CN110055260A - A kind of rice BURP protein coding gene OsBURP16 and its application - Google Patents
A kind of rice BURP protein coding gene OsBURP16 and its application Download PDFInfo
- Publication number
- CN110055260A CN110055260A CN201910246826.9A CN201910246826A CN110055260A CN 110055260 A CN110055260 A CN 110055260A CN 201910246826 A CN201910246826 A CN 201910246826A CN 110055260 A CN110055260 A CN 110055260A
- Authority
- CN
- China
- Prior art keywords
- rice
- gene
- osburp16
- plant
- banded sclerotial
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of rice BURP protein coding gene OsBURP16 and its applications, and the nucleotide sequence of the gene is as shown in SEQ ID No.1.It after the gene is connect by the present invention by genetic engineering means with over-express vector, converts into rice, improves the expression in the rice plant of the gene in post-conversion, the rice plant can be made to improve the resistance of banded sclerotial blight；In addition it can enhance the disease resistance of other plants with the expression of the DNA homolog gene in the other plants of overexpression.In addition, can be that bait protein fishes out the albumen in rice or other plant with the interactions between protein using the albumen of this OsBURP16 gene coding, regulation and control model of gene during anti-banded sclerotial blight be specified.
Description
Technical field
The invention belongs to gene engineering technology fields, and in particular to a kind of rice BURP protein coding gene OsBURP16 and its
Using.
Background technique
Rice is important cereal crops, and production directly affects the economic development of China its people.Rice sheath blight disease be by
A kind of silborne fungal diseases caused by Rhizoctonia solani Kuhn (RhizoctoniasolaniK ü hn), simultaneously with rice blast and bacterial leaf-blight
Referred to as three major disease of rice can cause 50% underproduction in certain banded sclerotial blight districts occurred frequently, and have the tendency that aggravating year by year, at
For the Major Diseases factor for limiting rice high yield.In recent years, with rice high yield, thick stalk, more evil, big fringe while climate change
The popularizing planting of type germplasm, planting density increases and the excessive application of nitrogenous fertilizer, and so that field is divulged information, poor, humidity is big, is banded sclerotial blight
Bacterium infects host and creates strong environmental condition.
Currently, due to the shortage of anti-banded sclerotial blight Rice Germplasm Resources, host range is wide for pathogen, resistance is strong and heredity
The factors such as variation, to the prevention and treatment of banded sclerotial blight still without the method for more system.In agricultural production, chemical agent pair is mainly used
Rice sheath blight disease carries out prevention and control, but influence of the chemical agent to environment and the problems such as causing pathogenic bacteria resistance to drugs are following.
In global most of paddy fields, 90% or more rice varieties show in various degree susceptible.About the water resistant sheath and culm blight of rice
Although related QTL and gene it has been reported that however generation and plant disease epidemic due to field banded sclerotial blight by such as rice growing way, hat
The influence of the layer multiple factors such as density and field agronomic conditions, and such as inoculation method, disease in terms of the withered Resistance Identification of line
Investigation and grade scale are also unified not to the utmost, cause to regulate and control the major gene resistance of sharp eyespot resistance and QTL not to parse yet clear, anti-line is withered
Sick Advances in Breeding is slow.Therefore, not only there is great theory significance to the research of resisting rice sheath blight related gene, simultaneously
It can promote the excavation of Rice Resistance banded sclerotial blight germ plasm resource and genetic improvement, be finally reached effective prevention and control and agricultural to banded sclerotial blight
Increasing both production and income.
Summary of the invention
The purpose of the present invention is in view of the above shortcomings of the prior art, provide a kind of rice BURP protein coding gene
The application of OsBURP16 and the gene in the water resistant sheath and culm blight of rice provides new method to cultivate anti-banded sclerotial blight rice varieties.
In order to achieve the above object, the technical scheme adopted by the invention is that: a kind of positive regulation resisting rice sheath blight is provided
BURP protein coding gene OsBURP16 gene, the nucleotide sequence of the gene is as shown in SEQ IDNo.1.
Further, after which being connect to recombination with plant over-express vector, conversion to rice sense banded sclerotial blight kind
In Lement, it is found that the expression of the gene in transgenic paddy rice improves, and improve to the resistance of banded sclerotial blight；By the gene with
After the connection recombination of plant interference vector, conversion finds the gene in transgenic paddy rice into the special blueness of Rice Resistance banded sclerotial blight kind
Expression reduces, and reduces to the resistance of banded sclerotial blight.By the gene of overexpression in rice, anti-banded sclerotial blight can be obtained
Rice plant can be used for the breeding of anti-banded sclerotial blight rice varieties.
The present invention also provides a kind of over-express vectors containing said gene, and the agriculture bar containing the over-express vector
Bacteria strain.
Purposes of the invention are as follows:
(1) it after the gene is connect by the present invention by genetic engineering means with over-express vector, converts into rice, improves
Expression in the rice plant of the gene in post-conversion can make the rice plant improve the resistance of banded sclerotial blight；It in addition can be with
Using the expression of its homologous gene in the other plants of the gene overexpression, and enhance the disease resistance of other plants.
(2) it is used for the parsing of Rice Resistance banded sclerotial blight mechanism, the gene order is such as connected to any one and contains fluorescence egg
On the conversion carrier of white gene, with any method for transformation by the gene and the covalent Introduced into Rice of fluorescence protein gene or other
Plant cell is observed that using fluorescence co-focusing transmission electron microscope and is merged in rice or other plant cells with fluorescin
Migration and positioning of the OsBURP16 albumen of expression in plant cell, specify site of action of the gene in cell；May be used also
Albumen using this OsBURP16 gene coding is that bait protein fishes out the albumen in rice or other plant with the interactions between protein,
Specify regulation and control model of gene during anti-banded sclerotial blight.
The beneficial effects of the present invention are: the present invention passes through clone to rice BURP albumen OsBURP16 gene and its anti-line
Blight functional analysis facilitates the molecular mechanism for parsing Rice Resistance banded sclerotial blight.It can be utilized by transgenic approach in practice
The gene cultivates anti-banded sclerotial blight rice material, further passes through interbreed, the stable anti-banded sclerotial blight rice product of acquired character
Kind, the generation of banded sclerotial blight is effectively controlled, rice yield is improved.
Detailed description of the invention
Fig. 1 is transcript profile table of the OsBURP16 gene in the different time points that sheath blight fungus infects in anti-sense rice varieties
Expression patterns；
Fig. 2 is qRT-PCR of the OsBURP16 gene in the different time points that sheath blight fungus infects in anti-sense rice varieties
Verify expression pattern；
Fig. 3 is OsBURP16 gene in the expression being overexpressed in plant；
Fig. 4 is expression of the OsBURP16 gene in interference plant；
Fig. 5 is rice sense banded sclerotial blight material Lment and is overexpressed OsBURP16 base as background to feel banded sclerotial blight material Lment
Because of symptom when plant is inoculated with sheath blight fungus 96h；
Fig. 6 is that anti-banded sclerotial blight material is special green and expression OsBURP16 gene is planted by background interference of anti-banded sclerotial blight material spy blueness
Symptom when strain inoculation sheath blight fungus 96h.
Specific embodiment
Below with reference to embodiment, specific embodiments of the present invention will be described in detail.
Embodiment one: the clone of rice Os BURP16 gene cDNA and its sequence analysis
The special green seed of rice after vernalization 1 day, is seeded in greenhouse in 37 DEG C, tri-leaf period rice leaf is taken to extract RNA.It mentions
Take method using Trizol method, specific steps are as follows:
(1) take 50~100mg fresh paddy rice blade, be put into preprepared mortar (DEPC water impregnate for 24 hours, high temperature
Sterilizing) in, appropriate liquid nitrogen frozen is added and is ground into powder；
(2) powder after grinding is moved into preprepared to manage without the 1.5ml EP of enzyme, the Trizol of 1ml is added immediately
Reagent notices that population of samples product is no more than the 10% of Trizol volume；
(3) chloroform of 400 μ L volumes, after vortex 1min, ice bath 15min will be added after EP pipe ice bath 15min；
Under the conditions of (4) 4 DEG C, 12000rpm is centrifuged 15min, and the careful supernatant for drawing 450 μ L volumes to contraposition is without enzyme
1.5mlEP pipe；
(5) isopropanol of 500 μ L volumes is added, is uniformly mixed.- 20 DEG C of refrigerators are put into, freezing precipitation is no less than 30min；
(6) after freezing precipitation, under the conditions of 4 DEG C, 13000rpm is centrifuged 20min, and precipitating is RNA；
(7) after being centrifuged, upper liquid is outwelled, pays attention to not pouring out RNA.75% ethyl alcohol of the 1ml (nothing of 750 μ L is added
The DEPC aqueous mixtures of water-ethanol and 250 μ L), washing precipitates 2-3 times repeatedly under room temperature, each 5-10min.Washing every time
After, under the conditions of 4 DEG C, 7500rpm is centrifuged 5min；
(8) high speed brief centrifugation after washing, is sopped up with the first extra alcohol of lancet；
(9) natural air drying makes alcohol volatilize, and suitable DEPC water is added according to requirement of experiment, is placed in -80 DEG C of refrigerators and protects
It deposits spare.The RNA of acquisition is obtained into cDNA by reverse transcription, reverse transcription uses the ReverTra Ace qPCR of Y0Y0B0 company
RT Master Mix with gDNA Remover kit carries out.Concrete operations are as follows: taking lug RNA and appropriate distilled water
It mixes, total volume 12ul, 65 DEG C of processing 5min, on ice rapidly after cooling, 4x DNase Mix 4ul, 37 DEG C of processing is added
5min.5x RT Master Mix 4ul is added, after 37 DEG C of processing 15min, then at 50 DEG C of processing 5min, 98 DEG C of processing 5min,
Terminate reaction.
Using OryzasativaLcv.Nipponbare genome as template design primer OsRL1, sequence is as follows:
OsRL1-F:5'-ATGGCAACATCCTTTCTCTTCTC-3'(SEQ ID No.2)；
OsRL1-R:5'-TTAGGATTTGTCGGCGATGAC-3'(SEQ ID No.3).
The cDNA obtained using reverse transcription is template amplification, using the special green OsBURP16 gene of RT-PCR method cloning rice,
Specific reaction system is as follows: 2 × Phanta Max Buffer, 25 μ L, dNTP Mix (10mM each) 1 μ L, upstream primer (10
μm) 2 μ L, downstream primer (10 μm) 2 μ L, 1 μ L of Phanta MaxSuper-Fidelity DNA Polymerase, template cDNA
2μL,ddH2O up to 50μL；Response procedures are as follows: 95 DEG C of initial denaturation 2min；95 DEG C of denaturation 20s, 62 DEG C of annealing 20s, 72 DEG C are prolonged
1min is stretched, is recycled 35 times；72 DEG C of extension 10min.After reaction, the gene of acquisition, which is sent to, holds up the new limited public affairs of industry biotechnology of section
Take charge of (Chengdu) sequencing.Sequencing result such as result is as follows:
ATGGCAACATCCTTTCTCTTCTCTCTCATTCTCCTCCTCATCACTGCCCTTTCTCTTCCCTTTCCTCT
CCATGCGTCATCTGTAGACCCCTTGAGCGCCGGTGCGACCACCGTCCGCTACTGGAATCGCAAGATTCCTAACAAT
GCTCCTCACCCCGACTTCTTCCTTTCACTCCTCTCCCCTCTTCCCGCATCTGTCTCCTCTTCCCTCTCCTCTCCGC
TCTCCATATCCCCATCCATCTGCCGCTCTGCTCGCCTCCTCTGCCCTAACTCTACCTATTTTCAGTCCCTCTCAAG
CACTGTCTTCATAGATGGATGCACCTTTAGTTACTCATGCACCTTCACATACGAACATACCAACATCACTATAAAG
CCTGGTATATTTTTTCGGGAGCAAGAATTGAAAGAGGGGAATGTGGTCAGAATGCCAGATATAGCGAATGAGTTGA
CGACGGCTCGTTCGTCGTTCCTTCCCCGATCGATCGCGGATAGGATCCCATTCAAGGCTGAGGCTGTCAAGTCCCT
GTTCGGGCTAGAGCCAAACACAACCTTGGCAAAGGCTGTGGATGAAACGGTGGCGCAATGCCAGAGCTCGCCAAGC
AAGGGCGAGACGAAGCGGTGCGTCACATCAGCAGAGGACATGATCGACTTTGCCGTGGCGATGTTAGGTGATGACA
TTGTGGTTCGGAGTACCGTACTGCCAAATGGGCCCGGCGAGTCGATCATGATTGGTAAGGTCAAGGGAATAAATGG
TGGCAAGATTACCAGCTCGGTATCATGCCACGAATACTTATTTCCATACATGGTATACTACTGCCACTCGGTGCCT
AAAATCAGAGTTTATGAGGCCGAGATCCTGTCCGTCCAGACGAAGGAGAAGATCAACAGCGGTGTCGCCATCTGTC
ACATTGACACGTCTGCCTGGAATGCTGGGCATCCTGCTTTTGTGGCACTAGGTGGGAAGCCAGGTCAGAACAAGGT
CTGCCACTGGATATTTAATGGCTCTATGACCTGGGTCATCGCCGACAAATCCTAA(SEQ ID No.1)。
Expression analysis of two: the OsBURP16 gene of embodiment in anti-sense rice varieties
Extract that tillering stage rice is special green respectively and Lement infect 0h, 12h, for 24 hours, the blade RNA of 48h and 72h, analysis
The expression of OsRSb5 gene different time of infection points in two rice materials.
The RNA of two rice materials is extracted and reverse transcription method is the same as embodiment 1.It is analyzed using fluorescence quantitative PCR method
The expression of OsBURP16 gene.Fluorescence quantification PCR primer OsRL2, sequence are designed according to the OsBURP16 gene order of clone
It arranges as follows:
OsRL2-F:5'-TCACATCAGCAGAGGATATGATC-3'(SEQ ID No.4)；
OsRL2-R:5'-CACCGAGTGGCAGGAGTATAC-3'(SEQ ID No.5).
Using the RNA reverse transcription product of two rice difference time of infection point blades as template, reaction system be 20uL (2 ×
10.0 0.4 μ l of μ l, Primer1 (10 μM) of AceQ qPCR SYBR Green Master Mix Primer1 (10 μM),
0.4 μ l, 50 × ROX Reference Dye of Primer2 (10 μM), 1 0.4 μ l, Template DNA/cDNA, 2 μ l is used
ddH2O supplies 20.0 μ l), using rice Os UBQ gene as reference gene, primer sequence is as follows:
UBQ-F:5'-CAAGATGATCTGCCGCAAATGC-3'(SEQ ID No.6)；
UBQ-R:5'-TTTAACCAGTCCATGAACCCG-3'(SEQ ID No.7).
It is carried out using the CFX Connect Real-Time PCR System fluorescence quantitative PCR instrument of Bio Rad Laboratories glimmering
Fluorescent Quantitative PCR reaction.Response procedures are as follows: 95 DEG C of initial denaturation 10min；95 DEG C of denaturation 15s, 60 DEG C of extension 1min are recycled 40 times.It is real
It tests the result shows that rice BURP protein coding gene OsBURP16 high expression (left side column in figure) in the special blueness of disease-resistant variety, and phase
For not infecting control, expression quantity is raised when infecting 12h；Lower (right side column in figure) is expressed in susceptible variety Lement, such as
Shown in Fig. 1~2.
The acquisition of three: OsBURP16 gene overexpression transgenic rice plant of embodiment
Further to identify function of the OsBURP16 gene in sharp eyespot resistance, the present invention will obtain in embodiment 1
Sequence fragment is cloned into plant expression vector pBWA (V) KS, constructs the over-express vector of OsBURP16 gene.By what is built
OsBURP16 gene overexpression carrier converts Agrobacterium GV3101 using Electroporation conversion, and converts susceptible variety Lement, has
Gymnastics work is completed by Wuhan Biorun Bio-Tech. Co., Ltd..Transformed plant is detection indicate that OsBURP16 gene turns in overexpression
Change expression in plant and be apparently higher than wild type, sees Fig. 3.
Example IV: the acquisition of OsBURP16 knockout transgenic rice plant
Further to verify function of the OsBURP16 gene in rice kernel smut resistance, the present invention constructs OsBURP16
The knockout carrier of gene, and the anti-rice kernel smut kind of rice transformation is special green.The specific method is as follows: being based on OsBURP16 gene
CDS sequence design specific primer OsRL4i, sequence are as follows:
OsRL4i-F:5'-CATGACTGCCCTCCGTTCAC-3'(SEQ ID No.8)；
OsRL4i-R:5'-GAGCCTGGGATCACGAAGAA-3'(SEQ ID No.9).
Using the OsBURP16 gene cloned as template, using high fidelity enzyme TransStartFastPfu DNA
Polymerase (TRNAsGen) PCR amplification OsRSb5 gene order.Extension increasing sequence is connected in pBWA (V) HS carrier, is obtained
The knockout carrier of OsBURP16 gene.The OsBURP16 gene knockout carrier built is converted into Agrobacterium using Electroporation conversion
GV3101, and the special blueness of disease-resistant variety is converted, concrete operations are completed by Wuhan Biorun Bio-Tech. Co., Ltd..Transformed plant is through examining
Survey shows that the expression in interference transformed plant of OsRSb5 gene is shown in Fig. 4 significantly lower than wild type.
Embodiment five: being overexpressed and knocks out the anti-banded sclerotial blight identification of rice plant
The anti-banded sclerotial blight of rice plant is overexpressed and knocked out using the method for sheath blight fungus Inoculated Rice excised leaf
Identification.The specific method is as follows:
(1) diameter is taken in the PDA culture medium edge punching with sheath blight fungus mycelia with punch (diameter about 5mm)
Uniform fritter is inoculated on the plate of fresh PDA culture medium, and inversion is placed in 28 DEG C of incubators, activation culture 2-3d, to
Media surface is taken out after covering with white hypha；
(2) clip rice plant of tillering stage, falls two leaf blades, is placed in 40 × 30 × 3cm white porcelain dish for being covered with filter paper, filter paper
With sterile water-soaked, vacuum side of blade is close to filter paper.The fresh sheath blight fungus culture dish edge of culture is uniformly punched, it is every to guarantee
A agar block contains substantially uniform hyphae length, fungus block is placed in position among excised leaf, the one side with mycelia is close to blade
Surface.For higher humidity needed for holding pathogen infection, white porcelain dish is wrapped up using preservative film, sets 28 DEG C of illumination boxs；
(3) incidence, disease measurement scab length are observed after 72h.
The experimental results showed that OsRSb5 gene interference rice plant is obviously more susceptible than wild type, OsBURP16 gene overexpression
Rice plant is obviously more disease-resistant than wild type, sees Fig. 5 and Fig. 6.Further illustrate that OsBURP16 gene has positive regulation rice line
The function of blight resistance.
Although be described in detail to a specific embodiment of the invention in conjunction with the embodiments, should not be construed as to this
The restriction of the protection scope of patent.In range described by claims, those skilled in the art are without creative work
The various modifications and deformation that can make still belong to the protection scope of this patent.
Sequence table
<110>Sichuan Agricultural University
<120>a kind of rice BURP protein coding gene OsBURP16 and its application
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1035
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atggcaacat cctttctctt ctctctcatt ctcctcctca tcactgccct ttctcttccc 60
tttcctctcc atgcgtcatc tgtagacccc ttgagcgccg gtgcgaccac cgtccgctac 120
tggaatcgca agattcctaa caatgctcct caccccgact tcttcctttc actcctctcc 180
cctcttcccg catctgtctc ctcttccctc tcctctccgc tctccatatc cccatccatc 240
tgccgctctg ctcgcctcct ctgccctaac tctacctatt ttcagtccct ctcaagcact 300
gtcttcatag atggatgcac ctttagttac tcatgcacct tcacatacga acataccaac 360
atcactataa agcctggtat attttttcgg gagcaagaat tgaaagaggg gaatgtggtc 420
agaatgccag atatagcgaa tgagttgacg acggctcgtt cgtcgttcct tccccgatcg 480
atcgcggata ggatcccatt caaggctgag gctgtcaagt ccctgttcgg gctagagcca 540
aacacaacct tggcaaaggc tgtggatgaa acggtggcgc aatgccagag ctcgccaagc 600
aagggcgaga cgaagcggtg cgtcacatca gcagaggaca tgatcgactt tgccgtggcg 660
atgttaggtg atgacattgt ggttcggagt accgtactgc caaatgggcc cggcgagtcg 720
atcatgattg gtaaggtcaa gggaataaat ggtggcaaga ttaccagctc ggtatcatgc 780
cacgaatact tatttccata catggtatac tactgccact cggtgcctaa aatcagagtt 840
tatgaggccg agatcctgtc cgtccagacg aaggagaaga tcaacagcgg tgtcgccatc 900
tgtcacattg acacgtctgc ctggaatgct gggcatcctg cttttgtggc actaggtggg 960
aagccaggtc agaacaaggt ctgccactgg atatttaatg gctctatgac ctgggtcatc 1020
gccgacaaat cctaa 1035
<210> 2
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atggcaacat cctttctctt ctc 23
<210> 3
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ttaggatttg tcggcgatga c 21
<210> 4
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
tcacatcagc agaggatatg atc 23
<210> 5
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
caccgagtgg caggagtata c 21
<210> 6
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
caagatgatc tgccgcaaat gc 22
<210> 7
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
tttaaccagt ccatgaaccc g 21
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
catgactgcc ctccgttcac 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
gagcctggga tcacgaagaa 20
Claims (4)
1. a kind of rice BURP protein coding gene OsBURP16, nucleotide sequence is as shown in SEQ ID No.1.
2. the over-express vector containing rice BURP protein coding gene OsBURP16 described in claim 1.
3. the agrobacterium strains containing over-express vector described in claim 2.
4. application of the rice BURP protein coding gene OsBURP16 described in claim 1 in Genes For Plant Tolerance banded sclerotial blight.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910246826.9A CN110055260A (en) | 2019-03-29 | 2019-03-29 | A kind of rice BURP protein coding gene OsBURP16 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910246826.9A CN110055260A (en) | 2019-03-29 | 2019-03-29 | A kind of rice BURP protein coding gene OsBURP16 and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110055260A true CN110055260A (en) | 2019-07-26 |
Family
ID=67317835
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910246826.9A Pending CN110055260A (en) | 2019-03-29 | 2019-03-29 | A kind of rice BURP protein coding gene OsBURP16 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110055260A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111172179A (en) * | 2020-01-19 | 2020-05-19 | 武汉艾迪晶生物科技有限公司 | Ubiquitin ligase gene OsNLA2, protein and application thereof in rice breeding |
| CN116218867A (en) * | 2022-11-17 | 2023-06-06 | 华南农业大学 | Application of rice gene OsBURP12 in salt-tolerant germination of rice |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003000906A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Plant disease resistance genes |
-
2019
- 2019-03-29 CN CN201910246826.9A patent/CN110055260A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003000906A2 (en) * | 2001-06-22 | 2003-01-03 | Syngenta Participations Ag | Plant disease resistance genes |
Non-Patent Citations (2)
| Title |
|---|
| HUANHUAN LIU ET AL.: "Overexpression of stress-inducible OsBURP16,the β subunit of polygalacturonase 1,decreases pectin content and cell adhesion and increases abiotic stress sensitivity in rice", 《PLANT,CELL&ENVIRONMENT》 * |
| XIPENG DING ET AL.: "Genome-wide identification of BURP domain-containing genes in rice reveals a gene family with diverse structures and responses to abiotic stresses", 《PLANTA》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111172179A (en) * | 2020-01-19 | 2020-05-19 | 武汉艾迪晶生物科技有限公司 | Ubiquitin ligase gene OsNLA2, protein and application thereof in rice breeding |
| CN111172179B (en) * | 2020-01-19 | 2020-09-08 | 武汉艾迪晶生物科技有限公司 | Ubiquitin ligase gene OsNLA2, protein and application thereof in rice breeding |
| CN116218867A (en) * | 2022-11-17 | 2023-06-06 | 华南农业大学 | Application of rice gene OsBURP12 in salt-tolerant germination of rice |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Qi et al. | Morphological and molecular analysis of genetic variability within isolates of Corynespora cassiicola from different hosts | |
| CN102816773B (en) | Application of OsWRKY28 transcription factor gene of rice in improvement of plant disease resistance | |
| CN113249229B (en) | Pseudocercosporus endophytic fungus P-B313 and application thereof | |
| CN110904119B (en) | XNDL2 gene, protein, overexpression vector, and method for obtaining rice with banded sclerotial blight resistance and application | |
| CN110004156A (en) | GhCML20 gene relevant to resistance to verticillium wilt and its application | |
| CN107267523A (en) | A kind of bacterial leaf spot resistance albumen and encoding gene | |
| CN105585619A (en) | Protein related to grain length and grain weight of paddy rice grains, encoding gene GL3-3 and application thereof | |
| CN110055260A (en) | A kind of rice BURP protein coding gene OsBURP16 and its application | |
| CN108588041B (en) | Gossypium barbadense cytochrome P450 gene, and coding protein and application thereof | |
| CN106591145A (en) | Plectosphaerella sp. EF01 separated from root tuber of radix tetrastigme and application of Plectosphaerella sp. EF01 | |
| CN104593383B (en) | The gene TaFBK1 of one tool F box domain and its expression vector and application | |
| CN110055267A (en) | A kind of rice cytosolic kinase-encoding gene OsRLCK5 and its application | |
| CN110079533A (en) | A kind of rice NBS-LRR ill-resistant protein encoding gene OsRSR1 and its application | |
| CN110982817A (en) | amiRNA for resisting wheat yellow mosaic virus and application thereof | |
| CN114276938B (en) | Paecilomyces EJKS strain, Fusarium E-9 strain and application thereof | |
| CN110606877A (en) | Transcription factor for improving wheat rust-resistant varieties and screening method thereof | |
| CN115976051A (en) | Potato StRTP7 gene and application thereof in disease-resistant breeding | |
| CN108559753A (en) | The breeding method of application and Rust resistance bacterium wheat of the wheat stripe rust PSTG_17694 genes in stripe rust prevention | |
| CN110055266A (en) | A kind of rice cytochrome P 450 encoding gene OsRSb3 and its application | |
| CN109825456B (en) | Marina marine bacillus E40208a1 and application thereof | |
| Wickramasinghe et al. | Molecular characterization of Colletotrichum species causing Begonia anthracnose in Sri Lanka | |
| CN106497943A (en) | A kind of ash arrhizus bacteria gene BcSEP5 related to pathogenicity and its application | |
| CN111004727B (en) | Endophytic fungus Z1 for increasing biomass of casuarina equisetifolia in high-salt environment | |
| CN114292759A (en) | Fusarium oxysporum with effect of preventing and treating continuous cropping obstacle of tobacco | |
| CN111635906A (en) | Gossypium barbadense GbCYP72A2 gene, and coding protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190726 |
|
| RJ01 | Rejection of invention patent application after publication |