CN108359737A - Mycoplasma contamination detection method and application - Google Patents

Abstract

The present invention provides mycoplasma contamination detection method and detection kits in a kind of new cell cultivation process.It is detection targeting section with rDNA relatively conservative in mycoplasma, by the combination of specific primer and probe, it is detected using the isothermal amplification technology based on recombinase polymerase, it is easy to operate, detection time is shortened, the specificity and accuracy of mycoplasma contamination detection are improved.

Description

Mycoplasma contamination detection method and application

Technical field

The invention belongs to biotechnologies, and in particular to and it is a kind of by isothermal amplification technology, carry out mycoplasma contamination inspection The combination of the method and the primer and probe used in this method of survey.

Background technology

Cell culture technology is all essential core in fields such as bio-pharmaceuticals, production of vaccine and clinical cytology treatments One of link.However it is that cell is often contaminated that a serious problems are faced in incubation, pollution source includes branch original The types such as body, bacterium and fungi, wherein mycoplasma are most important pollution sources^[1-2].It again can be real by serum after mycoplasma contamination It tests personnel and the approach such as the cell culture that has polluted is diffused^[3-5], cause the more pollution in wide area of cell sample.According to statistics The about cell culture of 15%-35% is subject to mycoplasma contamination in world wide^[6-7]。

Prokaryotic cell of the mycoplasma as the minimum acellular wall of presently found living nature, size is between bacterium and virus Between, diameter is about 0.2-0.3um, can be caused to be difficult to keep away in cell culture by common degerming filter membrane (0.22-0.45um) Exempt from the pollution of mycoplasma.Mycoplasma cell membrane is divided into three layers, and ectonexine is protein, and centre is lipid, more containing cholesterol, Mycoplasma film is set to have more compliance, this characteristic makes mycoplasma to the physical factors such as dehydration, osmotic pressure, pressure resistance significantly Enhancing, mycoplasma does not have cell wall, resistant to common antibiotic^[8], so cell is once difficult to clearly by mycoplasma contamination Except clean.The mycoplasma having been found to now wherein leads to the most common of pollution about more than 200 kind in cell cultivation process Mycoplasma type includes mainly：Mycoplasma hyorhinis (M.hyorhinis), mycoplasma fermentans (M.fementans), arginine branch are former Body (M.arginina), Mycoplasma orale (M.orale), mycoplasma hominis (M.hominis), mycoplasma salivarium (M.salivarium), Mycoplasma pirum (M.pirum) and Lai Shi acholeplasmas (A.laidlawii).According to reports, 95% Cell contamination is as caused by this 8 mycoplasma species^[9-10]。

Mycoplasma can compete medium nutrient content, a large amount of essential amino acids consumed in cell culture mediums with host cell (such as glutamic acid), influences cell growth and morphosis, to have an immense impact on to cell metabolism, gene expression^[11].Quilt Vitro growth rates are slack-off after mycoplasma contamination, and lesion occurs for cell, show as cell volume increase, fragment increases, in cell Particle is generated in matter.There is membranaceous deposition with space between cells in cell in culture bottle, and cell can not pass on or even entire cell colony Dissolving.Mycoplasma also results in cell chromosome fracture, number is reduced^[12-13].Mycoplasma can pass through the work of influence macrophage Property, inhibit the synthesis of interferon or reduce its activity, to increase the probability of cell infection germ and virus.Cell is by branch original After body pollution, obtained experimental data and conclusion do not have confidence level^[14].Mycoplasma contamination leads to some preciousnesses of laboratory Loss cell.And when carrying out biological agent production by mycoplasma contamination cell, finished product but will be caused unqualified, give industrial production Bring huge economic losses^[15], the vaccine of production can lose drug effect value, and the such vaccine of humans and animals inoculation will increase greatly Add the risk of illness^[16]；Human body input can be in peril of one's life by the cell therapy product of mycoplasma contamination^[17]。

If cell by bacterium and fungal contamination, is easy to find in incubation.Cell is contaminated by bacterial rear culture solution It becomes cloudy, solution pH value rapidly changes, and seriously polluted also results in cell death；It can go out in the cell culture fluid of fungal contamination Existing white, light yellow and black dot.It is easy to find by bacterium and fungal contamination different from cell, and cell is by mycoplasma dirt Cell will not be dead immediately after dye, and the significant change of cell appearance, cell culture fluid will not be caused not to send out by mycoplasma contamination It is raw muddy, and pollute initial stage and observe its cellular morphology under high magnification microscope and will not change^[18], need flower very More energy goes to identify.Therefore cell mycoplasma contamination is difficult to discover, and has great concealment^[19], to the potential of cell Threaten bigger.

It is seriously affected due to the concealment of cell mycoplasma contamination and to cell, the mycoplasma contamination of cell has become One more intractable global problem.The cell that laboratory is newly introduced, it should compare and certain method quarantine is taken to determine There is no mycoplasma contamination that could use^[8].In order to improve quality and the safety of animal cell culture biological products, the Chinese people Republic's States Pharmacopoeia specifications master cell bank, working cardial cell library, viral seed lot, control cell and clinical treatment should be carried out with cell Detection of mycoplasma^[20].U.S. Food and Drug Administration (FDA) suggests strongly, it should detect cell with suitable method Mycoplasma contamination situation^[21].European Pharmacopoeia European Pharmacopoeia (EP, 7th edition, Section2.6.7.) regulation needs cell therapy product to carry out stringent detection of mycoplasma^[22].It improves to mycoplasma contamination It is vigilant, adhere to that the detection for periodically doing mycoplasma, effort prevent to pollute.So finding a kind of quick and easy sensitive method progress Cell mycoplasma conventional detection is just particularly important^[19]。

1956, since Robinson etc. has found the mycoplasma contamination in cell culture for the first time^[23], researchers' difference The analysis of its form, breeding, classification, in vitro culture, membrane structure and memebrane protein, metabolic pathway etc. are all goed deep into Research.October nineteen ninety-five, genome research association (TIGR) from Maryland Gaithersburg with positioned at Chapel Hill's The team unity of North Carolina State University, it is common to complete the 580kb sequencings of mycoplasma genitalium full-length genome^[24], this is also people Class completes mycoplasma genome sequencing for the first time, and the laboratories subsequent Richard Herrma complete mycoplasma pneumoniae full genome The sequencing of group 800kb^[25]So that the detection of mycoplasma enters Molecular Detection field and is possibly realized.Up to the present, occur very The detection method of branched substance^[26-27], there is traditional detection method (including direct cultivation and DNA fluorescence colours), ATP enzyme Method, immunization (ELISA method etc.) and molecular diagnosis method (including regular-PCR and fluorescent PCR, LAMP, recombinase amplification technique Deng), these technologies when detecting between, detection accuracy has different difference in sensitivity and specificity.

Cultivation is most traditional mycoplasma contamination detection method and earliest detection method, and basic experiment step is first Cell culture was placed in mycoplasma meat soup fluid nutrient medium before this, 37 DEG C culture 3 days after centrifuge, sediment is transferred to branch It in substance solid agar medium, is cultivated under the same terms, if thering is similar fried egg sample bacterium colony to occur in observation culture medium, carefully Born of the same parents are by mycoplasma contamination.Cultivation simple, intuitive, most of mycoplasmas may occur in which distinctive colonies typical, but mycoplasma is given birth to Long slow, a culture generation takes around 3-4 hours, generally requires the culture pollution that can just judge whether there is mycoplasma in 28 days^[27], Heavy workload, and have and further expand the risk that mycoplasma is propagated.Mycoplasma is harsher to condition of culture, medium component The difference of quality or batch can all have an impact the normal growth of mycoplasma, and have some mycoplasmas that can not pass through cultivation Growth, therefore be inaccurate using cultivation testing result and easy to produce false negative^[28].In order to mitigate the work of Culture Mycoplasma method It measures, shortens detection time, a kind of quick and easy detection method is needed to prevent the diffusion of mycoplasma contamination, occur using The method that DNA fluorescence colours detect mycoplasma.

DNA fluorescence colours are to mark cell and mycoplasma DNA, fluorescence dye using fluorescent reagent Hoechst 33258 etc. The A-T rich regions that material can be attached to DNA can be dyed, dyestuff exists because A-T contents occupy the majority in mycoplasma DNA Yellow-green fluorescence is generated under ultraviolet excitation, whether there is using fluorescence microscope mycoplasma.Side is seen in normal cell core area The neat clearly fluorescence of edge, cytoplasmic region unstressed configuration.By the cell of mycoplasma contamination not only in nucleus but also outside nucleus and The uniform fluorescence dot of visible many sizes on cell membrane^[29], as mycoplasma DNA, it was demonstrated that cell is by mycoplasma contamination. Since this method need not cultivate mycoplasma, it is only necessary to use fluorescence microscope, operation is relatively simple, and detection is quick.But This method remolding sensitivity is relatively low, and because of the presence of background fluorescence, cell is slight, and mycoplasma contamination is not easy to detect.Cell cracking death is produced Raw fragment can be also erroneously interpreted as causing false positive caused by mycoplasma dyeing by fluorescent dyeing.DNA fluorescence colours are than thin The detection of born of the same parents' cultivation shortens detection time but sensitivity and accuracy be not high and needs fluorescence microscope when detecting^[30].Fluorescence Decoration method not can determine that cell contamination caused by specifically which kind of mycoplasma.Fluorescence colour generally requires the free of contamination finger of culture Show cell as a contrast, increases the workload of detection.

In view of the shortcoming of DNA fluorescence colours, there is sensitivity and the higher PCR (Polymerase of accuracy Chain Reaction) detection mycoplasma method, Remy Teyssoud etc. are with height in the 16SrRNA nucleic acid sequences of mycoplasma Conserved sequence design primer^[31-33], using the mycoplasma contamination in the method detection cell of PCR.Mycoplasma is as a kind of protokaryon Biology, rRNA genes are arranged by conservative and changeable train interval, can be as the index of biological classification.PCR is with 4 kinds DNTP is substrate, and in the presence of primer, the extension of complementary strand is carried out in 3 ' ends of DNA profiling, repetitious to follow Ring can make micro template nucleic acid obtain exponential amplification.It is difficult and take that PCR detection method is particularly suitable for culture The Testing and appraisal of mycoplasma.

It includes extracting cell conditioned medium to be measured that PCR methods, which detect mycoplasma basic step, and PCR is added in PCR overall reaction systems Amplification condition amplified reaction is arranged in buffer solution, magnesium chloride, Taq enzyme, dNTP, template and primer.Micro amplified production is taken to carry out fine jade Sepharose electrophoresis is observed with Ultraviolet Detector and is taken a picture with gel imaging system, sees whether that purposeful segment occurs.PCR Method can carry out the discriminating of kind since design of primers specificity is stronger.It is greatly shortened than general culture method detection time, than DNA fluorescence colours have higher specificity^[34], can differentiate the not of the same race of mycoplasma.The analysis of PCR product generally uses Agarose gel electrophoresis is analyzed, the preliminary size for judging PCR product segment with it is expected that whether unanimously.But most troubling problem It is pcr amplification product pollution, because PCR product copy number is big, extremely micro pollution can cause the generation of false positive^[11]。 The form for being the most likely to cause PCR product pollution is Aerosol Pollution, more tempestuously shakes reaction tube in operation, especially beats The lid for opening reaction tube can all form aerosol when electrophoresis printing operation and pollute.One aerosol particle includes largely to copy Shellfish, thus it is the worth the problem of especially paid attention to pollute the false positive of generation as caused by aerosol^[11], and PCR is primary An index can only be detected.With the development of molecular biology, gradually develops and carried out mycoplasma using fluorescent quantitative PCR technique Detection means, such as Melanie Stormer quickly detect the mycoplasma contamination in cell using fluorescence quantifying PCR method^[35]。

Quantitative fluorescent PCR (real-time fluorescence quantitative PCR) is 1996 by the U.S. The new quantitative test technology of a kind of nucleic acid that Applied Biosystems companies release, quantitative fluorescent PCR are on Standard PCR basis Upper addition fluorescence probe or corresponding fluorescent dye realize real-time quantitative.With the progress that PCR reacts, PCR reaction products Constantly accumulative, also equal proportion increases fluorescence signal intensity.Often pass through a cycle, collect first order fluorescence signal, we are just in this way The variation that product amount can be monitored by fluorescence intensity change, to obtain a fluorescent amplification curve.In real time fluorescent quantitative Ct values refer to that the fluorescence signal in each reaction tube reaches the recurring number undergone when given threshold in round pcr.Each template The logarithm of starting copy number of Ct values and the template there are linear relationships, starting copy number is more, and Ct values are smaller.Using known The standard items of starting copy number can make standard curve, and wherein abscissa represents the logarithm of starting copy number, and ordinate represents Ct Value.Therefore, as long as obtaining the Ct values of unknown sample, you can calculate the starting copy number of the sample from standard curve.

The main step of real-time fluorescence quantitative PCR detection mycoplasma includes the design of mycoplasma special primer and probe, sun The property preparation of standard items and the drafting of standard curve, quantitative fluorescent PCR specificity experiments, sensitivity experiments and repeated experiment, It is finally to be passed through Ct values and amplification curve is judged with machine testing in cell supernatant to be measured.With making for real-time fluorescence quantitative PCR With there are many researchs for detecting mycoplasmas using this technology, Lorenzon S etc. detect lung using fluorescence quantifying PCR method Scorching mycoplasma capri pneumoniae^[36]It has invented Deng, Gerlier in 2017 etc. and utilizes fluorescence quantitative PCR detection mycoplasma Patent^[37].Real-time fluorescence quantitative PCR simplifies operating procedure, and aerosol caused by can avoid PCR race glue is detected using stopped pipe The appearance of false positive, sensibility is high, may be implemented to monitor in real time, can also realize rational judgment.Real-time fluorescence quantitative PCR has It is faster than PCR detections, the advantage of high sensitivity^[38], it is especially suitable for using when sample template content is relatively low, real-time fluorescence quantitative PCR It can judge specific amplification by solubility curve^[39].The fluorescent quantitation that real-time fluorescence quantitative PCR needs matched price high PCR instrument, and equipment maintenance cost is high, and machine setting is complicated for operation, needs professional, it is difficult to be popularized in an all-round way.

Loop-mediated isothermal amplification technique (Loop-mediated isothermal amplification method, LAMP it is) a kind of emerging gene amplification, by Japanese scholars Notomi^[40]2000 miscellaneous in Nucleic Acids Res It is published in will, as a kind of molecular Biological Detection technology, is now first widely used to Molecular Detection field, 2005 Saito R et al. have delivered the article that LAMP methods quickly detect mycoplasma pneumoniae^[41].HEYing in 2014^[42]Etc. using LAMP method Quickly detection capri pneumoniae mycoplasmas, U.S. Jonas M in 2016^[43]Etc. having invented lung is detected using LAMP method The patent of scorching mycoplasma.Cao Zhen in 2016 has invented a kind of patent of the LAMP method of detection wide spectrum mycoplasma^[44].2017 Matsuzaki I^[45]Deng the quick detection using LAMP for gene transfer.LAMP principles are 6 regions for target gene 4 species-specific primers are designed, under the action of strand displacement archaeal dna polymerase (such as Bst enzymes), 63 DEG C or so in water-bath, 60 minutes i.e. It can be achieved 10⁹~10¹⁰Nucleic acid amplification again has very high amplification efficiency, and easy to operate, detection need not use special instrument Device.Although LAMP increases amplification efficiency, but the non-specific pairing between primer is easy to cause false positive results^[46-50], limitation The use of LAMP method.

Since real-time fluorescence quantitative PCR needs mating instrument, and it is complicated for operation, need experienced experimenter to inspection Result is surveyed to be analyzed, and LAMP methods will appear false positive issue, make real-time fluorescence quantitative PCR and LAMP methods in detection mycoplasma All there are certain drawbacks in pollution, a kind of using simply in order to seek, as a result profit, occurs in accurate detection of mycoplasma method With the ATP enzyme method of mycoplasma enzyme this given activity detection mycoplasma^[29,51], such as the commercialization that Lonza companies release Mycoalert mycoplasma test reagent boxes, ATP enzyme method are the principles using bioluminescence, detect mycoplasma enzymatic activity, detection Mycoplasma enzyme be widely present in more than 180 kinds of mycoplasma, and this enzyme is not present in eukaryocyte.When mycoplasma is cleaved Afterwards, the enzyme with reaction substrate of release occur to be catalyzed and react, and ADP is converted to ATP^[29], pass through fluorescence spectrophotometer measurement sample The content that ATP before and after substrate is added in product, can obtain a ratio, ratio instruction mycoplasma whether there is.If these Enzyme is not present, and second of reading does not just increase relative to first time reading, will if enzyme-to-substrate carries out specific reaction ATP contents are caused to rise.The bioluminescence that rises through of ATP contents is chemically reacted and can be detected, reading rises and shows exist Mycoplasma contamination.

ATP enzyme method mycoplasma type that can be detected is more complete, and testing result can quantify, and easily determine, time-consuming short, whole A experimentation needs 20 minutes or so^[28].Since ATP enzyme method relies primarily on the performance of mycoplasma enzymatic activity, any influence enzyme Active performance is likely to influence the accuracy of result, and the researchs such as Vahid Molla Kazemiha in 2015 find ATP enzyme The sensitivity of method and accuracy will be less than quantitative real-time PCR^[9], ATP enzyme method need use sepectrophotofluorometer, and The mycoplasma test reagent box of commercialization is expensive, and it is higher that cost promotes the use of a large area.By comparing real time fluorescent quantitative It is still branch in its sensitivity and accuracy that PCR and ATP enzyme method, which can be seen that the method for detecting mycoplasma based on nucleic acid amplification, The primary means of the quick selective mechanisms of substance.Therefore, a kind of easy to operate, high specificity of exploitation, high sensitivity are badly in need of in this field The detection of mycoplasma method based on nucleic acid amplification.

Invention content

Isothermal amplification technology because its is easy to operate, instrument temperature control it is easy to implement quickly examined as microorganism it is most important One of means.Include at present LAMP (Loop-mediated in industry and the most commonly seen isothermal amplification technology of scientific research field isothermal amplification method)^[52-53]With RPA (recombinase polymeric enzymatic amplification technology, Recombinase polymerase amplification)^[54].Wherein, RPA is in proliferation time, specific amplification, the required energy consumption of amplification etc. Aspect all has apparent advantage.Principle be by reaction system be usually 28-35 base two specific primers and Recombinase forms compound, homologous sequence is found on template DNA, chain exchange occurs, and prolonged under archaeal dna polymerase effect It stretches^[55].By upstream and downstream primer at the specific section both ends of template respectively in connection with extension, the occurrence index grade that moves in circles expands Increase^[55].Although amplified production can realize the increase of fluorescence signal by adding SYBR Green dyestuffs, because fluorescent dye can not Non-specificity is distinguished, and can base be carried out by exonuclease III or endonuclease IV by increasing in reaction system The specificity fluorescent probe technique of the mode of analog excision is detected, to substantially increase the specificity of detection.At present RPA nucleic acid detection techniques have been applied to agricultural, animal doctor, the multiple fields such as bio-pharmaceuticals^[56-58].Boyle (2013) et al. is ground Study carefully and find that RPA is an ideal technology for the diagnosis of HIV-1, complicated temperature cycles equipment is not needed, in steady temperature Under the conditions of the amplification of target gene can be completed in 20min, HIV-1 provirus NDA detection sensitivities can be copied down to 3 Shellfish^[59].RPA technologies are widely reported in multiple infectious disease pathogens and microorganism detection field at present^[60-63], such as use In the detection of pathogenic mycoplasma or certain virus etc., but report is to be examined for a kind of or of a sort cause of disease completely It surveys, utilizes the correlative study of RPA technologies detection cell mycoplasma contamination there is not yet report up to now.And mycoplasma contamination is examined It surveys and needs to be detected across different species, and from chadogram affiliation, need the species for including with detection of mycoplasma Such as its gene order of Lai Shi acholeplasmas and Escherichia coli homology higher, needs to exclude the interference of Escherichia coli while including Lai Shi acholeplasmas.Therefore it by routine sequence homology analysis, can not be designed between primer and probe at above-mentioned two special Specific section including common mycoplasma contamination type and can exclude Escherichia coli sequence in homology.This hair The bright mycoplasma, refer to M.arginini, M.fermentans, M.hominis, M.orale, M.hyorhinis, M.salivarium、M.pirum、Acholeplamasa laidlaawii、Ureaplasma urealyticum、 Spiroplasma citri、M.gallisepticum、M.genitalium、M.pneumoniae、M.penetrans、 M.capricolum、M.bovis、M.bovoculi、M.synoviae、M.pulmonis、M.flocculare、 M.arthritidis、M.hyosynoviae、M.hyopneumoniae、Acholeplasma modicum、Acholeplasma morum、M.entomophilum、M.florum、M.Agussizii、M.alkalescens、M.alligatoris、 M.arthriditis、M.bovirhinis、M.buccale、M.californicum、M.canadense、M.cloacale、 M.conjunctivae、M.Crocodyli、M.equirhinis、M.faucium、M.gallinaceum、M.iguanae、 M.Lipophilum、M.muris、M.neurolyticum、M.opalescens、M.primatum M.spermatophilum、 M.dispar, M.falconis, M.lipofaciens and have with above-mentioned 51 kinds on genome sequence 90% or more homologous The microorganism of the identical or approximate kind of property.

This research inventor has found that RPA amplification enzymes have stronger mispairing tolerance, and are directed to by lot of experimental data The mispairing of 3 ' ends will largely effect on the efficiency of amplification.By in probe sequence, in base analogue both ends sequence to be excluded Introduce mispairing, to by the primer of specific amplification and with the probe combinations of specific cleavage, reach the inspection of specific amplification Test purpose.Mispairing tolerance research also has a relevant report, and Patil (2011) et al. researchs find that (base size is about single stranded DNA The mispairing for 83bp) having 12% causes chain exchange rate to reduce 50%, but equally also can in 3 ' terminal mismatch of primer compared with PCR Reduce its amplification efficiency^[64].It is sub- that Boyle (2013) et al. result of study shows that RPA can detect many different HIV-1 viruses Type can tolerate the mispairing of up to 9 bases^[59].Another is research shows that RPA detection brothers mouthful RNA virus can tolerate 5 alkali The mispairing of base^[65].Daher (2014) et al. result of study shows that mispairing tolerances of the RPA between primer and template is higher^[66].So And Chen (2015) et al. is research shows that the mispairing of 3 ' end of primer and template can influence the extension of archaeal dna polymerase^[67], C-C, This 4 kinds of mispairing between primer and template of A-G, G-A and A-A are bigger on the extension of archaeal dna polymerase influence, can seriously undermine amplification Efficiency.Based on the above principle, inventor is by comparing 23 common mycoplasma 16S-23S-5S sequences and bacillus coli gene Sequence, design RPA upstream and downstream primers, primer at least one base of 3 ' ends Yu Escherichia coli mispairing, but with all 3 ' end of substance has no mispairing, although having Individual base mispairing with centre at 5 ' ends, has no effect on its amplification；And it designs special Property probe section, introduce mispairing in sequence to be excluded at base analogue both ends, to by the primer of specific amplification and With the probe combinations of specific cleavage.

Therefore the common conservative gene of the invention by being listed in documents, and the 16S-ITS- that selected conservative is strong 23S-5S rDNA usually have 1-15 copy number in the genome as target amplification section, this section^[68], therefore relative to Other single copy genes are selected, select this section that can improve the sensitivity of mycoplasma contamination detection.Mycoplasma is retrieved from NCBI And the 16S-ITS-23S-5S rDNA sequences of Escherichia coli, it is respectively：M.arginini (accession number：AP014657.1)、 M.fermentans (accession number：CP002458.1), M.hominis (accession number：CP009652.1), M.orale (accession number： NZ_ATUH01000005.1), M.hyorhinis (accession number：CP016817.1), M.salivarium (accession number：NZ_ AXZE01000009.1), M.pirum (accession number：NZ_KK365983.1), Acholeplamasa laidlaawii (are logged in Number：CP000896.1), Ureaplasma urealyticum (accession number：AP014584.1), Spiroplasma citri (are stepped on Record number：CP013197.1), M.gallisepticum (accession number：CP006916.3), M.genitalium (accession number： CP003773.1), M.pneumoniae (accession number：CP017343.1), M.penetrans (accession number：BA000026.2)、 M.capricolum (accession number：CP000123.1), M.bovis (accession number：CP023663.1), M.bovoculi (accession number： CP007154.1), M.synoviae (accession number：CP011096.1), M.pulmonis (accession number：AL445565.1)、 M.flocculare (accession number：CP007585.1), M.arthritidis (accession number：CP001047.1)、 M.hyosynoviae (accession number：NR_029183.1, JQ670924.1), M.hyopneumoniae (accession number： CP003802.1), E.coli (accession number：CP017446.1), 16S-ITS-23S-5S is carried out by Vector NTI softwares RDNA sequence alignments select the preferable region design primer of conservative and probe, due to the first eight mycoplasma species (M.arginini, M.fermentans, M.hominis, M.orale, M.hyorhinis, M.salivarium, M.pirum and Acholeplamasa laidlaawii) pollution ratio accounts for about the 95% of mycoplasma contamination, so the design of primer and probe is excellent First consider this 8 kinds of common mycoplasmas, consider further that cover other mycoplasmas on this basis, while excluding Escherichia coli false positive knot Fruit compares, and part compares sequence results and sees Fig. 2：

This research designs multigroup primer and probe using RPA technologies according to the principle of the above primer and probe for the first time.Profit Amplification experiment is carried out with recombinase polymeric enzymatic amplification technology, judges whether cell is mycoplasma by the change of fluorescence signal value Pollution.

Based on the studies above, first aspect present invention provides a kind of method of detection Mycoplasma Contamination In Cell Cultures, This method use be based on recombinase polymerase constant-temperature amplification method, in mycoplasma genome conservative region or specific regions do It is detected for detection targeting section；Section, more preferably 16S- are targeted as detection with the rDNA of mycoplasma under preferable case ITS-23S-5S rDNA。

The method of mycoplasma in detection cell culture provided by the invention, reaction system include recombinase, and polymerase is single Chain DNA binding protein, nuclease, at least pair of primers, a probe, dNTP, template to be detected, crowding agent, recombination load Albumen, energy system and salt ion.The preferably described recombinase is selected from bacteriophage UvsX albumen, and Escherichia coli recA albumen is appointed One or more kinds of combinations；The polymerase be selected from klenow polymerases, bsu polymerases or phi29 polymerases and its this A little mutant of enzyme or any one or more combinations of large fragment；The single-stranded DNA binding protein is selected from Escherichia coli SSB albumen, GP32 albumen it is any or combinations thereof；The nuclease is selected from exonuclease III, endonuclease IV or first Any one or more combinations of amide pyrimidine-DNA glycosylases；The recombination load albumen is selected from bacteriophage UvsY eggs In vain, any one or more combinations of Escherichia coli RecO or Escherichia coli RecR；The crowding agent is selected from poly- second two One or more kinds of combinations of alcohol, polyvinyl alcohol, dextran or ficoll, wherein the polyethylene glycol is selected from PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG20000, PEG25000, PEG30000, PEG35000 Or PEG40000；The energy system is selected from ATP or ATP, phosphocreatine, the combination of creatine kinase；Salt ion is selected from Tris, magnesium Any one or more combinations of ion or potassium ion；The probe is the probe of fluorochrome label, and fluorescent dye can Think SYTO-13, SYTO-82, FAM, FITC, SYBR Green I, SYTO-13, SYTO-82, VIC, HEX, JOE, TAMRA, TET, Cy3, ROX, TEXAS-Red or Cy5.

The method of mycoplasma in detection cell culture provided by the invention, the primer include at least two, respectively in connection with The length of upstream and downstream in the regions to be amplified mycoplasma rDNA, primer is 15-45 nucleotide bases, preferably 28-35 cores Thuja acid base, primer have at least 80% sequence similar to a continuous section of the rDNA of the mycoplasma to be detected of all kinds Property (e.g., at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%)；The last one base-pair amplified reaction of 3 ' ends is most important, Therefore at least one primer base of 3 ' end one and the nucleic acid sequence of mycoplasma to be detected are completely the same, and same with Escherichia coli One base of source range is inconsistent, and primer can be chemically modified to improve Tm values, and then improves primer and combined with target sequence Specificity, the chemical modification is preferably any one or more combinations of PNA, LNA or BNA；The probe length For 35-55 nucleotide base, preferably 42-50 base, a base in probe positioned at 28-35 is replaced by core Acid-like substance, the nucleic acid analog are preferably THF, are respectively two T bases and mark fluorescent group in the both sides of THF and quench Go out group, and probe ' is closed-end 3 by blocking groups.It is further preferred that the primer is selected from following combination：

Group unification：

Sense primer 1：5’-ACCACCCGGTAAGGCTAAATACTAACCAGAC-3’

Sense primer 2：5’-AGGACCATCTCCTAAGGCTAAATACTACTTGG-3’

Sense primer 3：5’-CAAACCATTGGGTAAGCCTAAATACTAGTCAG-3’

Downstream primer 1：5’-CACCCATTAACGGGCTCTGACTAATTGTAA-3’

Downstream primer 2：5’-CACACATTAATGGGCTCTGACACGTTGTAG-3’

Combination two：

Sense primer：5’-CACCTCGATGTCGRCTCATCTCATCCTCGA-3’

Downstream primer 1：5’-CTAGGAACAGCTCTTCTCAATCTTCCTACGGG-3’

Downstream primer 2：5’-GTAGCTCTCATCAATATTCCAACGCCCACAT-3’

Downstream primer 3：5’-CTAGAAGCAAAGCTCTTCAATCTTCCTGTGGG-3’

Combination three：

Sense primer 1：5’-AATTTGAAGATACGCGGAGAACCTTACCCAC-3’

Sense primer 2：5’-TGGTGGAGCATGTTGCTTAATTCGACGGTACA-3’

Sense primer 3：5’-AGGCTTAGAAATAAGTTCGGAGGCTAACAGATG-3’

Downstream primer 1：5’-ACGTGTGTTGCCCCACTCGTAAGAGGCATGATGAT-3’

Downstream primer 2：5’-TTTGCAGCCCTAGACATAAGGGGCATGATGAT-3’

Or combination four：

Sense primer 1：5’-CTGTACCATTTTGAATAAGTGACGACTAACTAT-3’

Sense primer 2：5’-CGGTACCTGATTAGAAAGCAACGGCTAACTAT-3’

Sense primer 3：5’-CGGTACCCTGTCAGAAAGCGATGGCTAACTAT-3’

Downstream primer 1：5’-CTACAGACGCTTTACGCCCAATAATTTCGGA-3’

Downstream primer 2：5’-CTACGCACCCTTTACGCCCAGTAAATCCGGA-3’

The method of mycoplasma in above-mentioned detection cell culture, reaction temperature be 25-45 DEG C, preferably 37-42 DEG C, more preferably It is 37 DEG C；Reaction time is 15-60 minutes, preferably 15-30 minutes.

Another aspect of the present invention provides above-mentioned primer and probe in preparing cell culture in mycoplasma test reagent Using.

Further aspect of the present invention provides a kind of kit detecting mycoplasma in cell culture, including recombinase, polymerization Enzyme, single-stranded DNA binding protein, nuclease, at least pair of primers, a probe, dNTP, template to be detected, crowding agent, recombination Load albumen, energy system and salt ion.Wherein, the recombinase is selected from bacteriophage UvsX albumen, Escherichia coli recA albumen Any one or more combinations；The polymerase be selected from klenow polymerases, bsu polymerases or phi29 polymerases and The mutant of its these enzyme or any one or more combinations of large fragment；The single-stranded DNA binding protein is selected from large intestine Bacillus SSB albumen, GP32 albumen it is any or combinations thereof；The nuclease is selected from exonuclease III, endonuclease IV Or any one or more combinations of formyl amic metadiazine-DNA glycosylases；The recombination load albumen is selected from bacteriophage Any one or more combinations of UvsY albumen, Escherichia coli RecO or Escherichia coli RecR；The crowding agent is selected from One or more kinds of combinations of polyethylene glycol, polyvinyl alcohol, dextran or ficoll, wherein the polyethylene glycol is selected from PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG20000, PEG25000, PEG30000, PEG35000 Or PEG40000；The energy system is selected from ATP or ATP, phosphocreatine, the combination of creatine kinase；Salt ion is selected from Tris, magnesium Any one or more combinations of ion or potassium ion；The probe is the probe of fluorochrome label, and fluorescent dye can Think FAM, SYBR Green, SYTO-13, SYTO-82, cy-3 or cy-5；The primer include at least two, respectively in connection in The length of the upstream and downstream in the regions to be amplified mycoplasma rDNA, primer is 15-45 nucleotide bases, preferably 28-35 nucleosides Soda acid base, primer have at least 80% sequence similar to a continuous section of the rDNA of the mycoplasma to be detected of all kinds Property；The last one base-pair amplified reaction of 3 ' ends is most important, thus at least one primer base of 3 ' end one with it is to be checked The nucleic acid sequence for surveying mycoplasma is completely the same, and inconsistent with one base of Escherichia coli homology segment；The probe length is 35-55 nucleotide base, preferably 42-50 base, a base in probe positioned at 28-35 are replaced by nucleic acid Analog, the nucleic acid analog are preferably THF, are respectively two T bases and mark fluorescent group in the both sides of THF and are quenched Group, probe 3, ' by blocking groups closed, and the preferably described primer is selected from any one following combination by end；Combination One：

Sense primer 1：5’-ACCACCCGGTAAGGCTAAATACTAACCAGAC-3’

Sense primer 2：5’-AGGACCATCTCCTAAGGCTAAATACTACTTGG-3’

Sense primer 3：5’-CAAACCATTGGGTAAGCCTAAATACTAGTCAG-3’

Downstream primer 1：5’-CACCCATTAACGGGCTCTGACTAATTGTAA-3’

Downstream primer 2：5’-CACACATTAATGGGCTCTGACACGTTGTAG-3’

Combination two：

Sense primer：5’-CACCTCGATGTCGRCTCATCTCATCCTCGA-3’

Downstream primer 1：5’-CTAGGAACAGCTCTTCTCAATCTTCCTACGGG-3’

Downstream primer 2：5’-GTAGCTCTCATCAATATTCCAACGCCCACAT-3’

Downstream primer 3：5’-CTAGAAGCAAAGCTCTTCAATCTTCCTGTGGG-3’

Combination three：

Sense primer 1：5’-AATTTGAAGATACGCGGAGAACCTTACCCAC-3’

Sense primer 2：5’-TGGTGGAGCATGTTGCTTAATTCGACGGTACA-3’

Sense primer 3：5’-AGGCTTAGAAATAAGTTCGGAGGCTAACAGATG-3’

Downstream primer 1：5’-ACGTGTGTTGCCCCACTCGTAAGAGGCATGATGAT-3’

Downstream primer 2：5’-TTTGCAGCCCTAGACATAAGGGGCATGATGAT-3’

Or combination four：

Sense primer 1：5’-CTGTACCATTTTGAATAAGTGACGACTAACTAT-3’

Sense primer 2：5’-CGGTACCTGATTAGAAAGCAACGGCTAACTAT-3’

Sense primer 3：5’-CGGTACCCTGTCAGAAAGCGATGGCTAACTAT-3’

Downstream primer 1：5’-CTACAGACGCTTTACGCCCAATAATTTCGGA-3’

Downstream primer 2：5’-CTACGCACCCTTTACGCCCAGTAAATCCGGA-3’

Cell strain processing to be tested is as follows：It selects 95 plants of cell culture strains as sample database to be screened, uses liquid relief respectively Device takes the cells and supernatant of 200ul, moves in the new sterile centrifugation tubes of 1.5ml, and 95 DEG C are boiled 5min, and -20 DEG C save backup. The screening of positive sample：With reference to Takara PCR Mycoplasma Detection Set (6601Takara) reagent kit product Illustrating to carry out two-wheeled PCR reaction detection mycoplasmas, and filters out positive strain, two-wheeled PCR reactions are carried out with reference to kit specification, Condition is as follows：94℃30sec,1cycle；94 DEG C of 30sec, 55 DEG C of 2min, 72 DEG C of 1min, 30cycles.First round PCR reacts 1ul treated cell conditioned mediums are added as template, first round PCR reaction product 0.5ul is added in the second wheel PCR reactions.In order to Prevent from polluting, first round PCR after reaction, -20 DEG C of PCR reaction products freeze thaws after 10min plus template again, finally from Total 37 plants of positive samples are filtered out in 95 plants of cell culture strains.

According to explanation, Takara PCR Mycoplasma Detection Set kits can mainly detect culture cell In at least 11 mycoplasma species (M.fermentans, M.hyorhinis, M.arginini, M.orale, M.salivarium, M.hominis,M.pulmonis,M.arthritidis,M.neurolyticum,M.hyopneumoniae, M.capricolum) and urea substance (UreaPlasma) belong in a kind (U.urealyticum).In order to confirm 37 plants of positives Mycoplasma contamination type in sample, respectively to carrying out sanger sequencings after amplification PCR product segment recycling, the sequence that sequencing is obtained Progress Blast comparisons on NCBI are listed in, the mycoplasma contamination for sharing 5 types in 37 plants of positive samples is finally determined, is respectively M.arginini、M.fermentans、M.hominis、M.hyorhinis、M.salivarium.Then from the branch of each type Pick out representative cell in the positive sample of mycoplasma contamination respectively, cell number be respectively F81, JURKAT, KATO-III, CHO-K1, BHK21, and select one plant of uncontaminated negative cells KB.In addition, for the guiding region in case study on implementation Section has been respectively synthesized common 4 kinds of pollution mycoplasmas Acholeplamasa laidlaawii, Ureaplasma Urealyticum, M.orale, M.pirum and Spiroplasma citri, M.capricolum, M.genitalium, The plasmid of 5 mycoplasma species 16S and 23S rDNA sequences of M.pneumoniae, M.penetrans is used as positive DNA reference substances, supplies Subsequent experimental detects.

It is expanded using recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method amplification reaction system, at least It can detect the cell mycoplasma contamination including above-mentioned 23 kinds, in certain case study on implementation, structure amplification reaction system is such as Under：

30mM trishydroxymethylaminomethanes-acetate buffer solution pH8.0

100mM potassium acetates

14mM magnesium acetates

3mM dithiothreitol (DTT)s

5% polyethylene glycol (molecular weight 20000)

3mM ATP

30mM phosphocreatines

100ng/ul creatine kinases

600ng/ul Escherichia coli SSB albumen

150ng/ul bacteriophage uvsX albumen

25ng/ul bacteriophage uvsY albumen

20ng/ul klenow polymerase Large fragments (exo-)

50ng/ul exonucleases III

450uM dNTP

Every sense primer of 250uM

Every downstream primer of 250uM

Every fluorescence probe of 120uM

Cell conditioned medium is as amplification template, 2ul after above-mentioned processing

It is 37 DEG C to expand temperature, reacts 30min, fluorescence is detected with Molarray MA-1610 constant temperature amplified fluorescence instrument Changing value, per 30s read first order fluorescence.Recombinase polymeric enzymatic amplification technology does not need complicated sample DNA pretreatment process, The thermal denaturation of template is not needed, reaction is completed under lower isothermal condition, and reaction susceptibility is high, high specificity, upper machine It can go out result in detection 30min.Reaction is eliminated the process of PCR product electrophoresis verification, is avoided by fluorescence values interpretation Aerosol Pollution.

Beneficial effects of the present invention：The present invention is with relatively conservative in each kind mycoplasma and containing multiple copies rDNA Target spot is detected, by isothermal amplification technology, is combined using the primer and probe of specificity, improves the mycoplasma polluted in cell Detection convenience and specificity, while detection time also greatly shortens.Compared with PCR detection method, method of the invention saves Product electrophoresis verification process has been removed, false positive results appearance has been avoided, improves the accuracy of detection.Compared with qPCR, the present invention Method is simple, does not also need instrument and equipment complicated for operation, has saved cost, improves detection efficiency, is convenient for simultaneously It is promoted the use of interior on a large scale.It is shorter the time required to detection method of the invention compared with other constant-temperature amplification methods, detection Accuracy rate higher.

Description of the drawings

Fig. 1 is mycoplasma chadogram.

Fig. 2 is each mycoplasma species sequence and Escherichia coli sequence alignment schematic diagram.

Fig. 3 is different cell mycoplasma recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method testing results. 1.CHO-K1 2.BHK21 3.F81 4.JURKAT 5.KATO-III 6.KB 7.E.coli 8.ddH₂O。

Fig. 4 is different cell mycoplasma qPCR testing results.1.CHO-K1 2.BHK21 3.F81 4.JURKAT 5.KATO-III 6.KB 7.E.coli 8.ddH₂O。

Fig. 5 is recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method sensitivity test result.1.CHO cells It is former to handle 10 times of 3.CHO cells processing stostes 100 times of 4.CHO cells processing of dilution of stoste 2.CHO cells processing stoste dilution Liquid dilutes 1000 times of 5.ddH₂O

Fig. 6 is recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method sensitivity test result.1.CHO cells It handles stoste dilution 300 times of 2.CHO cells processing stostes dilutions, 600 times of 3.CHO cells processing stostes and dilutes 900 times 4.ddH₂O

Fig. 7 is qPCR sensitivity test results.1.CHO cells handle stoste 2.CHO cells processing stoste and dilute 10 times 3.CHO cells handle stoste and dilute 100 times of 4.CHO cells processing stostes dilutions, 300 times of 5.CHO cells processing stoste dilutions 600 times of 6.CHO cells processing stostes dilute 900 times of 7.CHO cells processing stostes and dilute 1000 times of 8.ddH₂O

Fig. 8 is qPCR sensitivity test solubility curve results

Fig. 9 is recombinase polymeric enzymatic amplification (in conjunction with endonuclease IV) method sensitivity test result.Chinese hamster ovary celI processing 300 times of 2.CHO cells processing stostes of stoste dilute 600 times of 3.CHO cells processing stostes and dilute 900 times of 4.ddH₂O

Each mycoplasma species sequences of Figure 10-13 and Escherichia coli sequence alignment schematic diagram.

Present disclosure will be described in detail by specific implementation mode below.It should be appreciated, however, that specific real It applies example and is merely to illustrate the present invention, the limitation to protection scope of the present invention can not be interpreted as.Based on skill disclosed by the invention Art means belong to the present invention's using various conventional replacements, the change etc. that general knowledge known in this field and customary means carry out Range.

Specific implementation mode

Embodiment one

Select above-mentioned screening and 23 mycoplasma species synthesized by plasmid to detect target,

The primer sequence of upstream three is respectively：5’-ACCACCCGGTAAGGCTAAATACTAACCAGAC-3’(Seq ID No.1) can amplify M.bovis, M.bovoculi, M.fermentans, M.synoviae, M.pulmonis, M.flocculare、M.hyorhinis、M.hominis、M.arginini、M.arthritidis、M.hyosynoviae、 M.orale, M.salivarium, M.hyopneumoniae, Spiroplasma citri totally 15 mycoplasma species；5’- AGGACCATCTCCTAAGGCTAAATACTACTTGG-3 ' (Seq ID No.2) can amplify Acholeplamasa laidlaawii；5 '-CAAACCATTGGGTAAGCCTAAATACTAGTCAG-3 ' (Seq ID No.3) can be amplified M.gallisepticum、M.pirum、M.pneumoniae、M.penetrans、M.genitalium、Ureaplasma Urealyticum, M.capricolum totally 7 mycoplasma species.

Two, downstream primer sequence is respectively：5’-CACCCATTAACGGGCTCTGACTAATTGTAA-3’(Seq ID No.4) can amplify M.bovis, M.bovoculi, M.fermentans, M.synoviae, M.pulmonis, M.flocculare、M.hyorhinis、M.hominis、M.arginini、M.arthritidis、M.hyosynoviae、 M.orale、M.salivarium、M.hyopneumoniae、Acholeplamasa laidlaawii、M.capricolum、 Ureaplasma urealyticum, Spiroplasma citri totally 18 mycoplasma species；5’- CACACATTAATGGGCTCTGACACGTTGTAG-3 ' (Seq ID No.5) can amplify M.gallisepticum, M.pirum, M.genitalium, M.pneumoniae, M.penetrans totally 5 mycoplasma species；

Probe sequence is：CTATTTCACTCCC MTCCCKGGGTTCTTT(FAM-dT)CA(THF)C(BHQ1-dT) TTCCCTCACGGTACT(C3-SPACER)。

It is expanded, is built using recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method amplification reaction system Amplification reaction system is as follows：

30mM trishydroxymethylaminomethanes-acetate buffer solution pH8.0

100mM potassium acetates

14mM magnesium acetates

3mM dithiothreitol (DTT)s

5% polyethylene glycol (molecular weight 20000)

3mM ATP

30mM phosphocreatines

100ng/ul creatine kinases

600ng/ul Escherichia coli SSB albumen

150ng/ul bacteriophage uvsX albumen

25ng/ul bacteriophage uvsY albumen

20ng/ul klenow polymerase Large fragments (exo-)

50ng/ul exonucleases III

450uM dNTP

Every sense primer of 250uM

Every downstream primer of 250uM

Every fluorescence probe of 120uM

It is 37 DEG C to expand temperature, reacts 30min, fluorescence is detected with Molarray MA-1610 constant temperature amplified fluorescence instrument Changing value, per 30s read first order fluorescence.Detect above-mentioned 6 kinds of cells (F81, CHO-K1, JURKAT, KATO-III, BHK21, KB), positive plasmid, Escherichia coli and the ddH synthesized₂O。

Sample process：200ul cell culture fluids are taken, 95 DEG C are boiled 5min and take supernatant spare.Testing result in addition to cell KB, Escherichia coli and ddH₂O results are negative outer, remaining testing result is positive (see Fig. 3)；Then choose that treated that CHO is thin Born of the same parents' supernatant carries out 10,100,1000 times of gradient dilution with TE buffer, and test recombinase polymeric enzymatic amplification is (outside in conjunction with nucleic acid Enzyme cutting III) method sensitivity, dilution 1000 times cell conditioned medium amplification curve it is very weak, in order to confirm its sensitivity, to cell Supernatant carries out 300,600,900 times of gradient dilution, after detection finally confirms that its sensitivity can detect 900 times of processing of dilution Cell conditioned medium (see Fig. 5,6), sensitivity is entirely capable of reaching application demand.

Meanwhile to above-mentioned 6 kinds of cells (F81, CHO-K1, JURKAT, KATO-III, BHK21, KB), Escherichia coli and ddH₂O carries out qPCR (SYBR Green) and detects, and qPCR mycoplasmas primer is according to Molla Kazemiha et al.^[28,^69-70]Document On sequence synthesized, sequence is as follows：F:GTG GGG AGG AAA YAG GAT TAG AR:GGC ATG ATG ATT TGA CGT CRT, qPCR reaction conditions：95℃2min；45cycles：95 DEG C of 15s, 52 DEG C of 20s, 72 DEG C of 20s, melt curve analysis： 95 DEG C of 15s, 65 DEG C of 60s, 95 DEG C of 15s.It is detected with ABI7500 fluorescent instruments.Sample process is same as above, final qPCR detections knot The same recombinase polymeric enzymatic amplification of fruit (in conjunction with nucleic acid exonucleaseⅢ) methods and results are consistent (see Fig. 4), except cell KB, Escherichia coli And ddH₂O results are presented outside negative, remaining is the positive.Treated Chinese hamster ovary celI supernatant is then chosen, into line sensitivity Detection, final result show that the qPCR Chinese hamster ovary celI supernatants that can detect that treated dilute 900 times of mycoplasma (see Fig. 7,8), together The sensitivity of recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method is identical.

Embodiment two

The primer and probe sequence designed in embodiment one is chosen, carries out recombinase polymeric enzymatic amplification (in conjunction with endonuclease Enzyme IV) method version amplification assay, it is as follows to build amplification reaction system：

30mM trishydroxymethylaminomethanes-acetate buffer solution pH8.0

100mM potassium acetates

14mM magnesium acetates

3mM dithiothreitol (DTT)s

5% polyethylene glycol (20000)

3mM ATP

30mM phosphocreatines

100ng/ul creatine kinases

400ng/ul Escherichia coli recA albumen

200ng/ul Escherichia coli SSB albumen

60ng/ul Escherichia coli recO albumen

40ng/ul Escherichia coli recR albumen

60ng/ul Escherichia coli recF albumen

8Units bacillus subtilis DNA polymerase is

50ng/ul endonucleases IV

450uM dNTP

Every sense primer of 250uM

Every downstream primer of 250uM

120nM fluorescence probes

It is 42 DEG C to expand temperature, reacts 30min, fluorescence is detected with Molarray MA-1610 constant temperature amplified fluorescence instrument Changing value, per 30s read first order fluorescence.Detect above-mentioned 6 kinds of cells (F81, CHO-K1, JURKAT, KATO-III, BHK21, KB), Escherichia coli and ddH₂O。

Sample process：200ul cell conditioned mediums are taken, 95 DEG C are boiled 5min and take supernatant spare.Testing result and qPCR, recombinase Polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) methods and results are consistent, in addition to cell KB, Escherichia coli and ddH₂O results are the moon Outside property, remaining testing result is the positive；The Chinese hamster ovary celI supernatant of different extension rates, tests recombinase after subsequent selection processing The sensitivity of polymeric enzymatic amplification (in conjunction with endonuclease IV) method can finally detect the cell conditioned medium of 900 times of dilution (see figure 9), although sensitivity and recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method are essentially identical, it is average to play peak time It is more late 2-3min than recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method.

Embodiment three

The common mycoplasma of 8 kinds of the design preferences of all primers and probe consideration (M.arginini, M.fermentans, M.hominis, M.orale, M.hyorhinis, M.salivarium, M.pirum and Acholeplamasa Laidlaawii), consider further that on this basis and cover other mycoplasmas, while to exclude the interference of Escherichia coli, comparison result See Figure 10：

Probe and primer sequence are as follows：

Upstream primer sequence：5 '-CACCTCGATGTCGRCTCATCTCATCCTCGA-3 ' (Seq ID No 6), can expand All 23 mycoplasma species；

Three, downstream primer sequence is respectively：5’-CTAGGAACAGCTCTTCTCAATCTTCCTACGGG-3’(Seq ID No 7), can amplify M.gallisepticum, M.pirum, M.pneumoniae, M.penetrans, M.capricolum, Ureaplasma urealyticum totally 6 mycoplasma species；5’-GTAGCTCTCATCAATATTCCAACGCCCACAT-3’(Seq ID No 8), can amplify M.bovis, M.bovoculi, M.fermentans, M.synoviae, M.pulmonis, M.flocculare、M.hyorhinis、M.hominis、M.arginini、M.arthritidis、M.hyosynoviae、 M.orale、M.salivarium、M.hyopneumoniae、Acholeplamasa laidlaawii、Spiroplasma Citri totally 16 mycoplasma species；5 '-CTAGAAGCAAAGCTCTTCAATCTTCCTGTGGG-3 ' (Seq ID No 9), are that can expand Increase and M.genitalium；

Probe sequence is respectively：TTCGCCCATTAAAGCGGTACGCGAGCTGGGTT(FAM-dT)A(THF)AACG (BHQ1-dT)CGTGAGACAGTT(C3-SPACER)、TTCGCCGATTAAAGAGATACGTGAGTTGGGTT(FAM-dT)A (THF)ACCG(BHQ1-dT)CGTGAGACAGGT(C3-SPACER)。

It is expanded, is built using recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method amplification reaction system Amplification reaction system is as follows：

30mM trishydroxymethylaminomethanes-acetate buffer solution pH8.0

100mM potassium acetates

14mM magnesium acetates

3mM dithiothreitol (DTT)s

5% polyethylene glycol (molecular weight 20000)

3mM ATP

30mM phosphocreatines

100ng/ul creatine kinases

400ng/ul Escherichia coli recA albumen

200ng/ul Escherichia coli SSB albumen

60ng/ul Escherichia coli recO albumen

40ng/ul Escherichia coli recR albumen

60ng/ul Escherichia coli recF albumen

8Units Klenow polymerase Large fragments (exo-)

50ng/ul exonucleases III

450uM dNTP

420uM sense primers

Every downstream primer of 250uM

Every fluorescence probe of 80uM

It is 37 DEG C to expand temperature, reacts 30min, fluorescence is detected with Molarray MA-1610 constant temperature amplified fluorescence instrument Changing value, per 30s read first order fluorescence.Detect above-mentioned 6 kinds of cells (F81, CHO-K1, JURKAT, KATO-III, BHK21, KB), Escherichia coli and ddH₂O。

Sample process：200ul cell culture fluids are taken, 95 DEG C are boiled 5min and take supernatant spare.Testing result in addition to cell KB, Escherichia coli and ddH₂O results are negative outer, remaining testing result is the positive.

Example IV

The design preferences of all primers and probe consider this 8 kinds of common mycoplasmas, consider further that on this basis cover it is other Mycoplasma, while the interference of Escherichia coli is excluded, comparison result is shown in Figure 11-12：

The primer sequence of upstream three is respectively：5’-AATTTGAAGATACGCGGAGAACCTTACCCAC-3’(Seq ID No 10), can amplify M.bovis, M.bovoculi, M.fermentans, M.synoviae, M.pulmonis, M.flocculare、M.hyorhinis、M.hominis、M.arginini、M.arthritidis、M.hyosynoviae、 M.orale, M.salivarium, M.hyopneumoniae totally 14 mycoplasma species；5’- TGGTGGAGCATGTTGCTTAATTCGACGGTACA-3 ' (Seq ID No 11), can amplify M.genitalium, M.gallisepticum、M.pirum、M.pneumoniae、M.penetrans、Ureaplasma urealyticum、 Spiroplasma citri, M.capricolum totally 8 mycoplasma species；5’- AGGCTTAGAAATAAGTTCGGAGGCTAACAGATG-3 ' (Seq ID No12), can amplify Acholeplamasa Laidlaawii mycoplasmas；

Two, downstream primer sequence is respectively：5’-ACGTGTGTTGCCCCACTCGTAAGAGGCATGATGAT-3’(Seq ID No13) can amplify M.genitalium, M.gallisepticum, M.pirum, M.pneumoniae, M.penetrans、M.capricolum、Ureaplasma urealyticum、Spiroplasma citri、 Acholeplamasa laidlaawii totally 9 mycoplasma species；5’-TTTGCAGCCCTAGACATAAGGGGCATGATGAT-3’ (Seq ID No 14) can amplify M.bovis, M.bovoculi, M.fermentans, M.synoviae, M.pulmonis, M.flocculare、M.hyorhinis、M.hominis、M.arginini、M.arthritidis、M.hyosynoviae、 M.orale, M.salivarium, M.hyopneumoniae totally 14 mycoplasma species；

Probe sequence is：CAGATGGTGCATGGTTGTCGTCAGCTCGTG(FAM-dT)C(THF)(BHQ1-dT) GAGATGTTTGGTCA(C3-SPACER)。

It is expanded, is built using recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method amplification reaction system Amplification reaction system is as follows：

30mM trishydroxymethylaminomethanes-acetate buffer solution pH8.0

100mM potassium acetates

14mM magnesium acetates

3mM dithiothreitol (DTT)s

5% polyethylene glycol (molecular weight 20000)

3mM ATP

30mM phosphocreatines

100ng/ul creatine kinases

600ng/ul bacteriophage gp32 albumen

150ng/ul bacteriophage uvsX albumen

25ng/ul bacteriophage uvsY albumen

20ng/ul Klenow polymerase Large fragments (exo-)

50ng/ul exonucleases III

450uM dNTP

Every sense primer of 250uM

Every downstream primer of 250uM

120uM fluorescence probes

It is 37 DEG C to expand temperature, reacts 20min, fluorescence is detected with Molarray MA-1610 constant temperature amplified fluorescence instrument Changing value, per 30s read first order fluorescence.Detect above-mentioned 6 kinds of cells (F81, CHO-K1, JURKAT, KATO-III, BHK21, KB), Escherichia coli and ddH₂O。

Sample process：200ul cell culture fluids are taken, 95 DEG C are boiled 5min and take supernatant spare.Testing result in addition to cell KB, Escherichia coli and ddH₂O results are negative outer, remaining testing result is the positive.

Embodiment five

The design preferences of all primers and probe consider this 8 kinds of common mycoplasmas, consider further that on this basis cover it is other Mycoplasma, while the interference of Escherichia coli is excluded, comparison result is shown in Figure 13：

The primer sequence of upstream three is respectively：5’-CTGTACCATTTTGAATAAGTGACGACTAACTAT-3’(Seq ID No 15)、5’-CGGTACCTGATTAGAAAGCAACGGCTAACTAT-3’(Seq ID No 16)、5’- CGGTACCCTGTCAGAAAGCGATGGCTAACTAT-3 ' (Seq ID No 17), the primer of upstream 3 can amplify all 23 kinds Mycoplasma；

Two, downstream primer sequence is respectively：5’-CTACAGACGCTTTACGCCCAATAATTTCGGA-3’(Seq ID No 18), 5 '-CTACGCACCCTTTACGCCCAGTAAATCCGGA-3 ' (Seq ID No 19), two, downstream primer can expand Go out all 23 mycoplasma species；

Probe sequence is：GGCTAACTATGTGCCAGCAGCCGCGGTAA(FAM-dT)A(THF)A(BHQ1-dT) AGGKGGCGAGCGTTATC(C3-SPACER)。

It is expanded, is built using recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method amplification reaction system Amplification reaction system is as follows：

30mM trishydroxymethylaminomethanes-acetate buffer solution pH8.0

100mM potassium acetates

14mM magnesium acetates

3mM dithiothreitol (DTT)s

5% polyethylene glycol (molecular weight 20000)

3mM ATP

30mM phosphocreatines

100ng/ul creatine kinases

600ng/ul bacteriophage gp32 albumen

150ng/ul bacteriophage uvsX albumen

25ng/ul bacteriophage uvsY albumen

20ng/ul Klenow polymerase Large fragments (exo-)

50ng/ul exonucleases III

450uM dNTP

Every sense primer of 250uM

Every downstream primer of 250uM

120uM fluorescence probes

It is 37 DEG C to expand temperature, reacts 30min, fluorescence is detected with Molarray MA-1610 constant temperature amplified fluorescence instrument Changing value, per 30s read first order fluorescence.Detect above-mentioned 6 kinds of cells (F81, CHO-K1, JURKAT, KATO-III, BHK21, KB), Escherichia coli and ddH₂O。

Sample process：200ul cell culture fluids are taken, 95 DEG C are boiled 5min and take supernatant spare.Testing result in addition to cell KB, Escherichia coli and NTC results are negative outer, remaining testing result is the positive.

Embodiment six

The primer and probe sequence designed in embodiment five is chosen, carries out recombinase polymeric enzymatic amplification (in conjunction with Exonucleolytic Enzyme III) method amplification assay, it is as follows to build amplification reaction system：

30mM trishydroxymethylaminomethanes-acetate buffer solution pH8.0

100mM potassium acetates

14mM magnesium acetates

3mM dithiothreitol (DTT)s

5% polyethylene glycol (molecular weight 20000)

3mM ATP

30mM phosphocreatines

100ng/ul creatine kinases

600ng/ul bacteriophage gp32 albumen

150ng/ul bacteriophage uvsX albumen

25ng/ul bacteriophage uvsY albumen

20ng/ul Klenow polymerase Large fragments (exo-)

50ng/ul exonucleases III

450uM dNTP

Every sense primer of 250uM

Every downstream primer of 250uM

120uM fluorescence probes

Template 10ng genomic DNAs

It is 37 DEG C to expand temperature, reacts 30min, fluorescence is detected with Molarray MA-1610 constant temperature amplified fluorescence instrument Changing value, per 30s read first order fluorescence.Detect Mycoplasma orale positive plasmid, ddH₂The biology that O and part need to exclude.

Sample process：Extracting need to exclude the genome of biology, measure its concentration, then diluted it respectively with TE buffer It is spare to 10ng/ul.

It is detected by recombinase polymeric enzymatic amplification (in conjunction with nucleic acid exonucleaseⅢ) method, final result is in addition to oral cavity branch original Body positive plasmid result is positive outer, remaining is negative (see the table below).

Bibliography

[1]Cord CUphoff,Hans GDrexler.Detection of Mycoplasma contamination in cell cultures[J].Molecular Biology,2014,28.4.1-28.4.14.

[2]Drexler,H.G.and Uphoff,C.C.Mycoplasma contamination of cell cultures:Incidence,

sources,effects,detection,elimination,prevention[J].Cytotechnol,2002, 39:23-38.

[3]Uphoff,C.C.and Drexler,H.G.Prevention of mycoplasma contamination in leukemialy-mphomacell lines[J].Human Cell,2001,14:244-247.

[4]Wang H,Kang F,Jelfs P,James G,Gilbert GL.Simultaneous detection and identification of common cell culture contaminant and pathogenic mollicutes strain by reverse line blot hybridization[J].Appl Environ Microbiol,2004,70:1483–1486.

[5]Sung H,Kang SH,Bae YJ,Hong JT,Chung YB et al.PCR-based detection of Mycoplasma species[J].Microbiol,2006,44:42–49.

[6]L.Young,J.Sung,G.Stacey,and J.R.Masters.Detection of Mycoplasma in cell cultures[J].Nature protocols,2010,5,(5):929–934.

[7]Tabatabaei-Qomi R,Sheykh-Hasan M,Fazaely H et al.Development of a PCR assay to detect Mycoplasma contamination in cord blood hematopoietic stem cells[J].Iran J Microbiol,2014,6(4):281-4.

[8]Nikfarjam L,Farzaneh P.Prevention and detection of Mycoplasma contamination in cell culture[J].Cell,2012,13:203–212.

[9]Vahid Molla Kazemiha,Shahin Bonakdar,Amir Amanzadeh et al.Real- time PCR assay is superior to other methods for the detection of mycoplasma contamination in the cell lines of the National Cell Bank of Iran[J] .Cytotechnology,2016,68(4):1063–1080.

[10]Kong,F,James,G,Gordon,S,Zelynski,A,andGilbert,G.L.Species- PCR for of common contaminant Mollicutes in cell culture[J] .Appl EnvironMicrobiol,2001,67:3195-3200.

[11]M.Hannah Degeling,Casey A,Maguire,M,Sarah S.Bovenberg.Sensitive assay for Mycoplasma detection in mammalian cell culture[J].Analytical Chemistry,2012,84:4227-4232.

[12]Loens K,Uris D,Goossens H,Ieven M.Molecular diagnosis of Mycoplasma pneumoniae respiratory tract infections[J].Clin Microbiol 2003,41: 4915–4923.

[13]Mardassi BB,Mohamad RB,GueririI,Boughattaas S,Mlik B.Duplex PCR to differentiate between Mycoplasma synoviae and Mycoplasma gallisepticum on the basis of conserved species-specific sequences of their hemagglutinin genes[J].Clin Microbiol,2005,43:948–958.

[14]Master JR.False cell lines:the problem and a solution[J] .Cytotechnology,2002,39:69-74.

[15]Ryan JA.Understanding and managing cell culture contamination[J] .CorniTechnical bulletin life science,1994,15:11-12.

[16]Merten OW.Virus contaminations of cell cultures:a biotechnological view[J].Cytotechnology,2002,39:91-116.

[17]Falagan-Lotsch P,Lopes TS,Ferreira N,Balthazar N,Monteiro AM, Borojevic R,Granjeiro JM.Performance of PCR-based and Bioluminescent assays for mycoplasma detection[J].Microbiol Methods,2015,118:31-6.

[18]Uphoff,C.C.and Drexler,H.G.Contamination of cell cultures, mycoplasma in the Encyclopedia of Industrial Biotechnology[J].M.Flickinge, 2010,5:3611-3630.

[19]Brinzeu DGT,Feier V,Herbeck R,Cristodor P,Paunescu M,Condor A,et al.Microbial and fungal contamination of keratinocyte and cell cultures[J].Exp Med Surg Res 2008,15:123-8.

[20] 98,3301 mycoplasma inspection technique of Chinese Pharmacopoeia Commission general rules《Pharmacopoeia of People's Republic of China》[M] .2015 year version Beijing：China Medical Science Press, 2015：518-519.

[21]Cheng H-S,Shen C-W,Wang S-R et al.Effect of storage conditions on detection of mycoplasma in biopharmaceutical products[J].Cell Dev Biol Anim, 2007,43:113–119.

[22]European Directorate for the Quality of Medicines(EDQM): Mycoplasma；in European pharmacopoeia,7th ed.Council of Europe,Strasbourg, 2007,Section 2.6.7.

[23]Rabinson L B,Yogev D,Naot Y.Molecular biology and pathogenicity ofmycoplasmas[J].Microbiol Mol Biol Rev,1998,62:1094-1156.

[24]Fraser C M,Gocayne J D,Whge O,et al.The minimal gene complement of Mycoplasma genitalium[J].Science,1995,270:397-403.

[25] Himmelreich R, Hilbert H, Plagens H, et al.Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae[J].NuclAcids Res,1996,24,4420-4449.

[26]C.C.Upho and H.G.Drexler.Mycoplasma contamination of cell cultures,in Encyclopedia of Industrial Biotechnology:Bioprocess,Bioseparation [J].Cell Technology,2010,3611-3630.

[27]PeredeltchoukM,Wilson DavidS,Bhattacharya B,VolokhovD,Chizhikov V.Detection of mycoplasma contamination in cell substrates using reverse transcriptionPCR assays[J].Appl Microbiol,2011,110:54–60.

[28]Molla Kazemiha V,Amanzadeh A,Memarnejadian A et al.Sensitivity of biochemical test in comparison with other methods for the detection of mycoplasma contamination in human and animal cell lines stored in the National Cell Bank of Iran[J].Cytotechnology,2014,66(5):861-73.

[29]Volokhov DV,Graham LJ,Brorson KA,Chizhikov.VE.Mycoplasma testing of cell substrates and biologics:review of alternative non-microbiological techniques[J].Mol Cell Probes,2011,25(2-3):69-77.

[30]Claudia Zylberberg,Juan Manuel Rodriguez,Andres Clemente Hernando Insua,Ricardo Ariel Lopez.Detection of Mycoplasma in cell cultures and cell culture derived biologicals[P].US2015/0111207 A1,2015-04-23.

[31]Remy Teyssou,Francoise Poutiers,Colette Saillard.Detection of mollicute contamination in cell cultures by 16S rDNA amplification[J] .Molecular and Cellular Probes,1993,7:209-216.

[32]Quirk JT,Kupinski JM,Dicioccio RA.Detection of Mycoplasma ribosomal DNA sequences in ovarian tumors by nested PCR[J].Gynecol Oncol 2001；83:560–562.

[33]Tang J,HuM,Lee S,Robin RA.Polymerse chain reaction based method for detecting Mycoplasma Acholeplasma contaminants in cell culture[J] .Microbiol Methods 2000,39:121–126.

[34]Kong F,James G,Gordon S,Zelynski A,Gilbert GL.Species-specific PCR for identification of common contaminant Mollicutes in cell culture[J] .Appl Environ Microbiol,2001；67:3195–3200.

[35]Stormer M,Vollmer T,Henrich B,Kleesiek K,Dreier J.Broad-range real-time PCR assay for the rapid identification of cell-line contaminants and clinically important mollicute species[J].Med Microbiol,2009,299(4):291- 300.

[36]Lorenzon S,Manso-Silván L,Thiaucourt F.Specific real-time PCR assays for the detection and quantification of Mycoplasma mycoides subsp.mycoides SC and Mycoplasma capricolum subsp.capri pneumoniae[J].Mol Cell Probes,2008,22(5-6):324-8.

[37]Gerlier,Blanquier,Jean,Grosjean.Method for universal detection and quantification of Mycoplasma(Mollicutes)16SrDNA by quantitative polymerase chain reaction amplifying a 1.5 kilobase fragment[P].WO2017/178587 A1,2017-09-19.

[38]Ursi D,Dirven K,Loens K et al.Detection of Mycoplasma pneumoniae in respiratory samples by real-time PCR using an inhibition control[J] .Microbiol Methods,2003,55(1):149-53.

[39]Claudia Litterst,Luis A.Ugozzoli.Rapid detectionn of Mycoplasma contamination in cell cuture samples[P].US:US2011/0104686A1,2011-05-05.

[40]Notomi T,Okayama H,Masubuchi H,Yonekawa T,Watanabe K,Amino N,Hase T.Loop-mediated isothermal amplication of DNA[J].Nucleic Acids Res,2000,18: 12-63.

[41]Saito R,Misawa Y,Moriya K,Koike K,Ubukata K,Okamura N.Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of Mycoplasma pneumoniae[J].Med Microbiol,2005,54(11):1037-41.

[42]He Y,Zhang N-z,Zhao P.Sensitive and rapid detection of Mycoplasma capricolum subsp.capri pneumoniae by Loop-mediated isothermal amplification [J].African Journal of Biotechnology,2014,13:2113-2118.

[43]Jonas M.Winchell.Methods and compositions for isothermal amplification and detection of Mycoplasma pneumoniae[P].US2016/0237479 A1, 2016-8-18.

[44] a kind of LAMP primer groups of detection wide spectrum mycoplasma of Cao Zhen, kit and its application [P] .CN 105755161A,2016,7,13.

[45]Matsuzaki I,Iguchi H,Mikasa Y.Novel Application of Loop-mediated Isothermal Amplification for Rapid Detection of Gene Translocation[J].Acta Histochem Cytochem,2017,50(6):169-176.

[46]Nagamine K,Hase T,Notomi T.Accelerated reaction by loop-mediated isothermal amplification using loop primers[J].Mol Cell Probes,2002,16(3): 223-229.

[47]Zyrina N V,Zheleznaya L A,Dvoretsky E V,Vasiliev V D,Chernov A, Matvienko N I.BspD61DNA nickase strongly stimulates template-independt synthesis of non-palindromic repetitive DNA by Bst DNA poly-merase[J].Biol Chem,2007,388(4):367-372.

[48]Hill J,Beriwal S,Chandra I,Paul VK,Kapil A,Singh T.A Loop- mediated isothermal assay for rapid detection of common strains of Escherichia coli[J].Clin Microbiol2008,46:2800-2804.

[49]Lau YL,Meganathan P,Sonaimuthu P,Thiruvengadam G. sensitive,and rapid diagnosis of active toxoplasmosis by a loop-mediated isothermal method usingblood samples from patients[J].Clin Microbiol,2010,48:3698-3702.

[50]Koizumi N,Nakajima C,Harunari T,Tanikawa T.A new loop-mediated isothermal method for rapid,simple,and sensitive detection of Leptospira spp.in urine[J].ClinMicrobiol,2012,50:2072-2074.

[51]Mariotti E,Mirabelli P,Di Noto R,Fortunato G,Salvatore F.Rapid detection of mycoplasma in continuous cell lines using a selective biochemical test[J].Leuk Res,2008,32:323-326.

[52]Gandelman O,Jackson R,Kiddle G,Tisi L.Loop-mediated accelerated by stem primers[J].Mol.Sci,2011,12:9108-9124.

[53]Hosaka N,Ndembi N,Ishizaki A,Kageyama S,Numazaki K,Ichimura H.Rapid detection of human virus type 1groupM by a reverse transcription-loop-mediated isothermal assay[J].Virol.Methods, 2009,157:195-199.

[54]O Mayboroda,I Katakis,CK OSullivan.Multiplexed isothermal nucleic acid amplification[J].Analytical Biochemistry,2018,545:20-30.

[55]Olaf Piepenburg,Colin H.Williams,Derek L.Stemple.DNA Detection Using Recombination Proteins[J].PLoS Biol,2006,4(7):e204.

[56]Ahmed A,van der Linden H,Hartskeerl RA.Development of a recombinase polymerase assay for the detection of pathogenic Leptospira[J].Int JEnviron Res Public Health,2014,11:4953e64.

[57]Daher RK,Stewart G,Boissinot M,Bergeron MG.Isothermal recombinase polymerase assay applied to the detection of group B streptococci in vaginal/anal samples[J].Clin Chem,2014,60:660e6.

[58]Hill-Cawthorne GA,Hudson LO,El Ghany MF,Piepenburg O,Nair M, Dodgson A,et al.Recombinations in staphylococcal cassette chromosome mecelements compromise the molecular detection of methicillin resistance in Staphylococcus aureus[J].PLoS One,2014,9:e101419.

[59]David S.Boyle,Dara A.Lehman,Lorraine Lillis.Rapid Detection of HIV-1 Proviral DNA for Early Infant Diagnosis Using Recombinase PolymeraseM Bio,2013,4(2):e00135-13.

[60]Euler M,Wang Y,Otto P,Tomaso H,Escudero R,Anda P,Hufert FT, Weidmann M.Recombinase polymerase assay for rapid detection of Francisella tularensis[J].Clin Microbiol,2012,50:2234-2238.

[61]Euler M,Wang Y,Nentwich O,Piepenburg O,Hufert FT,Weidmann M.Recombinase polymerase -cation assay for rapid detection of Rift Valley fever virus[J].Clin Virol 2012,54:308-312.

[62]Krolov K,Frolova J,Tudoran O.Sensitive and rapid detection of Chlamydia trachomatis by recombinase polymerase amplification directly from urine samples[J].Mol Diagn,2014,16:127-135.

[63]Liljander A,Yu M,OBrien E,Heller MLiljander A,Yu M,OBrien E, Heller M.A field-applicable recombinase polymerase amplification assay for rapid detection of Mycoplasma capricolum subsp.capri pneumoniae[J].J Clin Microbiol,2015,53(9):2810-5.

[64]Patil KN,Singh P,Muniyappa K.DNA binding,coprotease,and strand exchange activities of mycobacterial RecA proteins:implications for functional diversity among RecA nucleoprotein filaments[J].Biochemistry,2011, 50:300e11.

[65]Abd El Wahed A,El-Deeb A,El-Tholoth M,Abd El Kader H,Ahmed A, Hassan S,et al.A portable reverse transcription recombinase polymerase assay for rapid detection of foot-and-mouth disease virus[J] .PLoS One,2013,8:e71642.

[66]Rana K.Daher,Gale Stewart,Maurice Boissinot.Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology[J].Mol Cell Probes,2014,11:005.

[67]Feng Chen,Yue Zhao,Chunhai Fan,Yongxi Zhao.Mismatch Extension of DNA Polymerases and High-Accuracy SNP Diagnostics by Gold Nanoparticles- Improved Isothermal Amplification[J].Anal.Chem,2015,87(17):8718-23.

[68]WangY,ZhangZ,Ramanan N.The actinomycete Thermobispora bispora contains two distinct types of transcriptionally active 16S rRNAgenes[J] .Bacteriology,1997,179(10):3270-3276.

[69]Molla Kazemiha V,Azari S,Amanzadeh A,Bonakdar S,Moghadam MS, Anbouhi MH,Maleki S,Ahmadi N,

Mousavi T,Shokrgozar MA.Efficiency of Plasmocin TM on various mammalian cell lines infected by

mollicutes in comparison with commonly used antibiotics in cell culture:a local experience[J].Cytotechnology,2011,63:609–620.

[70]Molla Kazemiha V,Shokrgozar MA,Arabestani MR,Moghadam MS,Azari S, Maleki S,Amanzadeh A,Tehrani MJ,Shokri F.PCR-based detection and eradication of mycoplasmal infections from various mammalian cell lines:a local experience[J].Cytotechnology,2009,61:117–124.

Sequence table

<110>Suzhou first reaches Gene Tech. Company Limited

<120>Mycoplasma contamination detection method and application

<130> 2018001

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

Claims (10)

1. a kind of method of detection Mycoplasma Contamination In Cell Cultures, it is characterised in that expand using based on recombinase polymerase constant temperature Increasing method, in mycoplasma genome conservative region or specific regions as detection targeting section be detected.

2. it is described in claim 1 detection cell culture in mycoplasma method, it is characterised in that with the rDNA of mycoplasma as Detection targeting section.

3. the method for mycoplasma in detection cell culture described in claim 1, it is characterised in that the reaction system packet of this method Include recombinase, polymerase, single-stranded DNA binding protein, nuclease, at least pair of primers, a probe, dNTP, template to be detected, Crowding agent, recombination load albumen, energy system and salt ion.

4. the method for mycoplasma in the detection cell culture described in claim 3, it is characterised in that the recombinase is selected from phagocytosis Body UvsX albumen, any one or more combinations of Escherichia coli recA albumen；The polymerase polymerize selected from klenow Any one or more combinations of the mutant or large fragment of enzyme, bsu polymerases or phi29 polymerases and its these enzymes； The single-stranded DNA binding protein is selected from Escherichia coli SSB albumen, GP32 albumen it is any or combinations thereof；The nuclease choosing From exonuclease III, any one or more combinations of endonuclease IV or formyl amic metadiazine-DNA glycosylases； Recombination load albumen is selected from bacteriophage UvsY albumen, and Escherichia coli RecO or Escherichia coli RecR's is any or a kind of Above combination；The crowding agent is selected from polyethylene glycol, polyvinyl alcohol, the one or more of dextran or ficoll Combination, wherein the polyethylene glycol be selected from PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG20000, PEG25000, PEG30000, PEG35000 or PEG40000；The energy system is selected from ATP or ATP, phosphoric acid flesh Acid, the combination of creatine kinase；Salt ion is selected from Trips, any one or more combinations of magnesium ion or potassium ion.

5. the method for mycoplasma in the detection cell culture described in claim 4, it is characterised in that the primer includes at least two Item is 15-45 nucleotide bases respectively in connection with the length in the upstream and downstream in the regions to be amplified mycoplasma rDNA, primer, excellent It is selected as 28-35 nucleotide bases, a continuous section of the rDNA of the mycoplasma to be detected of primer and all kinds has at least 80% Sequence similarity, at least one base at least one primer, 3 ' end and the nucleic acid sequence of mycoplasma to be detected are completely the same, And it is inconsistent at least one base of Escherichia coli homology segment, primer can be chemically modified, and the chemical modification is preferred For any one or more combinations of PNA, LNA or BNA；The probe length is 35-55 nucleotide base, preferably 42-50 base, a base in probe positioned at 28-35 are replaced by nucleic acid analog, and the nucleic acid analog is excellent It is selected as THF, is respectively two T bases and mark fluorescent group and quenching group in the both sides of THF, '-end passes through probe 3 Blocking groups are closed.

6. the method for mycoplasma in the detection cell culture described in claim 5, it is characterised in that the primer is selected from such as the following group It closes：

Group unification：

Sense primer 1：5’-ACCACCCGGTAAGGCTAAATACTAACCAGAC-3’

Sense primer 2：5’-AGGACCATCTCCTAAGGCTAAATACTACTTGG-3’

Sense primer 3：5’-CAAACCATTGGGTAAGCCTAAATACTAGTCAG-3’

Downstream primer 1：5’-CACCCATTAACGGGCTCTGACTAATTGTAA-3’

Downstream primer 2：5’-CACACATTAATGGGCTCTGACACGTTGTAG-3’

Combination two：

Sense primer：5’-CACCTCGATGTCG（A/G）CTCATCTCATCCTCGA-3’

Downstream primer 1：5’-CTAGGAACAGCTCTTCTCAATCTTCCTACGGG-3’

Downstream primer 2：5’-GTAGCTCTCATCAATATTCCAACGCCCACAT-3’

Downstream primer 3：5’-CTAGAAGCAAAGCTCTTCAATCTTCCTGTGGG-3’

Combination three：

Sense primer 1：5’-AATTTGAAGATACGCGGAGAACCTTACCCAC-3’

Sense primer 2：5’-TGGTGGAGCATGTTGCTTAATTCGACGGTACA -3’

Sense primer 3：5’-AGGCTTAGAAATAAGTTCGGAGGCTAACAGATG-3’

Downstream primer 1：5’-ACGTGTGTTGCCCCACTCGTAAGAGGCATGATGAT-3’

Downstream primer 2：5’-TTTGCAGCCCTAGACATAAGGGGCATGATGAT-3’

Or combination four：

Sense primer 1：5’-CTGTACCATTTTGAATAAGTGACGACTAACTAT-3’

Sense primer 2：5’-CGGTACCTGATTAGAAAGCAACGGCTAACTAT-3’

Sense primer 3：5’-CGGTACCCTGTCAGAAAGCGATGGCTAACTAT-3’

Downstream primer 1：5’-CTACAGACGCTTTACGCCCAATAATTTCGGA-3’

Downstream primer 2：5’-CTACGCACCCTTTACGCCCAGTAAATCCGGA-3’.

7. the method that claim 1-6 any one of them detects mycoplasma in cell culture, it is characterised in that reaction temperature is 25-45 DEG C, preferably 37-42 DEG C；Reaction time is 15-60 minutes, preferably 15-30 minutes.

8. application of any one of the claim 5-6 primer and probes in preparing cell culture in mycoplasma test reagent.

9. the kit of mycoplasma in a kind of detection cell culture, it is characterised in that including recombinase, polymerase, single stranded DNA knot Hop protein, nuclease, at least pair of primers, a probe, dNTP, template to be detected, crowding agent, recombination load albumen, energy Amount system and salt ion.

10. the kit of mycoplasma in the detection cell culture described in claim 9, it is characterised in that the recombinase is selected from and bites Thalline UvsX albumen, any one or more combinations of Escherichia coli recA albumen；The polymerase is poly- selected from klenow Any one or more groups of the mutant or large fragment of synthase, bsu polymerases or phi29 polymerases and its these enzymes It closes；The single-stranded DNA binding protein is selected from Escherichia coli SSB albumen, GP32 albumen it is any or combinations thereof；The nuclease Selected from exonuclease III, any one or more groups of endonuclease IV or formyl amic metadiazine-DNA glycosylases It closes；Recombination load albumen is selected from bacteriophage UvsY albumen, Escherichia coli RecO or Escherichia coli RecR any or one Kind or more combination；The crowding agent is selected from polyethylene glycol, polyvinyl alcohol, one kind of dextran or ficoll or it is a kind of with On combination, wherein the polyethylene glycol be selected from PEG1450, PEG3000, PEG8000, PEG10000, PEG14000, PEG20000, PEG25000, PEG30000, PEG35000 or PEG40000；The energy system is selected from ATP or ATP, phosphoric acid flesh Acid, the combination of creatine kinase；Salt ion is selected from Trips, any one or more combinations of magnesium ion or potassium ion；It is described Primer includes at least two, is 15-45 respectively in connection with the length in the upstream and downstream in the regions to be amplified mycoplasma rDNA, primer One of the rDNA of the mycoplasma to be detected of nucleotide base, preferably 25-35 nucleotide bases, primer and all kinds is continuous Section has at least 80% sequence similarity, the nucleic acid of at least one primer, 3 ' end at least one base and mycoplasma to be detected Sequence is completely the same, and inconsistent at least one base of Escherichia coli homology segment；The probe length is 35-55 nucleosides Soda acid base, preferably 42-50 base, a base in probe positioned at 25-35 is replaced by nucleic acid analog, described Nucleic acid analog is preferably THF, is respectively two T bases and mark fluorescent group and quenching group, probe in the both sides of THF It is closed by blocking groups in 3 '-ends, the preferably described primer is selected from any one following combination,

Group unification：

Sense primer 1：5’-ACCACCCGGTAAGGCTAAATACTAACCAGAC-3’

Sense primer 2：5’-AGGACCATCTCCTAAGGCTAAATACTACTTGG-3’

Sense primer 3：5’-CAAACCATTGGGTAAGCCTAAATACTAGTCAG-3’

Downstream primer 1：5’-CACCCATTAACGGGCTCTGACTAATTGTAA-3’

Downstream primer 2：5’-CACACATTAATGGGCTCTGACACGTTGTAG-3’

Combination two：

Sense primer：5’-CACCTCGATGTCG（A/G）CTCATCTCATCCTCGA-3’

Downstream primer 1：5’-CTAGGAACAGCTCTTCTCAATCTTCCTACGGG-3’

Downstream primer 2：5’-GTAGCTCTCATCAATATTCCAACGCCCACAT-3’

Downstream primer 3：5’-CTAGAAGCAAAGCTCTTCAATCTTCCTGTGGG-3’

Combination three：

Sense primer 1：5’-AATTTGAAGATACGCGGAGAACCTTACCCAC-3’

Sense primer 2：5’-TGGTGGAGCATGTTGCTTAATTCGACGGTACA -3’

Sense primer 3：5’-AGGCTTAGAAATAAGTTCGGAGGCTAACAGATG-3’

Downstream primer 1：5’-ACGTGTGTTGCCCCACTCGTAAGAGGCATGATGAT-3’

Downstream primer 2：5’-TTTGCAGCCCTAGACATAAGGGGCATGATGAT-3’

Or combination four：

Sense primer 1：5’-CTGTACCATTTTGAATAAGTGACGACTAACTAT-3’

Sense primer 2：5’-CGGTACCTGATTAGAAAGCAACGGCTAACTAT-3’

Sense primer 3：5’-CGGTACCCTGTCAGAAAGCGATGGCTAACTAT-3’

Downstream primer 1：5’-CTACAGACGCTTTACGCCCAATAATTTCGGA-3’

Downstream primer 2：5’-CTACGCACCCTTTACGCCCAGTAAATCCGGA-3’.