CN110129459B - LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application - Google Patents
LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application Download PDFInfo
- Publication number
- CN110129459B CN110129459B CN201810113531.XA CN201810113531A CN110129459B CN 110129459 B CN110129459 B CN 110129459B CN 201810113531 A CN201810113531 A CN 201810113531A CN 110129459 B CN110129459 B CN 110129459B
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- stranded dna
- dna molecule
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application thereof. The invention firstly provides a primer combination which is composed of 30 DNA molecules shown in a sequence 1 to a sequence 30. The primer combination can be used for detecting whether the bacteria to be detected are staphylococcus epidermidis, staphylococcus aureus, enterococcus faecalis, enterococcus faecium or streptococcus pyogenes, and can be used for detecting whether the samples to be detected contain staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes. The primer combination provided by the invention is used for detecting 5 gram-positive bacteria in intraocular fluid, has high specificity and high sensitivity, and can realize simple, convenient, rapid and accurate detection. The invention has great popularization value.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application thereof.
Background
Gram-positive bacteria are the leading causative bacteria of bacterial endophthalmitis. Retrospective analysis by hypersensitive et al 146 cases of keratitis patients who were positive for bacterial culture in Beijing Hospital from month 1 2010 to month 4 2015, 56.2% (82 cases) of pathogenic bacteria were gram-positive bacteria. Staphylococcus epidermidis (Staphylococcus epidermidis), staphylococcus aureus (Staphylococcus aureus), enterococcus faecalis (Enterococcus faecalis), enterococcus Faecium (Enterococcus faecalis), streptococcus faecalis (Streptococcus faecalis) and Streptococcus pyogenes (Streptococcus pyogenenes) are the most common 5 types of gram-positive pathogenic bacteria in clinical practice. Staphylococcus epidermidis is a kind of bacteria growing in the epidermis of organisms, belongs to a normal flora type, is mostly nonpathogenic, is rarely pathogenic, can cause diseases, and is caused by Staphylococcus epidermidis. Staphylococcus aureus, an important pathogenic bacterium in humans, belongs to the genus Staphylococcus (Staphylococcus), is a representative of gram-positive bacteria, and can cause many serious infections. Enterococcus faecalis and enterococcus faecium are common bacterial pathogens after cataract surgery and after eye trauma. Streptococcus pyogenes, group A Streptococcus (GAS), is one of the important pathogenic bacteria that cause intraocular inflammation, and is subject to beta hemolysis.
The current clinical detection methods for gram-positive bacteria mainly comprise isolated culture, smear microscopy and serological detection. The detection methods are complicated, long in detection time, low in sensitivity, easy to miss detection and error detection and incapable of meeting the requirement of rapid detection. The application of the molecular detection technology developed in recent years, particularly the PCR technology, in the aspects of quick identification and detection of microorganisms opens up a new way for the quick detection of bacteria. However, PCR has disadvantages of long detection time, susceptibility to contamination, and high false positive rate, and thus its application is limited.
Loop-mediated isothermal amplification (LAMP) is a sensitive, specific, simple and rapid nucleic acid amplification technology developed in recent years, and the principle is that under the action of DNA polymerase with strand displacement activity, 4-6 primers of 6-8 regions are identified, a target gene is rapidly and specifically amplified under an isothermal condition, and the LAMP can be popularized and applied to rapid and accurate detection of bacteria. In the LAMP technology, primers are key factors for determining the sensitivity and specificity of detection results.
Disclosure of Invention
The technical problem to be solved by the invention is how to detect the common gram-positive bacteria in the intraocular fluid.
In order to solve the above technical problems, the present invention provides a primer combination, which can be (a 1) or (a 2) or (a 3) or (a 4) or (a 5):
(a1) The primer set I, the primer set II, the primer set III, the primer set IV and the primer set V are combined;
(a2) The primer group I;
(a3) The primer group I is composed of any one, any two, any three or four of the primer group II, the primer group III, the primer group IV and the primer group V;
(a4) Any two, any three or any four of the primer group I, the primer group II, the primer group III, the primer group IV and the primer group V;
(a5) The primer group I, the primer group II, the primer group III, the primer group IV or the primer group V.
The primer group I can be composed of a primer I-F3, a primer I-B3, a primer I-FIP, a primer I-BIP, a primer I-LF and a primer I-LB;
the primers I to F3 can be (b 1) or (b 2);
(b1) A single-stranded DNA molecule shown in sequence 1 of the sequence table;
(b2) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 1 and have the same functions as the sequence 1;
the primers I-B3 can be (B3) or (B4);
(b3) A single-stranded DNA molecule shown in a sequence 2 of a sequence table;
(b4) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 2 and have the same functions as the sequence 2;
the primer I-FIP can be (b 5) or (b 6);
(b5) A single-stranded DNA molecule shown in sequence 3 of the sequence table;
(b6) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 3 and have the same functions as the sequence 3;
the primer I-BIP can be (b 7) or (b 8) as follows;
(b7) A single-stranded DNA molecule shown in a sequence 4 of the sequence table;
(b8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 4 and having the same functions as the sequence 4;
the primer I-LF can be (b 9) or (b 10);
(b9) A single-stranded DNA molecule shown in sequence 5 of the sequence table;
(b10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 5 and having the same functions as the sequence 5;
the primer I-LB can be (b 11) or (b 12);
(b11) A single-stranded DNA molecule shown in sequence 6 of the sequence table;
(b12) And (b) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 6 and has the same function as the sequence 6.
The primer group II can be composed of a primer II-F3, a primer II-B3, a primer II-FIP, a primer II-BIP, a primer II-LF and a primer II-LB;
the primers II-F3 can be (c 1) or (c 2);
(c1) A single-stranded DNA molecule shown in sequence 7 of the sequence table;
(c2) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 7 and having the same functions as the sequence 7;
the primer II-B3 can be (c 3) or (c 4);
(c3) A single-stranded DNA molecule shown in sequence 8 of the sequence table;
(c4) DNA molecules which are obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 8 and have the same functions as the sequence 8;
the primer II-FIP can be (c 5) or (c 6) as follows;
(c5) A single-stranded DNA molecule shown in sequence 9 of the sequence table;
(c6) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 9 and has the same function as the sequence 9;
the primer II-BIP can be (c 7) or (c 8) as follows;
(c7) A single-stranded DNA molecule shown in sequence 10 of the sequence table;
(c8) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 10 and has the same function as the sequence 10;
the primer II-LF can be (c 9) or (c 10);
(c9) A single-stranded DNA molecule shown in sequence 11 of the sequence table;
(c10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 11 and having the same functions as the sequence 11;
the primer II-LB can be (c 11) or (c 12);
(c11) A single-stranded DNA molecule shown in sequence 12 of the sequence table;
(c12) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 12 and has the same function as the sequence 12.
The primer group III can be composed of a primer III-F3, a primer III-B3, a primer III-FIP, a primer III-BIP, a primer III-LF and a primer III-LB;
the primer III-F3 can be (d 1) or (d 2) as follows;
(d1) A single-stranded DNA molecule shown in sequence 13 of the sequence table;
(d2) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 13 and has the same function as the sequence 13;
the primer III-B3 can be (d 3) or (d 4) as follows;
(d3) A single-stranded DNA molecule shown as a sequence 14 in a sequence table;
(d4) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 14 and has the same function as the sequence 14;
the primer III-FIP can be (d 5) or (d 6) as follows;
(d5) A single-stranded DNA molecule shown in sequence 15 of the sequence table;
(d6) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 15 and having the same functions as the sequence 15;
the primer III-BIP can be (d 7) or (d 8) as follows;
(d7) A single-stranded DNA molecule shown as sequence 16 in the sequence table;
(d8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 16 and having the same functions as the sequence 16;
the primer III-LF can be (d 9) or (d 10);
(d9) A single-stranded DNA molecule shown in sequence 17 of the sequence table;
(d10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 17 and having the same functions as the sequence 17;
the primer III-LB can be (d 11) or (d 12);
(d11) A single-stranded DNA molecule shown in sequence 18 of the sequence table;
(d12) And (b) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 18 and has the same function as the sequence 18.
The primer group IV can be composed of a primer IV-F3, a primer IV-B3, a primer IV-FIP, a primer IV-BIP, a primer IV-LF and a primer IV-LB;
the primer IV-F3 can be (e 1) or (e 2);
(e1) A single-stranded DNA molecule shown as sequence 19 in a sequence table;
(e2) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 19 and has the same function as the sequence 19;
the primer IV-B3 can be (e 3) or (e 4);
(e3) A single-stranded DNA molecule shown in sequence 20 of the sequence table;
(e4) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 20 and having the same functions as the sequence 20;
the primer IV-FIP can be (e 5) or (e 6) as follows;
(e5) A single-stranded DNA molecule shown in sequence 21 of the sequence table;
(e6) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 21 and has the same function as the sequence 21;
the primer IV-BIP can be (e 7) or (e 8) as follows;
(e7) A single-stranded DNA molecule shown as a sequence 22 in a sequence table;
(e8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 22 and having the same functions as the sequence 22;
the primer IV-LF can be (e 9) or (e 10) as follows;
(e9) A single-stranded DNA molecule shown as sequence 23 in the sequence table;
(e10) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 23 and having the same functions as the sequence 23;
the primer IV-LB can be (e 11) or (e 12);
(e11) A single-stranded DNA molecule shown in sequence 24 of the sequence table;
(e12) And (b) a DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 24 and has the same function as the sequence 24.
The primer group V can be composed of a primer V-F3, a primer V-B3, a primer V-FIP, a primer V-BIP, a primer V-LF and a primer V-LB;
the primers V-F3 can be (F1) or (F2);
(f1) A single-stranded DNA molecule shown as sequence 25 in the sequence table;
(f2) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 25 and having the same functions as the sequence 25;
the primer V-B3 can be (f 3) or (f 4);
(f3) A single-stranded DNA molecule shown as a sequence 26 in a sequence table;
(f4) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 26 and has the same function as the sequence 26;
the primer V-FIP can be (f 5) or (f 6);
(f5) A single-stranded DNA molecule shown as sequence 27 in the sequence table;
(f6) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 27 and has the same function as the sequence 27;
the primer V-BIP can be (f 7) or (f 8);
(f7) A single-stranded DNA molecule shown as sequence 28 in the sequence table;
(f8) DNA molecules obtained by substituting and/or deleting and/or adding one or more nucleotides to the sequence 28 and having the same functions as the sequence 28;
the primer V-LF can be (f 9) or (f 10);
(f9) A single-stranded DNA molecule shown as sequence 29 in a sequence table;
(f10) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 29 and has the same function as the sequence 29;
the primer V-LB can be (f 11) or (f 12);
(f11) A single-stranded DNA molecule shown as a sequence 30 in a sequence table;
(f12) A DNA molecule which is obtained by substituting and/or deleting and/or adding one or more nucleotides in the sequence 30 and has the same function as the sequence 30.
In the primer group I, the molar ratio of the primers I-F3, the primers I-B3, the primers I-FIP, the primers I-BIP, the primers I-LF and the primers I-LB can be specifically 0.5:0.5:2:2:1:1.
in the primer group II, the molar ratio of the primer II-F3, the primer II-B3, the primer II-FIP, the primer II-BIP, the primer II-LF and the primer II-LB is specifically 0.5:0.5:2:2:1:1.
in the primer group III, the molar ratio of the primer III-F3, the primer III-B3, the primer III-FIP, the primer III-BIP, the primer III-LF and the primer III-LB can be specifically 0.5:0.5:2:2:1:1.
in the primer group IV, the molar ratio of the primer IV-F3, the primer IV-B3, the primer IV-FIP, the primer IV-BIP, the primer IV-LF and the primer IV-LB can be specifically 0.5:0.5:2:2:1:1.
in the primer group V, the molar ratio of the primers V-F3, V-B3, V-FIP, V-BIP, V-LF and V-LB is specifically 0.5:0.5:2:2:1:1.
the invention also protects the application of the primer combination in the preparation of the kit; the use of the kit can be (h 1) or (h 2) as follows:
(h1) Identifying staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes;
(h2) The kit is used for detecting whether a sample to be detected contains staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes.
The invention also protects a kit containing the primer combination; the use of the kit can be (h 1) or (h 2) as follows:
(h1) Identifying staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes;
(h2) The kit is used for detecting whether a sample to be detected contains staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes.
The invention also provides a preparation method of the kit, which comprises the step of packaging each primer independently.
The invention also provides a method for detecting whether the bacteria to be detected are staphylococcus epidermidis, staphylococcus aureus, enterococcus faecalis, enterococcus faecium or streptococcus pyogenes, which comprises the following steps:
(1) Extracting genome DNA of bacteria to be detected;
(2) Taking the genomic DNA extracted in the step (1) as a template, respectively adopting each primer group in the primer combination to perform loop-mediated isothermal amplification, and then judging as follows:
if the primer group I is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as staphylococcus epidermidis;
if the primer group II is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as staphylococcus aureus;
if the primer group III is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as enterococcus faecalis;
if the primer group IV is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as enterococcus faecium;
if the primer group V is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as streptococcus pyogenes.
The invention also provides a method for detecting whether a sample to be detected contains staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes, which comprises the following steps:
(1) Extracting the total DNA of a sample to be detected;
(2) Taking the total DNA extracted in the step (1) as a template, respectively adopting each primer group in the primer combination to perform loop-mediated isothermal amplification, and then judging as follows:
if the primer group I is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain staphylococcus epidermidis;
if the primer group II is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain staphylococcus aureus;
if the primer group III is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain enterococcus faecalis;
if the primer group IV is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain enterococcus faecium;
if the primer group V is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain streptococcus pyogenes.
In any of the above methods, the loop-mediated isothermal amplification reaction system (10 μ L) may be: 1 μ L of 10 × ThermoPol Buffer, 1.6 μ L of betaine at 5M concentration, 0.1 μ L of BSA in water at 50mg/mL concentration, 0.4 μ L of MgSO 100mM concentration 4 Aqueous solution, 0.3. Mu.L of 20 × EvaGreen, 0.15. Mu.L of dNTPs (each) at a concentration of 100mM, 0.4. Mu.L of Bst DNA polymerase at a concentration of 8U/mLFragment, template (about 50pg-50 ng), 1. Mu.L primer mix, water supplemented to 10. Mu.L. The primer mixture is a mixture of each primer in the primer group. The 10 XThermoPol Buffer may in particular be a product of Thermo company. 20 × EvaGreen may be specifically a product of mixebome bio.
In any of the above methods, when the primer set I is used, the molar concentrations of the primers I-F3, I-B3, I-FIP, I-BIP, I-LF and I-LB in the loop-mediated isothermal amplification reaction system are 0.5. Mu.M, 2. Mu.M, 1. Mu.M and 1. Mu.M, respectively.
In any of the above methods, when the primer set II is used, the molar concentrations of the primer II-F3, the primer II-B3, the primer II-FIP, the primer II-BIP, the primer II-LF and the primer II-LB in the reaction system of the loop-mediated isothermal amplification are 0.5. Mu.M, 2. Mu.M, 1. Mu.M and 1. Mu.M, respectively.
In any of the above methods, when the primer set III is used, the molar concentrations of the primer III-F3, the primer III-B3, the primer III-FIP, the primer III-BIP, the primer III-LF and the primer III-LB in the reaction system of the LAMP are 0.5. Mu.M, 2. Mu.M, 1. Mu.M and 1. Mu.M, respectively.
In any of the above methods, when the primer set IV is used, the molar concentrations of the primer IV-F3, the primer IV-B3, the primer IV-FIP, the primer IV-BIP, the primer IV-LF and the primer IV-LB in the reaction system of the loop-mediated isothermal amplification are 0.5. Mu.M, 2. Mu.M, 1. Mu.M and 1. Mu.M in sequence.
In any of the above methods, when the primer set V is used, the molar concentrations of the primer V-F3, the primer V-B3, the primer V-FIP, the primer V-BIP, the primer V-LF and the primer V-LB in the reaction system of the LAMP are 0.5. Mu.M, 2. Mu.M, 1. Mu.M and 1. Mu.M, respectively.
In any of the above methods, the loop-mediated isothermal amplification reaction conditions are: keeping the temperature at 65 ℃ for 50min.
The invention also protects the application of the primer combination in detecting whether the bacteria to be detected are staphylococcus epidermidis, staphylococcus aureus, enterococcus faecalis, enterococcus faecium or streptococcus pyogenes.
The invention also protects the application of the primer combination in detecting whether a sample to be detected contains staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes.
Any of the above test samples may be an ocular aspirate sample (i.e., ocular fluid).
Any of the aforementioned Staphylococcus epidermidis can be specifically described in the following documents: zhang Zhiming, li Jianping, zhu Jianwei. Application of 16S rRNA in detection of bloodstream infection caused by Klebsiella pneumoniae [ J ]. Chinesis, 2011, 11 (3): 272-273. Any of the aforementioned Staphylococcus aureus bacteria can be specifically described in the following documents: wu Wei, he Meifeng, tang Xilan, et al. Analysis of distribution of pathogenic bacteria and drug resistance in Ocular bacterial infections [ J ]. Pharmaceutical journal of Chinese Hospital, 2010, 30 (20): 1786-1788. Any of the enterococcus faecalis and any of the enterococcus faecium may be specifically described in the following documents: sun Yanmei, ju Xiaogong, spiroazan, et al clinical characteristics and resistance comparative analysis of enterococcus faecalis and enterococcus faecium infections [ J ] modern preventive medicine, 2014, 41 (1): 125-127. Any of the above-mentioned streptococcus pyogenes may be specifically described in the following documents: liang Yunmei, yang Yonghong, yu Sangjie, et al 2011 to 2013, beijing, respectively, hai lake district sheep workshop community children pharynx tonsillitis streptococcus pyogenes molecular biology characteristics [ J ]. China practical pediatric clinical journal, 2014, 29 (16): 1220-1223.
Loop-mediated isothermal amplification (LAMP) is a sensitive, specific, simple and fast nucleic acid amplification technology developed in recent years, and the principle is that under the action of DNA polymerase with strand displacement activity, 4-6 primers of 6-8 regions are identified, target genes are rapidly and specifically amplified under isothermal conditions, and the LAMP can be popularized and applied to rapid and accurate detection of 5 common gram-positive bacteria in intraocular fluid. The LAMP method has the advantages of high sensitivity, good specificity, short reaction time, convenient judgment result, no need of expensive instruments and the like.
The primer combination provided by the invention is used for detecting 5 kinds of common gram-positive bacteria in intraocular fluid, has high specificity and high sensitivity, and can realize simple, convenient, rapid and accurate detection. The invention has great popularization value.
Drawings
FIG. 1 shows the results of the measurement in example 2.
FIG. 2 shows the results of the test in example 4.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.
10 XThermoPol Buffer is a product of Thermo company. 20 × EvaGreen is a product of mixebome bio.
Staphylococcus epidermidis is described in the following examples and in the following documents: zhang Zhiming, li Jianping, zhu Jianwei. Application of 16S rRNA in detection of bloodstream infection caused by Klebsiella pneumoniae [ J ]. Chinesis, 2011, 11 (3): 272-273.
The staphylococcus aureus bacteria in the following examples are described in the following documents: wu Wei, he Meifeng, tang Xilan, et al. Analysis of distribution of pathogenic bacteria and drug resistance in Ocular bacterial infections [ J ]. Pharmaceutical journal of Chinese Hospital, 2010, 30 (20): 1786-1788.
Enterococcus faecalis and enterococcus faecium in the following examples are described in the following documents: sun Yanmei, ju Xiaogong, spiroazan, et al clinical characteristics and resistance comparative analysis of enterococcus faecalis and enterococcus faecium infections [ J ] modern preventive medicine, 2014, 41 (1): 125-127.
The streptococcus pyogenes in the following examples are described in the following documents: liang Yunmei, yang Yonghong, yu Sangjie, et al, molecular biology characteristics of Streptococcus pyogenes in Yantonsillis in Yan shop communities of Yan Fang district, beijing City, 2011 to 2013 [ J ]. Chinese Utility pediatrics journal, 2014, 29 (16): 1220-1223.
Example 1 preparation of kit
The kit consists of five LAMP primer groups, and each primer group is used for detecting 1 gram-positive bacterium in intraocular fluid.
The primer set for detection of staphylococcus epidermidis was as follows (5 '→ 3'):
outer primer F3 (sequence 1): ATTgAgATAgCgggggA;
outer primer B3 (sequence 2): ACAACAAAgTAACAgTACCATg;
inner primer FIP (sequence 3): gCgTCATgCCTTTATTTgAAgAAAATgTACAgTCATAgCTAgTggA;
inner primer BIP (sequence 4): ACAggAgTAAATTCAgTgATTgCAATTCCgCAACTTACAAAACATg;
loop primer LF (sequence 5): TTATATgTATgTgCCCAAATCACA;
loop primer LB (SEQ ID NO: 6): CCAATTgATTggAAAggATTTgATC.
The primer set for detection of staphylococcus aureus was as follows (5 '→ 3'):
outer primer F3 (sequence 7): gCAACTgAAACAACAgAAgC;
outer primer B3 (seq id No. 8): TTTTgTgTTgggCgAgC;
inner primer FIP (sequence 9): TCACggATACCTgTACCAgCATCTCTATggTCCgAgACCgCAATT;
inner primer BIP (sequence 10): ggAACATTTggATATgAAgCgAgACTgCCATCTTgATTTgTCgTTAC; loop primer LF (SEQ ID NO: 11): TTTCACATACTTAggTgTTTTgT;
loop primer LB (sequence 12): CCAAgTgAAACAAATgCATACAAC.
Primer sets for detection of enterococcus faecalis were as follows (5 '→ 3'):
outer primer F3 (sequence 13): TTATCGAGGCTTCCAAGAA;
outer primer B3 (sequence 14): TCGTATTCGCACGCTCA;
inner primer FIP (sequence 15): AGCTTGAAAACTACGACTATCGCTACGCAATCGTCCAATCGG;
inner primer BIP (sequence 16): ATTACGCAACAGTTGATTGCCAAATCATTTTAAGCATTTCCGCG;
loop primer LF (sequence 17): TTTCTGTGCTCTCGCTCTG;
loop primer LB (SEQ ID NO: 18): CAACAAATGGATGAAGCCAAAG.
The primer set for detecting enterococcus faecium was as follows (5 '→ 3'):
outer primer F3 (sequence 19): AGTCGTAAAAGACGTAGCA;
outer primer B3 (sequence 20): TCCCATAAGAGTGGGTACA;
inner primer FIP (seq id No. 21): TCGCGTACTCTTGCGCTTATGCAGATTCCAGCCGA;
inner primer BIP (sequence 22): GGTGGAAGCGGATTGAGCCGGGCATAGAGTTTAATTCATTCAGG;
loop primer LF (sequence 23): GATAAACTTCTTCTGGCACT;
loop primer LB (sequence 24): GTGCGATTTCTTTTTGACAA.
Primer sets for detection of streptococcus pyogenes were as follows (5 '→ 3'):
outer primer F3 (sequence 25): gTTgTTAATgCTTTATCAACACA;
outer primer B3 (SEQ ID NO: 26): gCgCTTATCTgTAATggAAAT;
inner primer FIP (sequence 27): CAgTggTTCCAATgACCTCAAgATTCATTACCAAgAATTTAAACgCg;
inner primer BIP (sequence 28): ACACCCgATCCAgAAATTTTTACCAAAggCTAACTCTTgAATACgT;
loop primer LF (sequence 29): TCTgCTACAACAgCCC;
loop primer LB (sequence 30): AAACgACTCAgTTTgATTACAgT.
The primer group for detecting staphylococcus epidermidis is named as a primer group I. The primer set used for detecting staphylococcus aureus was designated as primer set ii. The primer set for detecting enterococcus faecalis was named primer set III. The primer set for detecting enterococcus faecium was named as primer set IV. The primer set for detecting Streptococcus pyogenes was designated as primer set V.
Example 2 specificity
1, sample to be tested: staphylococcus epidermidis.
Sample to be tested 2: staphylococcus aureus.
And 3, a sample to be detected: enterococcus faecalis.
And 4, sample to be detected: enterococcus faecium.
And 5, a sample to be detected: streptococcus pyogenes.
Each sample to be detected is respectively subjected to the following steps:
1. and extracting the genome DNA of the sample to be detected.
2. The genomic DNA extracted in step 1 was used as a template for loop-mediated isothermal amplification using each of the primer sets prepared in example 1.
Reaction system (10 μ L): 1 μ L of 10 × ThermoPol Buffer, 1.6 μ L of betaine at 5M concentration, 0.1 μ L of BSA in water at 50mg/mL concentration, 0.4 μ L of MgSO 100mM concentration 4 Aqueous solution, 0.3. Mu.L of 20 × EvaGreen, 0.15. Mu.L of dNTPs (each) at a concentration of 100mM, 0.4. Mu.L of Bst DNA polymerase large fragment at a concentration of 8U/mL, genomic DNA of the sample to be tested (between 50pg and 50 ng), 1. Mu.L of primer mix, supplemented with water to 10. Mu.L. The primer mixture is a mixture of each primer in the primer group. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 are both 0.5. Mu.M, the final concentrations of the inner primer FIP and the inner primer BIP are both 2. Mu.M, and the final concentrations of the loop primer LF and the loop primer LB are both 1. Mu.M.
Reaction conditions are as follows: keeping the temperature at 65 ℃ for 50min.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals. And drawing an amplification curve by taking the cycle number as an abscissa and the fluorescence signal intensity as an ordinate.
According to the method, the genomic DNA of the sample to be tested is replaced by sterilized ultrapure water, and other steps are not changed to be used as a negative control.
The results using primer set I are shown in FIG. 1A. The positive amplification curve is shown only when the sample to be tested is staphylococcus epidermidis (namely, the amplification curve is an S-shaped amplification curve). And when the sample to be detected is the sample to be detected 2, 3, 4 or 5, the positive amplification curve is not displayed.
The results using primer set II are shown in FIG. 1B. The positive amplification curve is shown only when the sample to be tested is staphylococcus aureus (namely, the amplification curve is an S-shaped amplification curve). And when the sample to be detected is the sample to be detected 1, 3, 4 or 5, a positive amplification curve is not displayed.
The results using primer set III are shown in FIG. 1C. The positive amplification curve is shown only when the sample to be tested is enterococcus faecalis (i.e. the amplification curve is an "S-shaped" amplification curve). And when the sample to be detected is the sample 1, 2, 4 or 5 to be detected, the positive amplification curve is not displayed.
The results using primer set IV are shown in FIG. 1D. The positive amplification curve is shown only when the sample to be tested is enterococcus faecium (i.e. the amplification curve is an S-shaped amplification curve). And when the sample to be detected is the sample 1, 2, 3 or 5 to be detected, the positive amplification curve is not displayed.
The results using primer set V are shown in FIG. 1E. A positive amplification curve is shown only when the sample to be tested is Streptococcus pyogenes (i.e., the amplification curve is an "S-type" amplification curve). And when the sample to be detected is the sample 1, 2, 3 or 4 to be detected, the positive amplification curve is not displayed.
The results show that the five primer groups provided by the invention have high specificity to the target bacteria respectively.
Example 3 sensitivity
1, sample to be tested: staphylococcus epidermidis.
And 2, sample to be tested: staphylococcus aureus.
Sample to be tested 3: enterococcus faecalis.
And 4, sample to be detected: enterococcus faecium.
And 5, a sample to be detected: streptococcus pyogenes.
Each sample to be detected is respectively subjected to the following steps:
1. extracting the genome DNA of a sample to be detected, and performing gradient dilution by using sterile water to obtain each diluent.
2. The dilutions obtained in step 1 were used as templates for loop-mediated isothermal amplification using the primer sets prepared in example 1, respectively.
And when the sample to be detected is the sample 1 to be detected, performing loop-mediated isothermal amplification by using the primer group I. And when the sample to be detected is the sample 2 to be detected, performing loop-mediated isothermal amplification by using the primer group II. And when the sample to be detected is the sample 3 to be detected, performing loop-mediated isothermal amplification by using the primer group III. And when the sample to be detected is the sample 4 to be detected, performing loop-mediated isothermal amplification by using the primer group IV. And when the sample to be detected is the sample 5 to be detected, performing loop-mediated isothermal amplification by using the primer group V.
Reaction system (10 μ L): 1 μ L of 10 × ThermoPol Buffer, 1.6 μ L of betaine at 5M concentration, 0.1 μ L of BSA in water at 50mg/mL concentration, 0.4 μ L of MgSO 100mM concentration 4 Aqueous solution, 0.3. Mu.L of 20 × EvaGreen, 0.15. Mu.L of dNTPs (each) at a concentration of 100mM, 0.4. Mu.L of Bst DNA polymerase large fragment at a concentration of 8U/mL, and 1. Mu.L of diluent (1. Mu.L of diluent containing 10 copies of genome) 4 1, 10 3 5 x 10 pieces of 2 Or 10 2 One), 1 μ L primer mix, water to 10 μ L. The primer mixture is a mixture of each primer in the primer group. In the reaction system, the final concentrations of the outer primer F3 and the outer primer B3 are both 0.5. Mu.M, the final concentrations of the inner primer FIP and the inner primer BIP are both 2. Mu.M, and the final concentrations of the loop primer LF and the loop primer LB are both 1. Mu.M.
Reaction conditions are as follows: keeping the temperature at 65 ℃ for 50min.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals. And drawing an amplification curve by taking the cycle number as an abscissa and the fluorescence signal intensity as an ordinate.
If a positive amplification curve appears within 50min (i.e., the amplification curve is an "S-type" amplification curve), it indicates that the corresponding genome content in the reaction system can be detected. If no positive amplification curve appears within 50min, the corresponding genome content in the reaction system cannot be detected.
The sensitivity of the primer group I for detecting the target bacteria is 5 multiplied by 10 2 The sensitivity of primer group II for detecting target bacteria is 5 multiplied by 10 2 The sensitivity of primer group III for detecting target bacteria is 5 multiplied by 10 2 The sensitivity of a primer group IV for detecting target bacteria is 5 multiplied by 10 2 The sensitivity of the primer group V for detecting the target bacteria is 5 multiplied by 10 2 Number of copies/reaction system.
Example 4 application
The sample to be detected is sample one, sample two, sample three, sample four, sample five or sample six:
a first sample: an ocular aspirate sample clinically identified as staphylococcus epidermidis positive (abbreviated as staphylococcus epidermidis positive sample).
Sample two: an eye aspirate sample clinically identified as staphylococcus aureus positive (abbreviated as staphylococcus aureus positive sample).
Sample three: an ocular aspirate sample clinically identified as enterococcus faecalis positive (abbreviated as enterococcus faecalis positive sample).
Sample four: an eye aspirate sample clinically identified as enterococcus faecium positive (e.g., an enterococcus faecium positive sample).
Sample five: an eye aspirate sample clinically identified as positive for streptococcus pyogenes (shortly referred to as streptococcus pyogenes positive sample).
Sample six: the eye aspirate samples of healthy subjects (referred to as healthy subject samples for short) were clinically identified for the absence of staphylococcus epidermidis, staphylococcus aureus, enterococcus faecalis, enterococcus faecium, and streptococcus pyogenes.
1. And extracting the total DNA of the sample to be detected.
2. Using the total DNA extracted in step 1 as a template, the primer sets prepared in example 1 were used to perform loop-mediated isothermal amplification.
The reaction system and reaction conditions were the same as in example 2.
In the reaction process, a fluorescence PCR instrument is adopted to detect fluorescence signals. And drawing an amplification curve by taking the cycle number as an abscissa and the fluorescence signal intensity as an ordinate.
According to the method, the total DNA of the sample to be detected is replaced by sterilized ultrapure water, and other steps are not changed to be used as negative control.
When a sample is detected, the total DNA of the sample to be detected is replaced by the genome DNA of the staphylococcus epidermidis according to the method, and other steps are not changed and are used as a positive control.
And when the second sample is detected, replacing the total DNA of the sample to be detected with the genome DNA of the staphylococcus aureus according to the method, and taking the total DNA of the sample to be detected as a positive control without changing other steps.
When the third sample is detected, the total DNA of the sample to be detected is replaced by the genomic DNA of the enterococcus faecalis according to the method, and other steps are not changed and are used as positive control.
When the sample four is detected, the total DNA of the sample to be detected is replaced by the genome DNA of the enterococcus faecium according to the method, and other steps are not changed and are used as positive control.
When the fifth sample is detected, the total DNA of the sample to be detected is replaced by the genome DNA of the streptococcus pyogenes according to the method, and other steps are not changed and are used as positive control.
The results using primer set I are shown in FIG. 2A. The positive amplification curve is shown only when the sample to be tested is sample one (i.e. the amplification curve is an "S-shaped" amplification curve). And when the samples to be detected are the second, third, fourth, fifth and sixth samples to be detected, positive amplification curves are not displayed.
The results using primer set II are shown in FIG. 2B. And (3) displaying a positive amplification curve only when the sample to be detected is the second sample (namely, the amplification curve is an S-shaped amplification curve). And when the samples to be detected are the first sample, the third sample, the fourth sample, the fifth sample and the sixth sample, a positive amplification curve is not displayed.
The results using primer set III are shown in FIG. 2C. And (3) displaying a positive amplification curve only when the sample to be detected is the third sample (namely, the amplification curve is an S-shaped amplification curve). And when the sample to be detected is a first sample, a second sample, a fourth sample, a fifth sample and a sixth sample, the positive amplification curve is not displayed.
The results using primer set IV are shown in FIG. 2D. The positive amplification curve is shown only when the sample to be tested is sample four (i.e. the amplification curve is an "S-shaped" amplification curve). And when the sample to be detected is a first sample, a second sample, a third sample, a fifth sample and a sixth sample, the positive amplification curve is not displayed.
The results using primer set V are shown in FIG. 2E. A positive amplification curve is shown only when the sample to be tested is sample five (i.e., the amplification curve is an "S-shaped" amplification curve). And when the sample to be detected is a first sample, a second sample, a third sample, a fourth sample and a sixth sample, the positive amplification curve is not displayed.
The results show that the primer combination provided by the invention is used for detecting 5 gram-positive bacteria in intraocular fluid, and the results are accurate and reliable.
<110> Beijing Zhi De Zhen and medical laboratory Co Ltd
<120> LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application
<160> 30
<170> PatentIn version 3.5
<210> 1
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 1
attgagatag cggggga 17
<210> 2
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 2
acaacaaagt aacagtacca tg 22
<210> 3
<211> 46
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 3
gcgtcatgcc tttatttgaa gaaaatgtac agtcatagct agtgga 46
<210> 4
<211> 46
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 4
acaggagtaa attcagtgat tgcaattccg caacttacaa aacatg 46
<210> 5
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 5
ttatatgtat gtgcccaaat caca 24
<210> 6
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 6
ccaattgatt ggaaaggatt tgatc 25
<210> 7
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 7
<210> 8
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 8
ttttgtgttg ggcgagc 17
<210> 9
<211> 45
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 9
tcacggatac ctgtaccagc atctctatgg tccgagaccg caatt 45
<210> 10
<211> 47
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 10
ggaacatttg gatatgaagc gagactgcca tcttgatttg tcgttac 47
<210> 11
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 11
tttcacatac ttaggtgttt tgt 23
<210> 12
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 12
ccaagtgaaa caaatgcata caac 24
<210> 13
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 13
ttatcgaggc ttccaagaa 19
<210> 14
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 14
tcgtattcgc acgctca 17
<210> 15
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 15
agcttgaaaa ctacgactat cgctacgcaa tcgtccaatc gg 42
<210> 16
<211> 44
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 16
attacgcaac agttgattgc caaatcattt taagcatttc cgcg 44
<210> 17
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 17
tttctgtgct ctcgctctg 19
<210> 18
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 18
caacaaatgg atgaagccaa ag 22
<210> 19
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 19
agtcgtaaaa gacgtagca 19
<210> 20
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 20
tcccataaga gtgggtaca 19
<210> 21
<211> 35
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 21
tcgcgtactc ttgcgcttat gcagattcca gccga 35
<210> 22
<211> 44
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 22
ggtggaagcg gattgagccg ggcatagagt ttaattcatt cagg 44
<210> 23
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 23
gataaacttc ttctggcact 20
<210> 24
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 24
gtgcgatttc tttttgacaa 20
<210> 25
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 25
gttgttaatg ctttatcaac aca 23
<210> 26
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 26
gcgcttatct gtaatggaaa t 21
<210> 27
<211> 47
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 27
cagtggttcc aatgacctca agattcatta ccaagaattt aaacgcg 47
<210> 28
<211> 46
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 28
acacccgatc cagaaatttt taccaaaggc taactcttga atacgt 46
<210> 29
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 29
<210> 30
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 30
aaacgactca gtttgattac agt 23
Claims (8)
1. The primer combination comprises a primer group I, a primer group II, a primer group III, a primer group IV and a primer group V;
the primer group I consists of a primer I-F3, a primer I-B3, a primer I-FIP, a primer I-BIP, a primer I-LF and a primer I-LB; the primers I-F3 are single-stranded DNA molecules shown in a sequence 1 in a sequence table; the primers I-B3 are single-stranded DNA molecules shown in a sequence 2 in a sequence table; the primer I-FIP is a single-stranded DNA molecule shown in a sequence 3 in a sequence table; the primer I-BIP is a single-stranded DNA molecule shown in a sequence 4 of a sequence table; the primers I-LF are single-stranded DNA molecules shown in a sequence 5 of a sequence table; the primers I-LB are single-stranded DNA molecules shown in sequence 6 of a sequence table;
the primer group II consists of a primer II-F3, a primer II-B3, a primer II-FIP, a primer II-BIP, a primer II-LF and a primer II-LB; the primers II-F3 are single-stranded DNA molecules shown in a sequence 7 of a sequence table; the primer II-B3 is a single-stranded DNA molecule shown in a sequence 8 of a sequence table; the primer II-FIP is a single-stranded DNA molecule shown in a sequence 9 of a sequence table; the primer II-BIP is a single-stranded DNA molecule shown in a sequence 10 of a sequence table; the primer II-LF is a single-stranded DNA molecule shown in a sequence 11 of a sequence table; the primer II-LB is a single-stranded DNA molecule shown in a sequence 12 in a sequence table;
the primer group III consists of a primer III-F3, a primer III-B3, a primer III-FIP, a primer III-BIP, a primer III-LF and a primer III-LB; the primer III-F3 is a single-stranded DNA molecule shown in a sequence 13 of a sequence table; the primer III-B3 is a single-stranded DNA molecule shown in a sequence 14 of a sequence table; the primer III-FIP is a single-stranded DNA molecule shown in a sequence 15 of a sequence table; the primer III-BIP is a single-stranded DNA molecule shown in a sequence 16 of a sequence table; the primer III-LF is a single-stranded DNA molecule shown in a sequence 17 of a sequence table; the primer III-LB is a single-stranded DNA molecule shown in a sequence 18 of a sequence table;
the primer group IV consists of a primer IV-F3, a primer IV-B3, a primer IV-FIP, a primer IV-BIP, a primer IV-LF and a primer IV-LB; the primer IV-F3 is a single-stranded DNA molecule shown in a sequence 19 of a sequence table; the primer IV-B3 is a single-stranded DNA molecule shown in a sequence 20 of a sequence table; the primer IV-FIP is a single-stranded DNA molecule shown in a sequence 21 in a sequence table; the primer IV-BIP is a single-stranded DNA molecule shown in a sequence 22 of a sequence table; the primer IV-LF is a single-stranded DNA molecule shown in a sequence 23 of a sequence table; the primer IV-LB is a single-stranded DNA molecule shown in a sequence 24 of a sequence table;
the primer group V consists of a primer V-F3, a primer V-B3, a primer V-FIP, a primer V-BIP, a primer V-LF and a primer V-LB; the primer V-F3 is a single-stranded DNA molecule shown in a sequence 25 in a sequence table; the primer V-B3 is a single-stranded DNA molecule shown in a sequence 26 in a sequence table; the primer V-FIP is a single-stranded DNA molecule shown in a sequence 27 in a sequence table; the primer V-BIP is a single-stranded DNA molecule shown in a sequence 28 of a sequence table; the primer V-LF is a single-stranded DNA molecule shown in a sequence 29 in a sequence table; the primer V-LB is a single-stranded DNA molecule shown in a sequence 30 of a sequence table.
2. Use of a primer combination according to claim 1 in the preparation of a kit; the application of the kit is (h 1) or (h 2):
(h1) Identifying staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes;
(h2) The kit is used for detecting whether a sample to be detected contains staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes.
3. A kit comprising the primer combination of claim 1; the application of the kit is (h 1) or (h 2):
(h1) Identifying staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes;
(h2) The kit is used for detecting whether a sample to be detected contains staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes.
4. A method for preparing the kit according to claim 3, comprising the step of packaging each primer individually.
5. A method for detecting whether a bacterium to be detected is staphylococcus epidermidis, staphylococcus aureus, enterococcus faecalis, enterococcus faecium or streptococcus pyogenes comprises the following steps:
(1) Extracting the genome DNA of the bacteria to be detected;
(2) Taking the genomic DNA extracted in the step (1) as a template, respectively adopting each primer group in the primer combination of claim 1 to perform loop-mediated isothermal amplification, and then judging as follows:
if the primer group I is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as staphylococcus epidermidis;
if the primer group II is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as staphylococcus aureus;
if the primer group III is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as enterococcus faecalis;
if the primer group IV is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as enterococcus faecium;
if the primer group V is adopted, the specific amplification with the genome DNA as a template can be realized, and the bacteria to be detected is or is selected as streptococcus pyogenes;
the methods are useful for the diagnosis and treatment of non-diseases.
6. A method for detecting whether a sample to be detected contains staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes, comprising the following steps:
(1) Extracting the total DNA of a sample to be detected;
(2) Taking the total DNA extracted in the step (1) as a template, respectively adopting each primer group in the primer combination of claim 1 to perform loop-mediated isothermal amplification, and then judging as follows:
if the primer group I is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain staphylococcus epidermidis;
if the primer group II is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain staphylococcus aureus;
if the primer group III is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain enterococcus faecalis;
if the primer group IV is adopted, the specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain enterococcus faecium;
if the primer group V is adopted, specific amplification with the total DNA as a template can be realized, and a sample to be detected contains or is suspected to contain streptococcus pyogenes;
the method is useful for diagnosis and treatment of non-diseases.
7. The use of the primer combination of claim 1 for detecting whether the test bacterium is staphylococcus epidermidis, staphylococcus aureus, enterococcus faecalis, enterococcus faecium or streptococcus pyogenes;
the use is for the diagnosis and treatment of non-diseases.
8. Use of the primer combination according to claim 1 for detecting the presence of staphylococcus epidermidis and/or staphylococcus aureus and/or enterococcus faecalis and/or enterococcus faecium and/or streptococcus pyogenes in a test sample;
the use is for the diagnosis and treatment of non-diseases.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810113531.XA CN110129459B (en) | 2018-02-05 | 2018-02-05 | LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810113531.XA CN110129459B (en) | 2018-02-05 | 2018-02-05 | LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110129459A CN110129459A (en) | 2019-08-16 |
| CN110129459B true CN110129459B (en) | 2023-02-24 |
Family
ID=67567419
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810113531.XA Active CN110129459B (en) | 2018-02-05 | 2018-02-05 | LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110129459B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109402277A (en) * | 2018-12-13 | 2019-03-01 | 博奥生物集团有限公司 | For quickly detecting the LAMP primer composition and application of enterococcus faecalis and enterococcus faecium |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1248295A (en) * | 1996-11-04 | 2000-03-22 | 感染诊断(I.D.I)公司 | Species-specific genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes |
| CN106367413A (en) * | 2016-09-05 | 2017-02-01 | 博奥生物集团有限公司 | Nucleic acid amplification method and application |
| CN107541509A (en) * | 2016-06-29 | 2018-01-05 | 博奥生物集团有限公司 | For detecting the LAMP primer composition and its application of 6 kinds of infectious agents of mastitis for milk cows |
-
2018
- 2018-02-05 CN CN201810113531.XA patent/CN110129459B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1248295A (en) * | 1996-11-04 | 2000-03-22 | 感染诊断(I.D.I)公司 | Species-specific genus-specific and universal DNA probes and amplification primers to rapidly detect and identify common bacterial and fungal pathogens and associated antibiotic resistance genes |
| CN107541509A (en) * | 2016-06-29 | 2018-01-05 | 博奥生物集团有限公司 | For detecting the LAMP primer composition and its application of 6 kinds of infectious agents of mastitis for milk cows |
| CN106367413A (en) * | 2016-09-05 | 2017-02-01 | 博奥生物集团有限公司 | Nucleic acid amplification method and application |
Non-Patent Citations (4)
| Title |
|---|
| A loop-mediated isothermal amplification (LAMP) assay for the rapid detection of Enterococcus spp. in water;Roland Martzy等;《Water Research》;20170513;第122卷;62-69页 * |
| 奶牛乳房炎致病菌的分离鉴定及耐药性研究;李新圃 等;《动物医学进展》;20151130;第36卷(第11期);36-39页 * |
| 眼内炎的病因及其预防;Fred M Wilson Ⅱ;《国外医学眼科学分册》;19880430(第2期);107-111页 * |
| 细菌性眼内炎31例;梁莉 等;《武警医学》;20150731;第26卷(第7期);722-724页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110129459A (en) | 2019-08-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20180135108A1 (en) | Method for detecting bacterial and fungal pathogens | |
| Tomaso et al. | Comparison of commercial DNA preparation kits for the detection of Brucellae in tissue using quantitative real-time PCR | |
| Kommedal et al. | Direct 16S rRNA gene sequencing from clinical specimens, with special focus on polybacterial samples and interpretation of mixed DNA chromatograms | |
| CN110714090B (en) | Kit for detecting free nucleic acid of blood flow infection pathogen in blood plasma | |
| JP6704565B2 (en) | How to detect mycoplasma | |
| KR102068136B1 (en) | Methods for measuring enzyme activity useful in determining cell viability in non-purified samples | |
| CN113512602B (en) | Blood stream infection pathogen multiple gene detection system and kit and application thereof | |
| He et al. | Real-time PCR for the rapid detection of vanA, vanB and vanM genes | |
| CN101144775B (en) | Bacteria real-time fluorescence quantitative polymerase chain reaction detection reagent kit | |
| Dalla-Costa et al. | Comparison of DNA extraction methods used to detect bacterial and yeast DNA from spiked whole blood by real-time PCR | |
| Deutschmann et al. | Validation of a NAT-based Mycoplasma assay according European Pharmacopoiea | |
| Brukner et al. | Assay for estimating total bacterial load: relative qPCR normalisation of bacterial load with associated clinical implications | |
| CN107541509B (en) | LAMP primer combination for detecting 6 infectious pathogens of cow mastitis and application thereof | |
| CN110669851A (en) | Primer and/or probe composition for detecting cocci causing bloodstream infections and use thereof | |
| Cherkaoui et al. | Development and validation of a modified broad-range 16S rDNA PCR for diagnostic purposes in clinical microbiology | |
| WO2015103710A1 (en) | Methods, reagents and kits for the assessment of bacterial infection | |
| CN110129459B (en) | LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application | |
| Ragheb et al. | The application of uniplex, duplex, and multiplex PCR for the absence of specified microorganism testing of pharmaceutical excipients and drug products | |
| CN110656188A (en) | Primer and/or probe composition for detecting bacillus causing bloodstream infection and application thereof | |
| US20100311040A1 (en) | Dna Fragments, Primers, Kits, and Methods for Amplification the Detection and Identification of Clinically Relevant Candida Species | |
| EP1808695A1 (en) | A method for detection of staphylococus epidermidis | |
| Eisner et al. | Identification of glycopeptide-resistant enterococci by VITEK 2 system and conventional and real-time polymerase chain reaction | |
| CN110029179B (en) | Nucleotide molecules and application thereof in identification of corynebacterium striatum | |
| CN112063734A (en) | Primer, probe and method for quantitatively detecting brucella in human blood by adopting real-time fluorescent quantitative PCR technology | |
| Ismail et al. | Routine Use of 16S rRNA Gene Sequencing for Diagnosis of Culture-Negative Bacterial Infections in Body Fluids Other than Blood: Benefits in a Limited Resource Hospital |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20191230 Address after: 100020 No. 8 South Road, workers' Stadium, Beijing, Chaoyang District Applicant after: BEIJING CHAO-YANG HOSPITAL, CAPITAL MEDICAL University Address before: The three District 101300 Beijing City Renhe Town, Shunyi District LAN Xiyuan 37 building two layer (innovation function area) Applicant before: BEIJING ZHIDE MEDICAL LABORATORY CO.,LTD. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |