of the BON family gene protein sequences of maize, Arabidopsis and rice.

FIG. 2 is a phylogenetic tree of the BON family of genes from maize, Arabidopsis and rice.

FIG. 3 is a schematic diagram of different allelic mutation types of Zmbon 1.

FIG. 4 shows the morphic phenotype of Zmbon 1.

FIG. 5 shows statistics of plant heights of Zmbon1 mutant.

Detailed Description

The invention is described in detail below with reference to the figures and the specific embodiments, but the invention should not be construed as being limited thereto. The technical means used in the following examples are conventional means well known to those skilled in the art, and materials, reagents and the like used in the following examples can be commercially available unless otherwise specified.

Example 1

Prediction of maize defense regulatory gene ZmBON1

1. Homologous alignment retrieval of maize BON family genes

The amino acid sequence of the Arabidopsis BON1(AT5G61900) gene was downloaded AT the TAIR website (https:// www.arabidopsis.org /). Using it as an index, using NCBI BLASTp online alignment tool (https:// blast.ncbi.nlm.nih.gov/blast.cgi program ═ Blast & PAGE _ TYPE ═ Blast Search & LINK _ LOC ═ Blast) to align in the Zea mays (tall: 4577) protein library, two genes with sequence similarity greater than 50% were obtained: GRMZM2G494514 and GRMZM2G176995 (FIG. 1).

2. Phylogenetic tree analysis and prediction ZmBON1 gene

Phylogenetic tree analysis was performed using the Neighbor-joining Method (Neighbor-joining Method) and it was found that GRMZM2G494514 was clustered with AtBON1 and OsBON1 (FIG. 2), which was designated ZmBON1, and the nucleotide sequence was shown in SEQ ID NO. 1.

Example 2

Design of CRISPR/Cas 9-based editing sites

The CDS sequence and genomic sequence of the ZmBON1 gene were downloaded at MazeGDB, the CDS sequence was copied to http:// cr. for. net/website, Genome selected Zea mays (B73 RefGen _ v4), PAM selected 20bp-NGG-Sp 9, Target sequence was Predicted, sequences beginning with G, high in Specificity and Predicted Efficiency were selected, and candidate Target sequences were aligned back to the genomic sequence of ZmBON1, excluding sequences spanning introns. According to the screening conditions, two targets of Target 1(GATCGCTTTCTCCGCTCCCG, shown as SEQ ID NO. 2) and Target 2(GTTCAGGCTGAAGAAAGTTC, shown as SEQ ID NO. 3) are obtained.

Example 3

Construction of Gene editing vector

Primers are designed according to the selected editing sites and enzyme cutting sites at the multiple cloning sites of the vectors pCBC-MT1T2 and pBUE411, the information of the primers is shown in Table 1, the intermediate vector pCBC-MT1T2 and the plant transformation binary vector pBUE411-2gR used in the experiment are both from the teacher of the Chen's army of the biological institute of Chinese agriculture university, and the final vector pBUE411 carries glufosinate-ammonium resistance gene Bar.

TABLE 1 primer information

Note: the underlined part is a Target sequence, and the rest is a vector framework homology arm and a series Target interval homology arm sequence.

(1) And (3) PCR amplification: four-primer PCR amplification was performed using 100-fold diluted pCBC-MT1T2 as a template. ZmBON1-MT1T2-BsF/-BsR is normal primer concentration (10 uM); ZmBON1-MT1T2-F0/-R0 was diluted 20-fold, the system is shown in Table 2, and the reaction procedure is shown in Table 3.

TABLE 2 PCR amplification System

TABLE 3 PCR amplification procedure

(2) The PCR product was purified and recovered, and the enzyme digestion-ligation system as shown in Table 4 was established:

TABLE 4 enzyme digestion-ligation System

5uL of the strain was taken to transform the competence of E.coli. Kan50 resistant plate screening. OsU3-FD3+ TaU3-RD 831bp colony PCR identification, OsU3-FD3 and TaU3-FD2 sequencing confirmation.

Note: colony PCR and sequencing primers:

OsU3-FD 3: GACAGGCGTCTTCTACTGGTGCTAC (shown in SEQ ID NO. 8);

TaU3-RD: CTCACAAATTATCAGCACGCTAGTC (shown as SEQ ID NO. 9);

TaU3-FD: TTAGTCCCACCTCGCCAGTTTACAG (shown as SEQ ID NO. 10);

TaU3-FD2: TTGACTAGCGTGCTGATAATTTGTG (shown in SEQ ID NO. 11).

Example 4

The pBUE411-BON1 gene editing vector is transferred into agrobacterium EHA105 by an electric shock method and identified by PCR.

Example 5

Agrobacterium transformed maize

The agrobacterium transforms the maize inbred line KN5585 to obtain transgenic seeds with 20 independent transgenic events.

Taking freshly stripped KN5585 maize inbred line immature embryos of about 1mm as a material, putting the stripped maize embryos into a 2mL plastic centrifuge tube containing 1.8mL of suspension, and treating about 150 immature embryos within 30 min; the suspension was aspirated off, the remaining corn embryos were placed in a tube and 1.0ml of Agrobacterium suspension was added and left for 5 min. The young embryos in the centrifuge tube are suspended and poured onto a co-culture medium, and the surplus agrobacterium liquid on the surface is sucked by a liquid transfer device and is cultured for 3 days in the dark at the temperature of 23 ℃. After co-cultivation, the young embryos were transferred to a resting medium, cultured in the dark at 28 ℃ for 6 days, placed on a screening medium containing bialaphos, and screened for two weeks, followed by screening for 2 weeks on a new screening medium. Transferring the resistant callus to a differentiation culture medium, and culturing for 3 weeks at 25 ℃ and 5000lx under illumination; transferring the differentiated plantlets to a rooting culture medium, and culturing at 25 ℃ and 5000lx by illumination until the plantlets are rooted; transferring the plantlets into small pots for growth, transplanting the plantlets into a greenhouse after a certain growth stage, and harvesting progeny seeds after 3-4 months.

Example 6

Identification of transgenic maize plants in which editing occurred

1. PCR amplification across Target sequence

(1) Taking the leaves of transgenic T1 generation materials to extract DNA, and using a primer pair crossing Target 1: ZmBON1_ T1-F (5'-GGGTCTCCGTGTCGTCTCTGCGA-3', shown as SEQ ID NO. 12) and ZmBON1_ T1-R (5'-GCCAACGAGTAACGTAGCAGTA-3', shown as SEQ ID NO. 13), and a primer pair spanning Target 2: and amplifying the transgenic positive plants by ZmBON1_ T2-F (5'-GTAGCTTGTTCTCTAGTGGCCTA-3' shown as SEQ ID NO. 14) and ZmBON1_ T2-R (5'-GTAATGCGCCAGCTGTTGATGGT-3' shown as SEQ ID NO. 15), and sequencing and identifying the amplified products. The reaction systems and procedures are shown in tables 5-6.

TABLE 5 reaction System

TABLE 6 reaction procedure

(2) Analysis of PCR sequencing results

The chromatogram after sequencing was introduced into http:// skl.scau.edu.cn/dsdecode/website, and the genomic DNA sequence between the above-mentioned Target1/2 spanning amplification primers was used as the reference sequence for decoding. Multiple different allelic mutants were obtained as shown in FIG. 3.

2. Phenotypic outcome identification

Plant height measurements were performed on all lines that gave homozygous mutants for the genotype identification of the material from T1 generations and on wild-type lines grown contemporaneously and in the same location, and it was found that the plant height of the Zmbon1 mutant was significantly lower than that of the KN5585 wild-type, with statistical data for the growth phenotype and plant height of two representative lines, Zmbon1-1 and Zmbon1-2, as shown in fig. 4 and 5.

It should be noted that when the following claims refer to numerical ranges, it should be understood that both ends of each numerical range and any numerical value between the two ends can be selected, and the preferred embodiments of the present invention are described for the purpose of avoiding redundancy.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> Henan university of agriculture

<>

<120> gene for controlling height of corn plant, protein encoded by the gene and application of the protein

<>

<160> 15

<>

<170> SIPOSequenceListing 1.0

<>

<210> 1

<211> 1734

<212> DNA

<213> corn

<>

<400> 1

atggggaact gctgctccga tgaggtgagc cacgccggcg ctcatcccgt cggctccgcc 60 <>

accgccaaag ccgcctccgc agcctccgcc gcggccgatc gctttctccg ctcccgtggt 120 <>

gccggcgcgt ccacgcagat cgagttatct ctctctgcat caaatttggg tgatcaagaa 180 <>

tattttccca agagtaaacc catggttgtt gtgtattcca aaaagagaga tggtacacta 240 <>

gaagaaattg ggcgcagtga agtaatttta aattcattga acccattttg gacgaccaaa 300 <>

atcagtgtgc agtaccagtt tgaggttctt cagcaattgg tgtttcaggt ctttgacatc 360 <>

caccagcagt tccatgatgt cagtgaaaag atgcttaagc tagaggaaca agagtttctt 420 <>

ggagaggcta cctgtctttt gtcagaggtt atcaccaaac gggacagact gctgactctg 480 <>

aagcttggtg tttctgaaca taacttgcca aatcctaata attttggtga gctaactgtt 540 <>

caggctgaag aaagttcagg ttcaaaagca ataatggaga tgatattccg ctgttcggat 600 <>

cttgaaatca aggatcttct aacaaagagt gatacttttt tgctaatatc tggaatatca 660 <>

gatagtggaa tgcctgttcc aatttgcaag acagaagtaa gaaagaatga tctcaatcct 720 <>

aggtggaggc cagtgagtct gaatctgcaa cagattggaa gtaaggagaa ccctctaatt 780 <>

gtagagtgct ttaacttcag tagcaatggc aaacatgacc tagtcggcaa gatagtcaag 840 <>

tcagttgcag aattggaaaa tatgtaccat aggaagaatg gtgaaaattt ctttgttcct 900 <>

gccagcaatg cacatgaatg tcacagtaag gaggtgttga agagccagct atatgtagag 960 <>

aaatatgttg agagtaacag acatactttc ctagattata tttctgttgg gtgccagttg 1020 <>

aattttatgg taggcgtaga tttcacagct tcaaatggaa atccacggct tccagattct 1080 <>

ttgcattata ttgacccctc aggtcggcca aatgtatatc agaaggcaat actggaaatt 1140 <>

ggtgatgttc tacaatatta tgacccaccg aagcgtttcc ccgcttgggg ctttggagca 1200 <>

agacctattg acggtcctgt ttctcattgt tttaatttga atggcagcac ttatcaacct 1260 <>

gaggttgacg gaatacaagg aattatgtca gcttatatca gcgctcttcg taatgtatca 1320 <>

ttagctggtc ctaccctctt tggtcagttg ataagcaccg ccatggcgat agctagccaa 1380 <>

tctcttgctg agaatcaaca taaatacttc attttgttaa tagtcactga tggcgtggta 1440 <>

actgattttc aagagactat tgatgcgatc ataaaggcat cagattttcc tatatccata 1500 <>

attgttgttg gagttggagg ggctgatttc aaggaaatgg agtttctaga tccaaacaaa 1560 <>

ggagagaaac tggaaagctc aaccgggaga gttgcatcaa gggatatgat acagtttgcc 1620 <>

ccgatgaagg atatgcacgg cactgggata tccacacttc aatcacttct tgctgaggta 1680 <>

ccagggcaat tcatgacata catgaggaca agagaaaccc aaacagacag ttag 1734 <>

<>

<210> 2

<211> 20

<212> DNA

<213> corn

<>

<400> 2

gatcgctttc tccgctcccg 20 <>

<>

<210> 3

<211> 20

<212> DNA

<213> corn

<>

<400> 3

gttcaggctg aagaaagttc 20 <>

<>

<210> 4

<211> 36

<212> DNA

<213> Artificial sequence

<>

<400> 4

aataatggtc tcaggcgatc gctttctccg ctcccg 36 <>

<>

<210> 5

<211> 40

<212> DNA

<213> Artificial sequence

<>

<400> 5

gatcgctttc tccgctcccg gttttagagc tagaaatagc 40 <>

<>

<210> 6

<211> 33

<212> DNA

<213> Artificial sequence

<>

<400> 6

gaactttctt cagcctgaac gcttcttggt gcc 33 <>

<>

<210> 7

<211> 36

<212> DNA

<213> Artificial sequence

<>

<400> 7

attattggtc tctaaacgaa ctttcttcag cctgaa 36 <>

<>

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence

<>

<400> 8

gacaggcgtc ttctactggt gctac 25 <>

<>

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence

<>

<400> 9

ctcacaaatt atcagcacgc tagtc 25 <>

<>

<210> 10

<211> 25

<212> DNA

<213> Artificial sequence

<>

<400> 10

ttagtcccac ctcgccagtt tacag 25 <>

<>

<210> 11

<211> 25

<212> DNA

<213> Artificial sequence

<>

<400> 11

ttgactagcg tgctgataat ttgtg 25 <>

<>

<210> 12

<211> 23

<212> DNA

<213> Artificial sequence

<>

<400> 12

gggtctccgt gtcgtctctg cga 23 <>

<>

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence

<>

<400> 13

gccaacgagt aacgtagcag ta 22 <>

<>

<210> 14

<211> 23

<212> DNA

<213> Artificial sequence

<>

<400> 14

gtagcttgtt ctctagtggc cta 23 <>

<>

<210> 15

<211> 23

<212> DNA

<213> Artificial sequence

<>

<400> 15

gtaatgcgcc agctgttgat ggt 23 <>

<>

Claims

1. The gene for controlling the height of the corn plant is characterized in that the gene is ZmBON1, and the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. A protein for controlling the plant height of maize, wherein said protein is encoded by the gene of claim 1.

3. The application of the gene of claim 1 in maize dwarf material breeding is characterized in that the gene is subjected to site-directed mutation on a maize ZmBON1 gene by using a CRISPR/Cas9 gene editing means, so that the maize ZmBON1 gene function is deleted to realize genetic improvement on the maize plant height.

4. The application of claim 3, wherein a CRISPR/Cas 9-based sgRNA sequence is designed for a target gene ZmBON1 in corn, a DNA fragment containing the sgRNA sequence is connected into a Bar-carrying vector, the constructed vector is used for transforming the corn, site-directed mutation on ZmBON1 is realized, and then a transgenic corn plant with the ZmBON1 gene function loss is obtained.

5. The use of claim 4, wherein the sgRNA sequences for the site of action of the target gene ZmB ON1 in maize are 5'-GATCGCTTTCTCCGCTCCCG-3' and 5'-GTTCAGGCTGAAGAAAGTTC-3'.

6. The use of claim 5, wherein two sgRNA sites are connected in series to the same vector via different expression cassettes.

7. The use according to claim 4, wherein the Bar carrying vector is pBUE 411.

8. The use of claim 4, wherein the maize is transformed by an Agrobacterium-mediated method.

9. The use of claim 4, wherein the maize is inbred KN 5585.