CN110129459A - It is a kind of for detecting the LAMP primer composition and application of 5 kinds of gram-positive bacteriums in intraocular liquid - Google Patents
It is a kind of for detecting the LAMP primer composition and application of 5 kinds of gram-positive bacteriums in intraocular liquid Download PDFInfo
- Publication number
- CN110129459A CN110129459A CN201810113531.XA CN201810113531A CN110129459A CN 110129459 A CN110129459 A CN 110129459A CN 201810113531 A CN201810113531 A CN 201810113531A CN 110129459 A CN110129459 A CN 110129459A
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer
- following
- deletion
- substitution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of for detecting the LAMP primer composition and application of 5 kinds of gram-positive bacteriums in intraocular liquid.Present invention firstly provides a kind of combination of primer, 30 kinds of DNA moleculars shown in sequence 1 to sequence 30 are formed.Whether the primer combination can be applied to detect whether bacterium to be measured is staphylococcus epidermis, staphylococcus aureus, enterococcus faecalis, enterococcus faecium or streptococcus pyogenes, can be applied in detection sample to be tested containing staphylococcus epidermis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes.5 kinds of gram-positive bacteriums in the intraocular liquid of primer combine detection provided by the invention have high specific and high sensitivity, and easy, quick, accurate detection may be implemented.The present invention has great promotional value.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to one kind is for detecting 5 kinds of gram-positive bacteriums in intraocular liquid
LAMP primer composition and application.
Background technique
Gram-positive bacterium is the main pathogenic bacteria for causing bacterial endophthalmitis.Height quick equal retrospective analysis 2010 1
Month to keratitis patients 146 of in April, 2015 Beijing Tongren Hospital's positive bacterial culture, wherein the cause of disease of 56.2% (82)
Bacterium is gram-positive bacterium.Staphylococcus epidermis (Staphylococcus epidermidis), staphylococcus aureus
(Staphylococcus aureus), enterococcus faecalis (Enterococcus faecalis), enterococcus faecium (Enterococcus
Faecium) and streptococcus pyogenes (Streptococcus pyogenes) is that clinical 5 kinds of most commonly seen Gram-positives are caused a disease
Bacterium.Staphylococcus epidermis is to be originated in a kind of bacterium of living thing's skins, belongs to normal flora type, and majority is non-causes a disease
Bacterium, minority can lead to disease, and most of bacterial endophthalmitis are caused by staphylococcus epidermis.Staphylococcus aureus is the mankind
A kind of important pathogen, be under the jurisdiction of staphylococcus (Staphylococcus), be the representative of gram-positive bacteria, can cause
Many severe infections.Enterococcus faecalis and enterococcus faecium are common bacterial pathogens after postcataract and eye wound.Make purulence
Streptococcus, i.e. A group streptococcus (Group A streptococcus, GAS) are β haemolysis, are the important causes for causing intraocular inflammation
One of germ.
The primarily discrete culture of the clinical detection method for gram-positive bacterium at present, smear for microscopic examination and serology inspection
It surveys.These detection methods are cumbersome, and detection time is long, and sensitivity is low, be easy to happen missing inspection and false retrieval, are unable to satisfy and quickly detect
It is required that.The molecular detection technology to grow up in recent years, especially round pcr, in microorganism Rapid identification and context of detection
Using, for bacterium it is quick detect open new approach.But that there are detection times is long, easy to pollute, false positive rate is high by PCR
The shortcomings that, it is restricted its application.
Loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) is in recent years
Come a kind of sensitive, special, the simple, fast nucleic acid amplification technologies developed, principle is that have strand-displacement activity in one kind
Archaeal dna polymerase under the action of, identify 6-8 region 4-6 primer, under isothermal conditions quickly, specifically expand purpose
Gene can be applied to fast and accurately detection bacterium.In LAMP technology, primer is to determine testing result sensitivity and spy
Anisotropic key factor.
Summary of the invention
The technical problem to be solved by the present invention is to how detect gram-positive bacterium common in intraocular liquid.
In order to solve the above technical problems, present invention firstly provides a kind of combination of primer, can for following (a1) or (a2) or
(a3) or (a4) or (a5):
(a1) it is made of primer sets I, primer sets II, primer sets III, primer sets IV and primer sets V；
(a2) primer sets I；
(a3) by " any one in the primer sets II, the primer sets III, the primer sets IV and the primer sets V
It is a, any two, three or four any " and the primer sets I form；
(a4) by the primer sets I, the primer sets II, the primer sets III, the primer sets IV and the primer sets
Any two, any three or any four composition in V；
(a5) primer sets I, the primer sets II, the primer sets III, the primer sets IV or the primer sets V.
The primer sets I can be by I-F3 of primer, I-B3 of primer, I-FIP of primer, I-BIP of primer, I-LF of primer and primer I-
LB composition；
I-the F3 of primer can be following (b1) or (b2)；
(b1) single strand dna shown in the sequence 1 of sequence table；
(b2) sequence 1 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1
The DNA molecular of identical function；
I-the B3 of primer can be following (b3) or (b4)；
(b3) single strand dna shown in the sequence 2 of sequence table；
(b4) sequence 2 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2
The DNA molecular of identical function；
I-the FIP of primer can be following (b5) or (b6)；
(b5) single strand dna shown in the sequence 3 of sequence table；
(b6) sequence 3 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 3
The DNA molecular of identical function；
I-the BIP of primer can be following (b7) or (b8)；
(b7) single strand dna shown in the sequence 4 of sequence table；
(b8) sequence 4 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 4
The DNA molecular of identical function；
I-the LF of primer can be following (b9) or (b10)；
(b9) single strand dna shown in the sequence 5 of sequence table；
(b10) sequence 5 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 5
The DNA molecular of identical function；
I-the LB of primer can be following (b11) or (b12)；
(b11) single strand dna shown in the sequence 6 of sequence table；
(b12) sequence 6 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 6
The DNA molecular of identical function.
The primer sets II can by II-F3 of primer, II-B3 of primer, II-FIP of primer, II-BIP of primer, II-LF of primer and
II-LB of primer composition；
II-the F3 of primer can be following (c1) or (c2)；
(c1) single strand dna shown in the sequence 7 of sequence table；
(c2) sequence 7 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 7
The DNA molecular of identical function；
II-the B3 of primer can be following (c3) or (c4)；
(c3) single strand dna shown in the sequence 8 of sequence table；
(c4) sequence 8 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 8
The DNA molecular of identical function；
II-the FIP of primer can be following (c5) or (c6)；
(c5) single strand dna shown in the sequence 9 of sequence table；
(c6) sequence 9 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 9
The DNA molecular of identical function；
II-the BIP of primer can be following (c7) or (c8)；
(c7) single strand dna shown in the sequence 10 of sequence table；
(c8) sequence 10 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 10
There is the DNA molecular of identical function；
II-the LF of primer can be following (c9) or (c 10)；
(c9) single strand dna shown in the sequence 11 of sequence table；
(c10) sequence 11 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 11
There is the DNA molecular of identical function；
II-the LB of primer can be following (c11) or (c12)；
(c11) single strand dna shown in the sequence 12 of sequence table；
(c12) sequence 12 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 12
There is the DNA molecular of identical function.
The primer sets III can by III-F3 of primer, III-B3 of primer, III-FIP of primer, III-BIP of primer, III-LF of primer and
III-LB of primer composition；
III-the F3 of primer can be following (d1) or (d2)；
(d1) single strand dna shown in the sequence 13 of sequence table；
(d2) sequence 13 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 13
There is the DNA molecular of identical function；
III-the B3 of primer can be following (d3) or (d4)；
(d3) single strand dna shown in the sequence 14 of sequence table；
(d4) sequence 14 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 14
There is the DNA molecular of identical function；
III-the FIP of primer can be following (d5) or (d6)；
(d5) single strand dna shown in the sequence 15 of sequence table；
(d6) sequence 15 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 15
There is the DNA molecular of identical function；
III-the BIP of primer can be following (d7) or (d8)；
(d7) single strand dna shown in the sequence 16 of sequence table；
(d8) sequence 16 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 16
There is the DNA molecular of identical function；
III-the LF of primer can be following (d9) or (d10)；
(d9) single strand dna shown in the sequence 17 of sequence table；
(d10) sequence 17 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 17
There is the DNA molecular of identical function；
III-the LB of primer can be following (d11) or (d12)；
(d11) single strand dna shown in the sequence 18 of sequence table；
(d12) sequence 18 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 18
There is the DNA molecular of identical function.
The primer sets IV can by IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-BIP of primer, IV-LF of primer and
IV-LB of primer composition；
IV-the F3 of primer can be following (e1) or (e2)；
(e1) single strand dna shown in the sequence 19 of sequence table；
(e2) sequence 19 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 19
There is the DNA molecular of identical function；
IV-the B3 of primer can be following (e3) or (e4)；
(e3) single strand dna shown in the sequence 20 of sequence table；
(e4) sequence 20 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 20
There is the DNA molecular of identical function；
IV-the FIP of primer can be following (e5) or (e6)；
(e5) single strand dna shown in the sequence 21 of sequence table；
(e6) sequence 21 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 21
There is the DNA molecular of identical function；
IV-the BIP of primer can be following (e7) or (e8)；
(e7) single strand dna shown in the sequence 22 of sequence table；
(e8) sequence 22 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 22
There is the DNA molecular of identical function；
IV-the LF of primer can be following (e9) or (e10)；
(e9) single strand dna shown in the sequence 23 of sequence table；
(e10) sequence 23 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 23
There is the DNA molecular of identical function；
IV-the LB of primer can be following (e11) or (e12)；
(e11) single strand dna shown in the sequence 24 of sequence table；
(e12) have by sequence 24 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 24
There is the DNA molecular of identical function.
The primer sets V can by V-F3 of primer, V-B3 of primer, V-FIP of primer, V-BIP of primer, V-LF of primer and
V-LB of primer composition；
V-the F3 of primer can be following (f1) or (f2)；
(f1) single strand dna shown in the sequence 25 of sequence table；
(f2) sequence 25 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 25
There is the DNA molecular of identical function；
V-the B3 of primer can be following (f3) or (f4)；
(f3) single strand dna shown in the sequence 26 of sequence table；
(f4) sequence 26 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 26
There is the DNA molecular of identical function；
V-the FIP of primer can be following (f5) or (f6)；
(f5) single strand dna shown in the sequence 27 of sequence table；
(f6) sequence 27 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 27
There is the DNA molecular of identical function；
V-the BIP of primer can be following (f7) or (f8)；
(f7) single strand dna shown in the sequence 28 of sequence table；
(f8) sequence 28 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 28
There is the DNA molecular of identical function；
V-the LF of primer can be following (f9) or (f10)；
(f9) single strand dna shown in the sequence 29 of sequence table；
(f10) sequence 29 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 29
There is the DNA molecular of identical function；
V-the LB of primer can be following (f11) or (f12)；
(f11) single strand dna shown in the sequence 30 of sequence table；
(f12) sequence 30 is had by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 30
There is the DNA molecular of identical function.
In the primer sets I, I-F3 of primer, I-B3 of primer, I-FIP of primer, I-BIP of primer, I-LF of primer and primer I-
The molar ratio of LB concretely 0.5:0.5:2:2:1:1.
In the primer sets II, II-F3 of primer, II-B3 of primer, II-FIP of primer, II-BIP of primer, II-LF of primer and
The molar ratio of II-LB of primer concretely 0.5:0.5:2:2:1:1.
In the primer sets III, III-F3 of primer, III-B3 of primer, III-FIP of primer, III-BIP of primer, III-LF of primer and
The molar ratio of III-LB of primer concretely 0.5:0.5:2:2:1:1.
In the primer sets IV, IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-BIP of primer, IV-LF of primer and
The molar ratio of IV-LB of primer concretely 0.5:0.5:2:2:1:1.
In the primer sets V, V-F3 of primer, V-B3 of primer, V-FIP of primer, V-BIP of primer, V-LF of primer and
The molar ratio of V-LB of primer concretely 0.5:0.5:2:2:1:1.
The present invention also protects the primer to combine the application in reagent preparation box；The purposes of the kit can be as follows
(h1) or (h2):
(h1) identify staphylococcus epidermis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/
Or streptococcus pyogenes；
(h2) for whether detecting in sample to be tested containing staphylococcus epidermis and/or staphylococcus aureus and/or excrement
Enterococcus and/or enterococcus faecium and/or streptococcus pyogenes.
The present invention also protects the kit containing primer combination；The purposes of the kit can for following (h1) or
(h2):
(h1) identify staphylococcus epidermis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/
Or streptococcus pyogenes；
(h2) for whether detecting in sample to be tested containing staphylococcus epidermis and/or staphylococcus aureus and/or excrement
Enterococcus and/or enterococcus faecium and/or streptococcus pyogenes.
The present invention also protects the preparation method of the kit, includes the steps that individually packing each primer.
The present invention also protect a kind of detection bacterium to be measured whether be staphylococcus epidermis, staphylococcus aureus, enterococcus faecalis,
Enterococcus faecium or the method for streptococcus pyogenes, it may include following steps:
(1) genomic DNA of bacterium to be measured is extracted；
(2) each primer sets in the primer combination are respectively adopted as template in the genomic DNA extracted using step (1)
Ring mediated isothermal amplification is carried out, is then made the following judgment:
If the primer sets I is used to may be implemented using the genomic DNA as the specific amplification of template, bacterium to be measured is
Or candidate is staphylococcus epidermis；
If using the primer sets II to may be implemented using the genomic DNA as the specific amplification of template, bacterium to be measured
For or candidate be staphylococcus aureus；
If using the primer sets III to may be implemented using the genomic DNA as the specific amplification of template, bacterium to be measured
For or candidate be enterococcus faecalis；
If using the primer sets IV to may be implemented using the genomic DNA as the specific amplification of template, bacterium to be measured
For or candidate be enterococcus faecium；
If using the primer sets V to may be implemented using the genomic DNA as the specific amplification of template, bacterium to be measured
For or candidate be streptococcus pyogenes.
The present invention also protects in a kind of detection sample to be tested whether contain staphylococcus epidermis and/or staphylococcus aureus
And/or enterococcus faecalis and/or enterococcus faecium and/or the method for streptococcus pyogenes, it may include following steps:
(1) total DNA of sample to be tested is extracted；
(2) as template, each primer sets being respectively adopted in the primer combination carry out the total DNA extracted using step (1)
Then ring mediated isothermal amplification makes the following judgment:
If the primer sets I is used to may be implemented to contain in sample to be tested using the total DNA as the specific amplification of template
Have or doubtful containing staphylococcus epidermis；
If using the primer sets II to may be implemented using the total DNA as the specific amplification of template, in sample to be tested
Contain or doubtful containing staphylococcus aureus；
If using the primer sets III to may be implemented using the total DNA as the specific amplification of template, in sample to be tested
Contain or doubtful containing enterococcus faecalis；
If using the primer sets IV to may be implemented using the total DNA as the specific amplification of template, in sample to be tested
Contain or doubtful containing enterococcus faecium；
If using the primer sets V to may be implemented using the total DNA as the specific amplification of template, in sample to be tested
Contain or doubtful containing streptococcus pyogenes.
In any description above method, loop-mediated isothermal amplification system (10 μ L) can are as follows: 1 μ L10 × ThermoPol
BSA aqueous solution that glycine betaine that Buffer, 1.6 μ L concentration are 5M, 0.1 μ L concentration are 50mg/mL, 0.4 μ L concentration are 100mM's
MgSO4DNTPs (every kind) that aqueous solution, 0.3 20 × EvaGreen of μ L, 0.15 μ L concentration are 100mM, 0.4 μ L concentration are 8U/
The Bst archaeal dna polymerase large fragment of mL, template (about 50pg-50ng), 1 μ L primer mixture, moisturizing to 10 μ L.Primer mixture
The mixture of each primer composition i.e. in primer sets.The production of 10 × ThermoPol Buffer concretely Thermo company
Product.The product of 20 × EvaGreen concretely Hefei Bo Mei biotech firm.
In any description above method, when using the primer sets I, draw in the reaction system of the ring mediated isothermal amplification
I-F3 of object, I-B3 of primer, I-FIP of primer, I-LB of I-BIP of primer, I-LF of primer and primer molar concentration be followed successively by 0.5 μM,
0.5μM、2μM、2μM、1μM、1μM。
In any description above method, when using the primer sets II, in the reaction system of the ring mediated isothermal amplification
II-F3 of primer, II-B3 of primer, II-FIP of primer, II-LB of II-BIP of primer, II-LF of primer and primer molar concentration successively
It is 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any description above method, when using the primer sets III, in the reaction system of the ring mediated isothermal amplification
III-F3 of primer, III-B3 of primer, III-FIP of primer, III-LB of III-BIP of primer, III-LF of primer and primer molar concentration successively
It is 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any description above method, when using the primer sets IV, in the reaction system of the ring mediated isothermal amplification
IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-LB of IV-BIP of primer, IV-LF of primer and primer molar concentration successively
It is 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any description above method, when using the primer sets V, in the reaction system of the ring mediated isothermal amplification
V-F3 of primer, V-B3 of primer, V-FIP of primer, V-LB of V-BIP of primer, V-LF of primer and primer molar concentration successively
It is 0.5 μM, 0.5 μM, 2 μM, 2 μM, 1 μM, 1 μM.
In any description above method, loop-mediated isothermal amplification condition are as follows: 65 DEG C of constant temperature 50min.
Whether it is staphylococcus epidermis, Staphylococcus aureus that the present invention also protects the primer to combine detecting bacterium to be measured
Application in bacterium, enterococcus faecalis, enterococcus faecium or streptococcus pyogenes.
The present invention also protects whether primer combination contains staphylococcus epidermis and/or golden yellow in detection sample to be tested
Application in color staphylococcus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes.
Any of the above-described sample to be tested can be eye aspirate sample (i.e. intraocular liquid).
Any of the above-described staphylococcus epidermis can specifically record in following document: Zhang Zhiming, Li Jianping, Zhu Jianwei
.16S rRNA causes application [J] Tropical China medicine in bloodstream infection in detection Klebsiella Pneumoniae, 2011,11 (3):
272-273..Any of the above-described staphylococcus aureus can specifically record in following document: Wu Wei, He Meifeng, Tang Xilan,
Equal eye bacterium infection pathogen distribution and drug resistance analysis [J] Journal of Chinese Hospital Pharmacy, 2010,30 (20): 1786-
1788..Any of the above-described enterococcus faecalis and any of the above-described enterococcus faecium can specifically record in following document: Sun Yan
Beauty, Ju Xiaohong, Su Lijuan wait the Clinical symptoms of enterococcus faecalis and Enterococcus faecium infections and drug resistance comparative analysis [J] modern
Preventive medicine, 2014,41 (1): 125-127..Any of the above-described streptococcus pyogenes can specifically record in following document: beam
Yun Mei, Yang Yonghong, Yu Sangjie wait .2011 to 2013 years Yangfangdian, Haidian District, Beijing City Community children pharynogotonsillitis to make purulence
Streptococcus molecular biological characteristics [J] China Applied Clinical Pediatrics magazine, 2014,29 (16): 1220-1223..
Loop-mediated isothermal amplification technique (loop-mediated isothermal amplification, LAMP) is in recent years
Come a kind of sensitive, special, the simple, fast nucleic acid amplification technologies developed, principle is that have strand-displacement activity in one kind
Archaeal dna polymerase under the action of, identify 6-8 region 4-6 primer, under isothermal conditions quickly, specifically expand purpose
Gene can be applied to and fast and accurately detect 5 kinds of gram-positive bacteriums common in intraocular liquid.LAMP method has
Sensitivity is high, specificity is good, the reaction time is short, determines that result is convenient, does not need the advantages such as expensive instrument.
Primer sets provided by the invention are shared in detecting 5 kinds of gram-positive bacteriums common in intraocular liquid, have Gao Te
It is anisotropic and highly sensitive, easy, quick, accurate detection may be implemented.The present invention has great promotional value.
Detailed description of the invention
Fig. 1 is the testing result of embodiment 2.
Fig. 2 is the testing result of embodiment 4.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified certainly
What routine biochemistry reagent shop was commercially available.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result makes even
Mean value.
10 × ThermoPol Buffer is the product of Thermo company.20 × EvaGreen is Hefei Bo Mei biotech firm
Product.
In staphylococcus epidermis record and following document in following embodiments: Zhang Zhiming, Li Jianping, Zhu Jianwei .16S
RRNA causes application [J] Tropical China medicine in bloodstream infection, 2011,11 (3): 272- in detection Klebsiella Pneumoniae
273.。
In staphylococcus aureus record and following document in following embodiments: Wu Wei, He Meifeng, Tang Xilan wait
The distribution of portion bacterium infection pathogen and drug resistance analysis [J] Journal of Chinese Hospital Pharmacy, 2010,30 (20): 1786-1788..
Enterococcus faecalis and enterococcus faecium in following embodiments record with following document in: Sun Yanmei, Ju Xiaohong, Su Li
Juan, waits the Clinical symptoms and drug resistance comparative analysis [J] modern preventive medicine of enterococcus faecalis and Enterococcus faecium infections, and 2014,
41(1):125-127.。
In streptococcus pyogenes record and following document in following embodiments: Liang Yunmei, Yang Yonghong, Yu Sangjie wait .2011
Year was into Yangfangdian, Haidian District, Beijing City Community children pharynogotonsillitis streptococcus pyogenes molecular biological characteristics [J] in 2013
Magnificent Applied Clinical Pediatrics magazine, 2014,29 (16): 1220-1223..
The preparation of embodiment 1, kit
Kit is made of five LAMP primer groups, and each primer sets are thin for detecting a kind of Gram-positive in intraocular liquid
Bacterium.
It is following (5 ' → 3 ') for detecting staphylococcus epidermis primer sets:
Outer primer F3 (sequence 1): ATTgAgATAgCgggggA；
Outer primer B3 (sequence 2): ACAACAAAgTAACAgTACCATg；
Inner primer FIP (sequence 3): gCgTCATgCCTTTATTTgAAgAAAATgTACAgTCATAgCTAgTggA；
Inner primer BIP (sequence 4): ACAggAgTAAATTCAgTgATTgCAATTCCgCAACTTACAAAACATg；
Ring primer LF (sequence 5): TTATATgTATgTgCCCAAATCACA；
Ring primer LB (sequence 6): CCAATTgATTggAAAggATTTgATC.
It is following (5 ' → 3 ') for detecting staphylococcus aureus primer sets:
Outer primer F3 (sequence 7): gCAACTgAAACAACAgAAgC；
Outer primer B3 (sequence 8): TTTTgTgTTgggCgAgC；
Inner primer FIP (sequence 9): TCACggATACCTgTACCAgCATCTCTATggTCCgAgACCgCAATT；
Inner primer BIP (sequence 10): ggAACATTTggATATgAAgCgAgACTgCCATCTTgATTTgTCgTTAC；Ring
Primer LF (sequence 11): TTTCACATACTTAggTgTTTTgT；
Ring primer LB (sequence 12): CCAAgTgAAACAAATgCATACAAC.
It is following (5 ' → 3 ') for detecting enterococcus faecalis primer sets:
Outer primer F3 (sequence 13): TTATCGAGGCTTCCAAGAA；
Outer primer B3 (sequence 14): TCGTATTCGCACGCTCA；
Inner primer FIP (sequence 15): AGCTTGAAAACTACGACTATCGCTACGCAATCGTCCAATCGG；
Inner primer BIP (sequence 16): ATTACGCAACAGTTGATTGCCAAATCATTTTAAGCATTTCCGCG；
Ring primer LF (sequence 17): TTTCTGTGCTCTCGCTCTG；
Ring primer LB (sequence 18): CAACAAATGGATGAAGCCAAAG.
It is following (5 ' → 3 ') for detecting enterococcus faecium primer sets:
Outer primer F3 (sequence 19): AGTCGTAAAAGACGTAGCA；
Outer primer B3 (sequence 20): TCCCATAAGAGTGGGTACA；
Inner primer FIP (sequence 21): TCGCGTACTCTTGCGCTTATGCAGATTCCAGCCGA；
Inner primer BIP (sequence 22): GGTGGAAGCGGATTGAGCCGGGCATAGAGTTTAATTCATTCAGG；
Ring primer LF (sequence 23): GATAAACTTCTTCTGGCACT；
Ring primer LB (sequence 24): GTGCGATTTCTTTTTGACAA.
It is following (5 ' → 3 ') for detecting streptococcus pyogenes primer sets:
Outer primer F3 (sequence 25): gTTgTTAATgCTTTATCAACACA；
Outer primer B3 (sequence 26): gCgCTTATCTgTAATggAAAT；
Inner primer FIP (sequence 27): CAgTggTTCCAATgACCTCAAgATTCATTACCAAgAATTTAAACgCg；
Inner primer BIP (sequence 28): ACACCCgATCCAgAAATTTTTACCAAAggCTAACTCTTgAATACgT；
Ring primer LF (sequence 29): TCTgCTACAACAgCCC；
Ring primer LB (sequence 30): AAACgACTCAgTTTgATTACAgT.
Primer sets for detecting staphylococcus epidermis are named as primer sets I.For detecting drawing for staphylococcus aureus
Object group is named as primer sets II.Primer sets for detecting enterococcus faecalis are named as primer sets III.For detecting enterococcus faecium
Primer sets are named as primer sets IV.Primer sets for detecting streptococcus pyogenes are named as primer sets V.
Embodiment 2, specificity
Sample to be tested 1: staphylococcus epidermis.
Sample to be tested 2: staphylococcus aureus.
Sample to be tested 3: enterococcus faecalis.
Sample to be tested 4: enterococcus faecium.
Sample to be tested 5: streptococcus pyogenes.
Each sample to be tested carries out following steps respectively:
1, the genomic DNA of sample to be tested is extracted.
2, for the genomic DNA extracted using step 1 as template, each primer sets that the preparation of embodiment 1 is respectively adopted carry out ring
Mediated isothermality amplification.
Reaction system (10 μ L): 1 μ L 10 × ThermoPol Buffer, glycine betaine, the 0.1 μ L that 1.6 μ L concentration are 5M are dense
Spend the BSA aqueous solution for being 50mg/mL, the MgSO that 0.4 μ L concentration is 100mM4Aqueous solution, 0.3 μ L20 × EvaGreen, 0.15 μ L
DNTPs (every kind) that concentration is 100mM, the Bst archaeal dna polymerase large fragment that 0.4 μ L concentration is 8U/mL, sample to be tested gene
Group DNA (between 50pg-50ng), 1 μ L primer mixture, moisturizing to 10 μ L.Each item in primer mixture, that is, primer sets draws
The mixture of object composition.In reaction system, the final concentration of outer primer F3 and outer primer B3 are 0.5 μM, inner primer FIP and interior are drawn
The final concentration of object BIP is 2 μM, and the final concentration of ring primer LF and ring primer LB are 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
In reaction process, fluorescence signal is detected using fluorescent PCR instrument.Using recurring number as abscissa, fluorescence signal intensity is
Ordinate draws amplification curve.
According to the method described above, the genomic DNA of sample to be tested is replaced with into sterilizing ultrapure water, other steps are constant, make
For negative control.
Using A in the result is shown in Figure 1 of primer sets I.Only the positive is shown when sample to be tested is staphylococcus epidermis
Amplification curve (i.e. amplification curve is " S type " amplification curve).It is not shown when sample to be tested is sample to be tested 2,3,4,5
Positive amplification curve.
Using B in the result is shown in Figure 1 of primer sets II.Only sun is shown when sample to be tested is staphylococcus aureus
Property amplification curve (i.e. amplification curve be " S type " amplification curve).It is not shown when sample to be tested is sample to be tested 1,3,4,5
Show positive amplification curve.
Using C in the result is shown in Figure 1 of primer sets III.Only positive amplification is shown when sample to be tested is enterococcus faecalis
Curve (i.e. amplification curve is " S type " amplification curve).The positive is not shown when sample to be tested is sample to be tested 1,2,4,5
Amplification curve.
Using D in the result is shown in Figure 1 of primer sets IV.Only positive amplification is shown when sample to be tested is enterococcus faecium
Curve (i.e. amplification curve is " S type " amplification curve).The positive is not shown when sample to be tested is sample to be tested 1,2,3,5
Amplification curve.
Using E in the result is shown in Figure 1 of primer sets V.Positive expansion is only shown when sample to be tested is streptococcus pyogenes
Increase curve (i.e. amplification curve is " S type " amplification curve).Sun is not shown when sample to be tested is sample to be tested 1,2,3,4
Property amplification curve.
The above result shows that five primer sets provided by the invention have very high specificity to its target bacterium respectively.
Embodiment 3, sensitivity
Sample to be tested 1: staphylococcus epidermis.
Sample to be tested 2: staphylococcus aureus.
Sample to be tested 3: enterococcus faecalis.
Sample to be tested 4: enterococcus faecium.
Sample to be tested 5: streptococcus pyogenes.
Each sample to be tested carries out following steps respectively:
1, the genomic DNA for extracting sample to be tested, carries out gradient dilution with sterile water, obtains each dilution.
2, for the dilution obtained using step 1 as template, the primer sets that the preparation of embodiment 1 is respectively adopted carry out ring mediated isothermal
Amplification.
When sample to be tested is sample to be tested 1, ring mediated isothermal amplification is carried out using primer sets I.Sample to be tested is to test sample
When sheet 2, ring mediated isothermal amplification is carried out using primer sets II.When sample to be tested is sample to be tested 3, ring is carried out using primer sets III
Mediated isothermality amplification.When sample to be tested is sample to be tested 4, ring mediated isothermal amplification is carried out using primer sets IV.Sample to be tested is
When sample to be tested 5, ring mediated isothermal amplification is carried out using primer sets V.
Reaction system (10 μ L): 1 μ L 10 × ThermoPol Buffer, glycine betaine, the 0.1 μ L that 1.6 μ L concentration are 5M are dense
Spend the BSA aqueous solution for being 50mg/mL, the MgSO that 0.4 μ L concentration is 100mM4Aqueous solution, 0.3 μ L20 × EvaGreen, 0.15 μ L
Bst archaeal dna polymerase large fragment that dNTPs (every kind) that concentration is 100mM, 0.4 μ L concentration are 8U/mL, 1 μ L dilution (1 μ L
The genome copy numbers contained in dilution are 104It is a, 103It is a, 5 × 102It is a or 102It is a), 1 μ L primer mixture, moisturizing is extremely
10μL.The mixture of each primer composition in primer mixture, that is, primer sets.In reaction system, outer primer F3 and outer primer B3
Final concentration be 0.5 μM, the final concentration of inner primer FIP and inner primer BIP are 2 μM, the end of ring primer LF and ring primer LB
Concentration is 1 μM.
Reaction condition: 65 DEG C of constant temperature 50min.
In reaction process, fluorescence signal is detected using fluorescent PCR instrument.Using recurring number as abscissa, fluorescence signal intensity is
Ordinate draws amplification curve.
If occurring positive amplification curve (i.e. amplification curve is " S type " amplification curve) in 50min, show reaction system
In corresponding gene group content can be detected.If not occurring positive amplification curve in 50min, show reactant
Corresponding gene group content in system cannot be detected.
The sensitivity that primer sets I detect target bacterium is 5 × 102A copy number/reaction system, primer sets II detect target bacterium
Sensitivity be 5 × 102A copy number/reaction system, the sensitivity that primer sets III detect target bacterium is 5 × 102A copy number/
Reaction system, the sensitivity that primer sets IV detect target bacterium is 5 × 102A copy number/reaction system, primer sets V detect target
The sensitivity of bacterium is 5 × 102A copy number/reaction system.
Embodiment 4, application
Sample to be tested is sample one, sample two, sample three, sample four, sample five or sample six:
Sample one: clinical identification is eye aspirate sample (the abbreviation staphylococcus epidermis sun of the staphylococcus epidermis positive
Property sample).
Sample two: clinical identification is eye aspirate sample (the abbreviation Staphylococcus aureus of S. aureus-positive
Bacterium positive sample).
Sample three: clinical identification is the eye aspirate sample (abbreviation enterococcus faecalis positive sample) of the enterococcus faecalis positive.
Sample four: clinical identification is the eye aspirate sample (abbreviation enterococcus faecium positive sample) of the enterococcus faecium positive.
Sample five: clinical identification is eye aspirate sample (the abbreviation streptococcus pyogenes positive sample of the streptococcus pyogenes positive
This).
Sample six: clinical identification there is no staphylococcus epidermis, staphylococcus aureus, enterococcus faecalis, enterococcus faecium and
The eye aspirate sample (abbreviation healthy person sample) of the healthy person of streptococcus pyogenes.
1, the total DNA of sample to be tested is extracted.
2, for the total DNA extracted using step 1 as template, each primer sets that the preparation of embodiment 1 is respectively adopted carry out ring mediation
Isothermal duplication.
Reaction system and reaction condition are the same as embodiment 2.
In reaction process, fluorescence signal is detected using fluorescent PCR instrument.Using recurring number as abscissa, fluorescence signal intensity is
Ordinate draws amplification curve.
According to the method described above, the total DNA of sample to be tested is replaced with into sterilizing ultrapure water, other steps are constant, as yin
Property control.
When detection sample a period of time, according to the method described above, the total DNA of sample to be tested is replaced with to the gene of staphylococcus epidermis
Group DNA, other steps are constant, as positive control.
When detecting sample two, according to the method described above, the total DNA of sample to be tested is replaced with to the base of staphylococcus aureus
Because of a group DNA, other steps are constant, as positive control.
When detecting sample three, according to the method described above, the total DNA of sample to be tested is replaced with to the genome of enterococcus faecalis
DNA, other steps are constant, as positive control.
When detecting sample four, according to the method described above, the total DNA of sample to be tested is replaced with to the genome of enterococcus faecium
DNA, other steps are constant, as positive control.
When detecting sample five, according to the method described above, the total DNA of sample to be tested is replaced with to the genome of streptococcus pyogenes
DNA, other steps are constant, as positive control.
A in Fig. 2 is shown in using the result of primer sets I.Positive amplification song is only shown when sample to be tested is sample one
Line (i.e. amplification curve is " S type " amplification curve).It is not shown when sample to be tested is sample to be tested two, three, four, five, six
Show positive amplification curve.
B in Fig. 2 is shown in using the result of primer sets II.Positive amplification song is only shown when sample to be tested is sample two
Line (i.e. amplification curve is " S type " amplification curve).It is not shown when sample to be tested is sample to be tested one, three, four, five, six
Show positive amplification curve.
C in Fig. 2 is shown in using the result of primer sets III.Positive amplification song is only shown when sample to be tested is sample three
Line (i.e. amplification curve is " S type " amplification curve).It is not shown when sample to be tested is sample to be tested one, two, four, five, six
Show positive amplification curve.
D in Fig. 2 is shown in using the result of primer sets IV.Positive amplification song is only shown when sample to be tested is sample four
Line (i.e. amplification curve is " S type " amplification curve).It is not shown when sample to be tested is sample to be tested one, two, three, five, six
Show positive amplification curve.
E in Fig. 2 is shown in using the result of primer sets V.Positive amplification song is only shown when sample to be tested is sample five
Line (i.e. amplification curve is " S type " amplification curve).It is not shown when sample to be tested is sample to be tested one, two, three, four, six
Show positive amplification curve.
The above result shows that carrying out in intraocular liquid 5 kinds of gram-positive bacteriums using primer provided by the invention combination
Detection, as a result accurately and reliably.
<110>intelligence moral in Beijing is attained and Co., Ltd, medical test institute
<120>a kind of for detecting the LAMP primer composition and application of 5 kinds of gram-positive bacteriums in intraocular liquid
<160> 30
<170> PatentIn version 3.5
<210> 1
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 1
attgagatag cggggga 17
<210> 2
<211> 22
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 2
acaacaaagt aacagtacca tg 22
<210> 3
<211> 46
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 3
gcgtcatgcc tttatttgaa gaaaatgtac agtcatagct agtgga 46
<210> 4
<211> 46
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 4
acaggagtaa attcagtgat tgcaattccg caacttacaa aacatg 46
<210> 5
<211> 24
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 5
ttatatgtat gtgcccaaat caca 24
<210> 6
<211> 25
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 6
ccaattgatt ggaaaggatt tgatc 25
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 7
gcaactgaaa caacagaagc 20
<210> 8
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 8
ttttgtgttg ggcgagc 17
<210> 9
<211> 45
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 9
tcacggatac ctgtaccagc atctctatgg tccgagaccg caatt 45
<210> 10
<211> 47
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 10
ggaacatttg gatatgaagc gagactgcca tcttgatttg tcgttac 47
<210> 11
<211> 23
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 11
tttcacatac ttaggtgttt tgt 23
<210> 12
<211> 24
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 12
ccaagtgaaa caaatgcata caac 24
<210> 13
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 13
ttatcgaggc ttccaagaa 19
<210> 14
<211> 17
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 14
tcgtattcgc acgctca 17
<210> 15
<211> 42
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 15
agcttgaaaa ctacgactat cgctacgcaa tcgtccaatc gg 42
<210> 16
<211> 44
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 16
attacgcaac agttgattgc caaatcattt taagcatttc cgcg 44
<210> 17
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 17
tttctgtgct ctcgctctg 19
<210> 18
<211> 22
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 18
caacaaatgg atgaagccaa ag 22
<210> 19
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 19
agtcgtaaaa gacgtagca 19
<210> 20
<211> 19
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 20
tcccataaga gtgggtaca 19
<210> 21
<211> 35
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 21
tcgcgtactc ttgcgcttat gcagattcca gccga 35
<210> 22
<211> 44
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 22
ggtggaagcg gattgagccg ggcatagagt ttaattcatt cagg 44
<210> 23
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 23
gataaacttc ttctggcact 20
<210> 24
<211> 20
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 24
gtgcgatttc tttttgacaa 20
<210> 25
<211> 23
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 25
gttgttaatg ctttatcaac aca 23
<210> 26
<211> 21
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 26
gcgcttatct gtaatggaaa t 21
<210> 27
<211> 47
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 27
cagtggttcc aatgacctca agattcatta ccaagaattt aaacgcg 47
<210> 28
<211> 46
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 28
acacccgatc cagaaatttt taccaaaggc taactcttga atacgt 46
<210> 29
<211> 16
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 29
tctgctacaa cagccc 16
<210> 30
<211> 23
<212> DNA
<213>artificial sequence
<220>
<223>
<400> 30
aaacgactca gtttgattac agt 23
Claims (8)
1. primer combines, for as follows (a1) or (a2) or (a3) or (a4) or (a5):
(a1) it is made of primer sets I, primer sets II, primer sets III, primer sets IV and primer sets V；
(a2) primer sets I；
(a3) by " in the primer sets II, the primer sets III, the primer sets IV and the primer sets V any one,
It is any two, three or four any " and the primer sets I form；
(a4) by the primer sets I, the primer sets II, the primer sets III, the primer sets IV and the primer sets V
Any two, it is any three or any four composition；
(a5) primer sets I, the primer sets II, the primer sets III, the primer sets IV or the primer sets V；
The primer sets I are by I-F3 of primer, I-B3 of primer, I-FIP of primer, I-LB group of I-BIP of primer, I-LF of primer and primer
At；
I-the F3 of primer is following (b1) or (b2)；
(b1) single strand dna shown in the sequence 1 of sequence table；
(b2) have by sequence 1 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 1 identical
The DNA molecular of function；
I-the B3 of primer is following (b3) or (b4)；
(b3) single strand dna shown in the sequence 2 of sequence table；
(b4) have by sequence 2 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 2 identical
The DNA molecular of function；
I-the FIP of primer is following (b5) or (b6)；
(b5) single strand dna shown in the sequence 3 of sequence table；
(b6) have by sequence 3 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 3 identical
The DNA molecular of function；
I-the BIP of primer is following (b7) or (b8)；
(b7) single strand dna shown in the sequence 4 of sequence table；
(b8) have by sequence 4 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 4 identical
The DNA molecular of function；
I-the LF of primer is following (b9) or (b10)；
(b9) single strand dna shown in the sequence 5 of sequence table；
(b10) have by sequence 5 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 5 identical
The DNA molecular of function；
I-the LB of primer is following (b11) or (b12)；
(b11) single strand dna shown in the sequence 6 of sequence table；
(b12) have by sequence 6 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 6 identical
The DNA molecular of function；
The primer sets II are by II-F3 of primer, II-B3 of primer, II-FIP of primer, II-BIP of primer, II-LF of primer and primer
II-LB composition；
II-the F3 of primer is following (c1) or (c2)；
(c1) single strand dna shown in the sequence 7 of sequence table；
(c2) have by sequence 7 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 7 identical
The DNA molecular of function；
II-the B3 of primer is following (c3) or (c4)；
(c3) single strand dna shown in the sequence 8 of sequence table；
(c4) have by sequence 8 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 8 identical
The DNA molecular of function；
II-the FIP of primer is following (c5) or (c6)；
(c5) single strand dna shown in the sequence 9 of sequence table；
(c6) have by sequence 9 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 9 identical
The DNA molecular of function；
II-the BIP of primer is following (c7) or (c8)；
(c7) single strand dna shown in the sequence 10 of sequence table；
(c8) there is phase by sequence 10 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 10
The DNA molecular of congenerous；
II-the LF of primer is following (c9) or (c 10)；
(c9) single strand dna shown in the sequence 11 of sequence table；
(c10) there is phase by sequence 11 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 11
The DNA molecular of congenerous；
II-the LB of primer is following (c11) or (c12)；
(c11) single strand dna shown in the sequence 12 of sequence table；
(c12) there is phase by sequence 12 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 12
The DNA molecular of congenerous；
The primer sets III are by III-F3 of primer, III-B3 of primer, III-FIP of primer, III-BIP of primer, III-LF of primer and primer
III-LB composition；
III-the F3 of primer is following (d1) or (d2)；
(d1) single strand dna shown in the sequence 13 of sequence table；
(d2) there is phase by sequence 13 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 13
The DNA molecular of congenerous；
III-the B3 of primer is following (d3) or (d4)；
(d3) single strand dna shown in the sequence 14 of sequence table；
(d4) there is phase by sequence 14 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 14
The DNA molecular of congenerous；
III-the FIP of primer is following (d5) or (d6)；
(d5) single strand dna shown in the sequence 15 of sequence table；
(d6) there is phase by sequence 15 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 15
The DNA molecular of congenerous；
III-the BIP of primer is following (d7) or (d8)；
(d7) single strand dna shown in the sequence 16 of sequence table；
(d8) there is phase by sequence 16 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 16
The DNA molecular of congenerous；
III-the LF of primer is following (d9) or (d10)；
(d9) single strand dna shown in the sequence 17 of sequence table；
(d10) there is phase by sequence 17 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 17
The DNA molecular of congenerous；
III-the LB of primer is following (d11) or (d12)；
(d11) single strand dna shown in the sequence 18 of sequence table；
(d12) there is phase by sequence 18 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 18
The DNA molecular of congenerous；
The primer sets IV are by IV-F3 of primer, IV-B3 of primer, IV-FIP of primer, IV-BIP of primer, IV-LF of primer and primer
IV-LB composition；
IV-the F3 of primer is following (e1) or (e2)；
(e1) single strand dna shown in the sequence 19 of sequence table；
(e2) there is phase by sequence 19 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 19
The DNA molecular of congenerous；
IV-the B3 of primer is following (e3) or (e4)；
(e3) single strand dna shown in the sequence 20 of sequence table；
(e4) there is phase by sequence 20 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 20
The DNA molecular of congenerous；
IV-the FIP of primer is following (e5) or (e6)；
(e5) single strand dna shown in the sequence 21 of sequence table；
(e6) there is phase by sequence 21 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 21
The DNA molecular of congenerous；
IV-the BIP of primer is following (e7) or (e8)；
(e7) single strand dna shown in the sequence 22 of sequence table；
(e8) there is phase by sequence 22 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 22
The DNA molecular of congenerous；
IV-the LF of primer is following (e9) or (e10)；
(e9) single strand dna shown in the sequence 23 of sequence table；
(e10) there is phase by sequence 23 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 23
The DNA molecular of congenerous；
IV-the LB of primer is following (e11) or (e12)；
(e11) single strand dna shown in the sequence 24 of sequence table；
(e12) there is phase by sequence 24 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 24
The DNA molecular of congenerous；
The primer sets V are by V-F3 of primer, V-B3 of primer, V-FIP of primer, V-BIP of primer, V-LF of primer and primer
V-LB composition；
V-the F3 of primer is following (f1) or (f2)；
(f1) single strand dna shown in the sequence 25 of sequence table；
(f2) there is phase by sequence 25 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 25
The DNA molecular of congenerous；
V-the B3 of primer is following (f3) or (f4)；
(f3) single strand dna shown in the sequence 26 of sequence table；
(f4) there is phase by sequence 26 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 26
The DNA molecular of congenerous；
V-the FIP of primer is following (f5) or (f6)；
(f5) single strand dna shown in the sequence 27 of sequence table；
(f6) there is phase by sequence 27 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 27
The DNA molecular of congenerous；
V-the BIP of primer is following (f7) or (f8)；
(f7) single strand dna shown in the sequence 28 of sequence table；
(f8) there is phase by sequence 28 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 28
The DNA molecular of congenerous；
V-the LF of primer is following (f9) or (f10)；
(f9) single strand dna shown in the sequence 29 of sequence table；
(f10) there is phase by sequence 29 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 29
The DNA molecular of congenerous；
V-the LB of primer is following (f11) or (f12)；
(f11) single strand dna shown in the sequence 30 of sequence table；
(f12) there is phase by sequence 30 by the substitution and/or deletion and/or addition of one or several nucleotide and with sequence 30
The DNA molecular of congenerous.
2. primer described in claim 1 combines the application in reagent preparation box；The purposes of the kit be following (h1) or
(h2):
(h1) staphylococcus epidermis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or wine are identified
Streptococcus pyrogenes；
(h2) for whether detecting in sample to be tested containing staphylococcus epidermis and/or staphylococcus aureus and/or excrement intestines ball
Bacterium and/or enterococcus faecium and/or streptococcus pyogenes.
3. the kit containing the combination of primer described in claim 1；The purposes of the kit is following (h1) or (h2):
(h1) staphylococcus epidermis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or wine are identified
Streptococcus pyrogenes；
(h2) for whether detecting in sample to be tested containing staphylococcus epidermis and/or staphylococcus aureus and/or excrement intestines ball
Bacterium and/or enterococcus faecium and/or streptococcus pyogenes.
4. the preparation method of kit described in claim 3 includes the steps that individually packing each primer.
5. whether a kind of detection bacterium to be measured is staphylococcus epidermis, staphylococcus aureus, enterococcus faecalis, enterococcus faecium or makes purulence
Streptococcic method, includes the following steps:
(1) genomic DNA of bacterium to be measured is extracted；
(2) genomic DNA extracted using step (1) is respectively adopted each of combination of primer described in claim 1 and drawn as template
Object group carries out ring mediated isothermal amplification, then makes the following judgment:
If the primer sets I is used to may be implemented using the genomic DNA as the specific amplification of template, bacterium to be measured is or waits
It is selected as staphylococcus epidermis；
If the primer sets II is used to may be implemented using the genomic DNA as the specific amplification of template, bacterium to be measured be or
Candidate is staphylococcus aureus；
If the primer sets III is used to may be implemented using the genomic DNA as the specific amplification of template, bacterium to be measured be or
Candidate is enterococcus faecalis；
If the primer sets IV is used to may be implemented using the genomic DNA as the specific amplification of template, bacterium to be measured be or
Candidate is enterococcus faecium；
If the primer sets V is used to may be implemented using the genomic DNA as the specific amplification of template, bacterium to be measured be or
Candidate is streptococcus pyogenes.
6. whether containing staphylococcus epidermis and/or staphylococcus aureus and/or enterococcus faecalis in a kind of detection sample to be tested
And/or enterococcus faecium and/or the method for streptococcus pyogenes, include the following steps:
(1) total DNA of sample to be tested is extracted；
(2) each primer sets in the combination of primer described in claim 1 are respectively adopted as template in the total DNA extracted using step (1)
Ring mediated isothermal amplification is carried out, is then made the following judgment:
If using the primer sets I may be implemented using the total DNA as the specific amplification of template, contain in sample to be tested or
It is doubtful to contain staphylococcus epidermis；
If the primer sets II is used to may be implemented to contain in sample to be tested using the total DNA as the specific amplification of template
Or doubtful contain staphylococcus aureus；
If the primer sets III is used to may be implemented to contain in sample to be tested using the total DNA as the specific amplification of template
Or doubtful contain enterococcus faecalis；
If the primer sets IV is used to may be implemented to contain in sample to be tested using the total DNA as the specific amplification of template
Or doubtful contain enterococcus faecium；
If the primer sets V is used to may be implemented to contain in sample to be tested using the total DNA as the specific amplification of template
Or doubtful contain streptococcus pyogenes.
7. whether the combination of primer described in claim 1 is staphylococcus epidermis, staphylococcus aureus, excrement intestines detecting bacterium to be measured
Application in coccus, enterococcus faecium or streptococcus pyogenes.
8. whether the combination of primer described in claim 1 contains staphylococcus epidermis and/or golden yellow Portugal in detection sample to be tested
Application in grape coccus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810113531.XA CN110129459B (en) | 2018-02-05 | 2018-02-05 | LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810113531.XA CN110129459B (en) | 2018-02-05 | 2018-02-05 | LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110129459A true CN110129459A (en) | 2019-08-16 |
| CN110129459B CN110129459B (en) | 2023-02-24 |
Family
ID=67567419
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810113531.XA Active CN110129459B (en) | 2018-02-05 | 2018-02-05 | LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110129459B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109402277A (en) * | 2018-12-13 | 2019-03-01 | 博奥生物集团有限公司 | For quickly detecting the LAMP primer composition and application of enterococcus faecalis and enterococcus faecium |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1248295A (en) * | 1996-11-04 | 2000-03-22 | 感染诊断(I.D.I)公司 | Species-specific genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes |
| CN106367413A (en) * | 2016-09-05 | 2017-02-01 | 博奥生物集团有限公司 | Nucleic acid amplification method and application |
| CN107541509A (en) * | 2016-06-29 | 2018-01-05 | 博奥生物集团有限公司 | For detecting the LAMP primer composition and its application of 6 kinds of infectious agents of mastitis for milk cows |
-
2018
- 2018-02-05 CN CN201810113531.XA patent/CN110129459B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1248295A (en) * | 1996-11-04 | 2000-03-22 | 感染诊断(I.D.I)公司 | Species-specific genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes |
| CN107541509A (en) * | 2016-06-29 | 2018-01-05 | 博奥生物集团有限公司 | For detecting the LAMP primer composition and its application of 6 kinds of infectious agents of mastitis for milk cows |
| CN106367413A (en) * | 2016-09-05 | 2017-02-01 | 博奥生物集团有限公司 | Nucleic acid amplification method and application |
Non-Patent Citations (4)
| Title |
|---|
| FRED M WILSON Ⅱ: "眼内炎的病因及其预防", 《国外医学眼科学分册》 * |
| ROLAND MARTZY等: "A loop-mediated isothermal amplification (LAMP) assay for the rapid detection of Enterococcus spp. in water", 《WATER RESEARCH》 * |
| 李新圃 等: "奶牛乳房炎致病菌的分离鉴定及耐药性研究", 《动物医学进展》 * |
| 梁莉 等: "细菌性眼内炎31例", 《武警医学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109402277A (en) * | 2018-12-13 | 2019-03-01 | 博奥生物集团有限公司 | For quickly detecting the LAMP primer composition and application of enterococcus faecalis and enterococcus faecium |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110129459B (en) | 2023-02-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20180135108A1 (en) | Method for detecting bacterial and fungal pathogens | |
| CN106661606A (en) | Method for detecting and characterising a microorganism | |
| JP6704565B2 (en) | How to detect mycoplasma | |
| US10253376B2 (en) | DNA-based detection and identification of eight mastitis pathogens | |
| Kurupati et al. | Rapid detection of Klebsiella pneumoniae from blood culture bottles by real-time PCR | |
| CN107541509B (en) | LAMP primer combination for detecting 6 infectious pathogens of cow mastitis and application thereof | |
| CN108359737A (en) | Mycoplasma contamination detection method and application | |
| Zhang et al. | Evaluation of a micro/nanofluidic chip platform for the high-throughput detection of bacteria and their antibiotic resistance genes in post-neurosurgical meningitis | |
| CN104059977A (en) | Salmonella serotype identification method and kit thereof | |
| CN104087676A (en) | Primer group and method for detecting four kinds of bacteria by means of multiple polymerase chain reaction (PCR) | |
| CN110669851A (en) | Primer and/or probe composition for detecting cocci causing bloodstream infections and use thereof | |
| CN105219874A (en) | The PSR detection method of Pseudomonas aeruginosa and primer special thereof and test kit | |
| CN107541567B (en) | LAMP primer combination for detecting 8 environmental pathogens of cow mastitis and application thereof | |
| Loonen et al. | Acceleration of the direct identification of Staphylococcus aureus versus coagulase-negative staphylococci from blood culture material: a comparison of six bacterial DNA extraction methods | |
| CN104830988A (en) | Salmonella typhimurium specific LAMP primer pair and LAMP detection method thereof | |
| CN109706145A (en) | Primer sets and its application | |
| CN110129459A (en) | It is a kind of for detecting the LAMP primer composition and application of 5 kinds of gram-positive bacteriums in intraocular liquid | |
| CN102628042B (en) | Specific ribonucleotide of legionella pneumophilia O9 wzm gene and application thereof | |
| CN108085408B (en) | The kit for detecting nucleic acid of quick detection bacterium sexual centre nervous system infection cause of disease | |
| Ragheb et al. | The application of uniplex, duplex, and multiplex PCR for the absence of specified microorganism testing of pharmaceutical excipients and drug products | |
| CN104388558B (en) | The molecular beacon probe of a kind of quick detection streptococcus agalactiae and detection method | |
| CN105524988A (en) | Kit for rapid detection of Mycobacterium tuberculosis in sputum | |
| CN110129316A (en) | It is a kind of for detecting the LAMP primer composition and application of 4 kinds of gramnegative bacteriums in intraocular liquid | |
| CN110029179B (en) | Nucleotide molecules and application thereof in identification of corynebacterium striatum | |
| CN109402277A (en) | For quickly detecting the LAMP primer composition and application of enterococcus faecalis and enterococcus faecium |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20191230 Address after: 100020 No. 8 South Road, workers' Stadium, Beijing, Chaoyang District Applicant after: BEIJING CHAO-YANG HOSPITAL, CAPITAL MEDICAL University Address before: The three District 101300 Beijing City Renhe Town, Shunyi District LAN Xiyuan 37 building two layer (innovation function area) Applicant before: BEIJING ZHIDE MEDICAL LABORATORY CO.,LTD. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |