CN110042123A - A method of bovine somatic cells cloning efficiency is improved by inducing expression zfp57 - Google Patents
A method of bovine somatic cells cloning efficiency is improved by inducing expression zfp57 Download PDFInfo
- Publication number
- CN110042123A CN110042123A CN201910307633.XA CN201910307633A CN110042123A CN 110042123 A CN110042123 A CN 110042123A CN 201910307633 A CN201910307633 A CN 201910307633A CN 110042123 A CN110042123 A CN 110042123A
- Authority
- CN
- China
- Prior art keywords
- zfp57
- cell
- gene
- somatic cells
- clone
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0656—Adult fibroblasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Rheumatology (AREA)
- Plant Pathology (AREA)
- Developmental Biology & Embryology (AREA)
- Gynecology & Obstetrics (AREA)
- Reproductive Health (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of methods for improving bovine somatic cells cloning efficiency, so that the methylation of the imprinted genes in ox clone embryos growth course is restored normal level by inducing expression zfp57 gene, to improve bovine somatic cells cloning efficiency.A kind of method improving bovine somatic cells cloning efficiency provided by the invention; imprinted genes hypomethylation abnormal on ox clone embryos is corrected using zfp57; reach its methylation level and the close level of IVF Embryos; to improve the embryo quality of ox clone embryos, promote the development of ox clone embryos；Theoretical foundation is provided the reason of the mechanism and somatic cell clone inefficiency of methylation imprinting exception during somatic cell clone embryo reprograms to illustrate.
Description
Technical field
The present invention relates to gene engineering technology fields, more particularly to a kind of to be improved by inducing expression zfp57
The method of bovine somatic cells cloning efficiency.
Background technique
The gene of mammal has two copies from parent, and under normal circumstances, two copies are expressed.But base
It is monoallelic expression (monoallelic expression) because group has some genes, only according to pro-borne these genes
The allele from one side of parent is expressed, and the allele from another party is not expressed.This genoid is known as imprinted genes,
This non-Mendelian heredity phenomenon is known as genomic imprinting.
There are mainly three types of the methods of reprogramming of somatic cells: nuclear transfer, the induction of the multipotency factor and cell fusion, but at present
Most mature is nuclear transfer to the highest method of reprogramming efficiency of somatic cells.Body-cell neucleus transplanting has important theoretical research valence
Value and production practices value, can be applied to therapeutic cloning, the production of disease-resistant transgenic domestic animal, the life of high value pharmaceutical protein
The research such as building of production, human organ transplantation and disease model.But the efficiency of somatic cell clone is not still high so far, and a large amount of bodies are thin
Born of the same parents' cloned fetus also shows various dysplasia, such as giant embryo in attached plant phase or perinatal death, the cloned animal for survival of being born
Disease etc..Generally existing imprinted genes exception demethylation is that cloned animal is caused to send out during somatic cell clone embryo reprogramming
Educate the major reason of exception and somatic cell clone inefficiency.
Therefore, the imprinted genes in ox clone embryos growth course how are protected to methylate, to improve bovine somatic cells gram
The problem of grand efficiency is those skilled in the art's urgent need to resolve.
Summary of the invention
In view of this, the present invention provides a kind of methods for improving bovine somatic cells cloning efficiency by inducing expression zfp57.
To achieve the goals above, the present invention adopts the following technical scheme:
A method of bovine somatic cells cloning efficiency being improved, the method makes Niu Kelong by inducing expression zfp57 gene
Imprinted genes methylation in embryo development procedure restores normal level, to improve bovine somatic cells cloning efficiency.
Further, a method of improving bovine somatic cells cloning efficiency, realized by following steps:
(1) zfp57 expression vector is constructed
1. zfp57 gene cloning:
According to the CDS sequence design amplimer Zfp57-KZ of zfp57 gene；Using tire bovine fibroblasts cDNA as mould
Plate, Zfp57-KZ are primer, and PCR amplification obtains zfp57 gene；
2. constructing zfp57 expression vector:
Zfp57 gene connects pMD-18T carrier, obtains plasmid pMD-18T-zfp57；By plasmid pMD-18T-zfp57 and
PTRE3G-BI carries out double digestion respectively, connects, and conversion obtains expression vector pTRE3G-BI-zfp57；
(2) transgenosis cell strain is established
1. expression vector pTRE3G-BI-zfp57 and assistant carrier cotransfection tire bovine fibroblasts are screened monoclonal
Cell；
2. the monoclonal cell to acquisition carries out PCR, real-time fluorescence quantitative PCR and immune-blotting method；
(3) influence of detection expression zfp57 gene pairs ox embryonic development；
(4) influence of detection expression zfp57 gene pairs ox embryonic blastula quality
(5) influence of detection expression zfp57 gene pairs cattle early embryo imprinted genes methylation level.
Further, the primer sequence of the amplimer Zfp57-KZ is as follows:
Zfp57-KZ-F:GCCACCATGGAGCCTAGTCACCCTTGGTGGC；SEQ ID NO.2；
Zfp57-KZ-R:TCACTTATCGTCGTCATCCTTGTAATCTTTCCCTTCTAAGACCTTCATTGCC；SEQ
ID NO.3；
Wherein, Kozak sequence (GCCACC) is added in upstream primer, and Flag sequence is added in downstream primer
(CTTATCGTCGTCATCCTTGTAATC)。
Further, the assistant carrier is pEF1 α-Tet3G.
Further, zfp57 gene is improving the application in bovine somatic cells cloning efficiency.
It can be seen via above technical scheme that compared with prior art, the present disclosure provides a kind of raising ox body is thin
The method of born of the same parents' cloning efficiency, there are the loss of serious trace methylation on bovine somatic cells clone embryos, zfp57 can correct Niu Ke
Abnormal imprinted genes hypomethylation on grand embryo makes the arrival of its methylation level and the close level of IVF Embryos, from
And the embryo quality of ox clone embryos is improved, promote the development of ox clone embryos；It was reprogrammed to illustrate somatic cell clone embryo
The reason of mechanism and somatic cell clone inefficiency of methylation imprinting exception, provides theoretical foundation in journey.
Detailed description of the invention
In order to more clearly explain the embodiment of the invention or the technical proposal in the existing technology, to embodiment or will show below
There is attached drawing needed in technical description to be briefly described, it should be apparent that, the accompanying drawings in the following description is only this
The embodiment of invention for those of ordinary skill in the art without creative efforts, can also basis
The attached drawing of offer obtains other attached drawings.
Fig. 1 attached drawing is zfp57 gene PCR amplified band of the present invention；
Fig. 2 attached drawing is expression vector pTRE3G-BI-zfp57 qualification result of the present invention；
Wherein, M, 5000bp marker；1, empty carrier pTRE3G-BI；2, plasmid pTRE3G-BI-zfp57；
Fig. 3 attached drawing is that expression vector pTRE3G-BI-zfp57 of the present invention transfects the transgenic cell after 293T cell；
Fig. 4 attached drawing is that the transgenosis after expression vector pTRE3G-BI-zfp57 of the present invention transfection tire bovine fibroblasts is thin
Born of the same parents；
Fig. 5 attached drawing is overexpressing cell strain expression efficiency of the present invention detection；
Wherein, KB, the not blank control of transfected plasmids；NC, transfection are free of the empty carrier of target gene；
O1-O6, part overexpressing cell strain are overexpressed Efficiency testing (O:Overexpression)；
Fig. 6 attached drawing is the expression that qPCR of the present invention identifies zfp57；
Fig. 7 attached drawing is the immune-blotting method of monoclonal cell of the present invention；
Wherein, A, Flag；B, internal reference β-Actin；1, transfect the over-express vector of target gene；2, transfect zero load crosses table
Up to carrier；
Fig. 8 attached drawing is ox clone embryos of the present invention；
Wherein, A compares IVF group；B interferes ZFP57-IVF group；C compares clone's group；D, ZFP57 clone's group；
Fig. 9 attached drawing is blastaea apoptosis rate of the present invention；
Wherein, blastomere apoptosis dyeing (TUNEL, green) and nucleus DNA (DAPI) contaminate altogether；Amplification factor is 40；
A compares IVF group；B interferes ZFP57-IVF group；C compares clone's group；D, ZFP57 clone's group；
It predicts on the island CpG that Figure 10 attached drawing is ox H19/IGF2ICR of the present invention；
The sequence information that Figure 11 attached drawing is ox H19/IGF2ICR of the present invention is studied；
Wherein, after ox H19/IGF2ICR segment (426bp) sequence to be studied (cochain) and area's bisulfite conversion
It predicts DNA sequence dna (lower chain)；It is primer sequence position that yellow and underscore, which mark sequence,；The site CpG is marked with " ++ "；
Figure 12 attached drawing is the methylation level that BSP method of the present invention analyzes H19/IGF2ICR
Figure 13 attached drawing is the methylation level that BSP method of the present invention analyzes XISTICR；
Figure 14 attached drawing is the methylation level that BSP method of the present invention analyzes IGF2R ICR；
In Figure 12-14, the circle on every horizontal cross chain indicates the site CpG inside research sequence, white and black
Circle respectively represents the CpG of non-methylation and methylation；Every horizontal cross chain represents the clone of a sequencing；Indicate DNA methyl
The circle string string figure of the BSP sequencing result of change level is automatically generated with BIQ Analyzer software；In each sample, methylation
Site indicates that the DNA methylation of the gene on this sample is horizontal divided by all sites；Each sample BS-PCR in triplicate.
Specific embodiment
Following will be combined with the drawings in the embodiments of the present invention, and technical solution in the embodiment of the present invention carries out clear, complete
Site preparation description, it is clear that described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.It is based on
Embodiment in the present invention, it is obtained by those of ordinary skill in the art without making creative efforts every other
Embodiment shall fall within the protection scope of the present invention.
PEF1alpha-Tet3G plasmid vector, pTRE3G-BI plasmid vector, 293T cell line and tire bovine fibroblasts,
It is saved by laboratory.
The a small amount of extraction agent boxes of SanPrep pillar Plasmid DNA, DNA purification and recovery reagent (Axygen), endotoxin-free plasmid
Middle extraction reagent kit is purchased from Promega company；Real-time quantitative PCR (RT-qPCR) kit SYBR Premix Ex TaqTM
(Perfect Real Time), reverse transcription reagent box PrimeScriptTM RT reagentKit is purchased from TaKaRa company；
BCA protein quantification kit is ShiJi Co., Ltd purchased from health；OptiMEM, DMEM high glucose medium, fetal calf serum are purchased from
Invitrogen company；FugeneHD transfection reagent is purchased from Roche company；TransZol Up is purchased from Transgene company；
Flag antibody, β-actin antibody, horseradish peroxidase-labeled goat anti-rabbit igg (H+L) are purchased from green skies company.
Embodiment 1zfp57 gene cloning
Bos zfp57 predictive genes sequence is searched for using NCBI, copies its transcript sequence, and mark out CDS sequence
(SEQ ID NO.1).Using Primer5 primer-design software according to the CDS sequence design amplimer (Zfp57- of zfp57
KZ), and at its upstream Kozak sequence (GCCACC) is added in primer, close terminating due to lacking ox ZFP57 protein antibodies
Add one section of Flag sequence (CTTATCGTCGTCATCCTTGTAATC) before numeral.
Wherein, amplimer Zfp57-KZ sequence is as follows；
Zfp57-KZ-F:GCCACCATGGAGCCTAGTCACCCTTGGTGGC；SEQ ID NO.2；
Zfp57-KZ-R:TCACTTATCGTCGTCATCCTTGTAATCTTTCCCTTCTA
AGACCTTCATTGCC；SEQ ID NO.3.
Using tire bovine fibroblasts cDNA as template, Zfp57-KZ is primer, and PCR amplification zfp57 gene obtains 1713bp
The band of size, as a result as shown in Figure 1.
PCR reaction system are as follows: 2.5 μ L of template, each 0.5 μ L, 2 × PrimeSTAR GC Buffer, 25 μ of upstream and downstream primer
4 μ L, PrimeSTAR HS DNA Polymerase of L, dNTP Mixture 0.5 μ L, ddH2O 17μL.PCR response parameter:
94℃5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 2min；72 DEG C of 10min are recycled 40 times；4 DEG C reaction was completed.
Glue recycling is carried out to the PCR product of acquisition, obtains zfp57 genetic fragment.
The building of embodiment 2zfp57 Primary structure carrier
1) the zfp57 genetic fragment that embodiment 1 obtains connects pMD-18T carrier
Coupled reaction system are as follows: 5 μ L, Solution I of zfp57 genetic fragment, 4 μ L, pMD-18T carrier, 1 μ L；By sample
4 DEG C of refrigerator overnight connections are placed, connection product is obtained.
2) connection product converts escherichia coli Trans5 α competent cell
(1) competent cell melted on 50 μ L ice baths is taken, the connection product of 5 μ L is added, mixes gently, ice bath is put
20min；
Heat shock 60s in (2) 42 DEG C of water-baths, is quickly transferred to 2min in ice bath for pipe；
(3) the sterile LB culture solution of 500 μ L is added into each 1.5ml EP pipe in superclean bench, mixing is placed on 37
DEG C, 200r/min cultivates 1h, recovery；
(4) 4000r/min is centrifuged 4min after recovering, and discards part supernatant, retains 100~200 μ L bacterium solutions and mixes precipitating,
It is uniformly coated on the LB culture dish containing Amp+, after bacterium solution is dry, ware is inverted, 42 DEG C of electro-heating standing-temperature cultivators are trained overnight
It supports.
3) monoclonal colonies are screened
In superclean bench picking there is the monoclonal of ammonia benzyl resistance to be added and contains 7mL LB culture solution and 7 μ L Amp+From
In heart pipe, each culture dish carries out 3 repetitions, is placed in constant-temperature table and expands culture about 10-12h (37 DEG C, 200r/min).
4) plasmid pMD-18T-zfp57 is extracted
The bacterium solution 6ml shaken is taken to extract plasmid as follows with a small amount of extraction agent boxes of SanPrep pillar Plasmid DNA,
And successively marker number.The bacterium solution shaken is drawn into 700 μ L, guarantor bacterium in the glycerol of 300 μ L (- 80 DEG C of storages) is added.It will label
The plasmid of good sequence number send to Nanjing Jin Sirui company be sequenced, obtain sequencing feedback information after carry out sequence between comparison, and with
Correspondence gene order Blast in NCBI chooses the plasmid pMD-18T-zfp57 without containing base mutation and base dislocation and carries out
Subsequent experimental.
5) construction of expression vector pTRE3G-BI-zfp57
Expression vector pTRE3G-BI and plasmid pMD-18T-zfp57 is subjected to double digestion using PstI and EcoRI respectively,
Electrophoresis and glue recycling digestion products, by the expression vector pTRE3G-BI after the zfp57 gene target fragment of glue recycling and double digestion
Connection.Connection product converts escherichia coli Trans5 α competent cell, and picking has the monoclonal of ammonia benzyl resistance, turned
Beggar extracts plasmid pTRE3G-BI-zfp57.
Agarose gel electrophoresis is carried out to plasmid pTRE3G-BI-zfp57, is control with empty carrier pTRE3G-BI, as a result
It was found that empty carrier pTRE3G-BI is 1700bp smaller than plasmid pTRE3G-BI-zfp57, as a result as shown in Fig. 2, showing expression vector
PTRE3G-BI-zfp57 is constructed successfully.
3 expression vector pTRE3G-BI-zfp57 of embodiment transfects 293T cell
1) preparation of 293T cell, tire bovine fibroblasts (FBF)
(1) 293T cell recovery
293T cell is thawed in 37 DEG C of water-baths immediately after liquid nitrogen container taking-up, the DMEM for drawing 37 DEG C of 1mL preheatings is thin
Born of the same parents' culture solution (is prepared: 10.4g DMEM dry powder, 3.7gNaHCO3, 100mL fetal calf serum, benefit ultrapure water to 1L, filtering packing)
In 1.5mL centrifuge tube, 293T cell is added, 1000r/min is centrifuged 5min, discards supernatant, and the training of 1mL DMEM cell is added
Nutrient solution blows afloat cell.The 293T cell hanged is added to 6cm Tissue Culture Dish and (includes 3mL cell culture fluid and 3 μ L moulds
Element and streptomysin are dual anti-) in, it mixes, is put into CO2Cell incubator culture.The dual anti-293T cell that can prevent from just having thawed is added
Germ contamination occurs.
(2) 293T cell passes on
Passage when 293T cell grows to plate 80%~90%.Culture solution in culture dish is exhausted, with 300 μ L
0.25% pancreatin cell dissociation buffer (weighs 0.25g trypsase powder, PBS of the 100mL without calcium and magnesium is added, no in 0.02g EDTA
Disconnected stirring is to abundant dissolution, and tubule dispenses after 0.22 μm of aperture membrane filtration, -20 DEG C freeze it is spare) digestion 3min (digestion time
Depending on length is with different cells) after, 1mL culture solution is added and stops digestion, culture solution liquid in ware is drawn to 1.5mL centrifuge tube,
Supernatant is abandoned after 1000r/min centrifugation 5min, 1mL culture solution is added and hangs cell, another is added in half cell suspending liquid
6cm Tissue Culture Dish (includes 3ml cell culture fluid and 3 μ L is dual anti-), and remaining cell suspending liquid is averagely added the 2 of 24 orifice plates
A hole (including 500 μ L culture solutions), is put in CO after mixing2Cell incubator culture.
The recovery of tire bovine fibroblasts is with passage referring to the recovery of 293T cell and passage step.
2) expression vector pTRE3G-BI-zfp57 and assistant carrier cotransfection 293T cell
The inducible expression is made of two carriers: main carrier and assistant carrier, in view of 293T cell transfecting efficiency compared with
Height, thus the present invention selection in 293T cell verify zfp57 inducible expression whether normal expression.Assistant carrier is to adjust
Expression vector can express transcriptional activators, its conformation can be changed by the transcription factor under Dox induction, be incorporated into
The sequence area TRE of expression vector is reacted, and then starts the expression of downstream target gene zfp57.
30min replaces the cell culture fluid in 24 orifice plates, every 500 μ L complete culture solution of hole before transfection；Respectively with 50 μ L
Serum-free DMEM in high glucose dilutes 1 μ g main carrier (expression vector pTRE3G-BI-zfp57) and 1 μ g assistant carrier (pEF1 α-
Tet3G), piping and druming up and down gently mixes；6 μ L Long Trans are diluted with 100 μ L serum-free DMEM in high glucose, are gently blown up and down
It beats 3-4 times；It takes the diluted Long Trans of 50 μ L to be added in diluted main carrier and assistant carrier respectively, blows and beats 3-4 up and down
It is secondary to be sufficiently mixed；It is stored at room temperature 10min.
50 μ L main carriers and reagent mixed liquor, assistant carrier and reagent mixed liquor are taken to be added in 24 orifice plates respectively, gently
It mixes；It is placed in CO2It is cultivated in incubator.DOX inducer (tetracycline analogue, to make target gene and resistance is added after 8h
Gene continuous expression) induction destination gene expression, observe GFP expression afterwards for 24 hours.As a result as shown in figure 3, transgenic cell table
Up to green fluorescence, show zfp57 inducible expression can in eukaryocyte normal expression.
The screening of monoclonal cell after embodiment 4 transfects
1) cell pre-sifted
FBF tiling in good condition is seeded in 12 orifice plates, every hole is inoculated with 7x104A cell, tiling are uniform.Second
It, absorbs culture medium in culture hole, and PBS washed once, and the screening and culturing medium of different G418 concentration, 100ug/ are added in every hole
Ml, 400ug/ml, 500ug/ml, 700ug/ml, 800ug/ml, 900ug/ml, 1000ug/ml will joined various concentration
12 orifice plates of G418 are put to CO2It is cultivated in incubator.Every the culture solution of replacement in 3-5 days, and the G418 of various concentration is added.
It is best screening concentration that the minimum G418 concentration of all cells, which can be killed, in screening 10~14 days.It is final to determine the present invention
The most suitable G418 screening concentration of cell used is 800ug/ml.
2) screening of plasmid transfection and monoclonal
By FBF plating cells in good condition to 4 6cm wares on the day before plasmid transfection, each culture dish is inoculated with 3x106It is a
Cell.Cell electricity is carried out when cell confluency is to 85%-95% to turn.
Electricity goes to step as follows: cell covers with 90% Shi Kezhuan-abandoning culture solution-PBS and washes 2 times-plus 300ul pancreatin, incubator
Middle 3min- adds 1ml culture solution to terminate digestion-centrifugation, and abandoning supernatant-Opti-MEM washes twice-addition 700ul electricity and turns liquid, 6ug matter
Grain-standing 10min- electric shock (510V 2ms 1 time)-stands 15min- and tiles into new 6cm ware, adds 3ml fresh medium-
It puts to CO2It is cultivated in incubator.
When transfecting over-express vector, electricity is added in the main carrier containing target gene built and each 10ug of assistant carrier
Turn to be incubated for 10min in liquid altogether；Unloaded main carrier is added in another electric revolving cup simultaneously to be incubated for altogether with each 10ug of assistant carrier
10min, as control.
After each group is incubated for 10min, carries out electricity and turn.After electricity turns, 15min is stood, then mixes cell in electric revolving cup with plasmid
It closes object to be transferred in 6cm ware, adds 3ml DMEM culture solution, jiggle culture dish, keep cell evenly laid out in culture dish bottom.
It puts to CO2It is cultivated in incubator.Next day reaches the cell in 6cm ware in 5 10cm wares, and 8ml culture solution is added in each ware,
64ul G418 (concentrate concentration be 100ug/ml) is added simultaneously, makes G418 concentration 800ug/ml in culture solution, gently on
Under, double swerve culture dish be evenly distributed on cell in culture dish.Correspondence markings are carried out to each culture dish.It puts to CO2Training
It supports and is cultivated in case.
Every the culture solution of replacement in 3 days, and observe the growth and death condition of cell.It will appear within 10-14 days the thin
Born of the same parents clone.Transgenic cell expresses green fluorescence, and cell clone is in cell monoclonal such as Fig. 4 of green fluorescence screening.According to thin
The growing state of born of the same parents clone and the size of clone carry out the picking of monoclonal cell.
3) picking of monoclonal cell
When cell after electricity turn is grown 14 days in 10cm ware, the size of clone can meet the condition of picking.Micro-
Cell state and sizeable monoclonal are found out under mirror and is irised out with marking pen, to facilitate subsequent picking process.
Culture solution is discarded, wash primary with PBS and is discarded, pancreatin is dripped at the monoclonal irised out, in desk-top inversion
The digestion situation of microscopically observation cell is carefully added into 4ml culture when most cells digest spatially shape by pancreatin
Liquid terminates digestion.
48 orifice plates are taken, and 400ul DMEM culture solution is added in every hole；By the monoclonal cell digested put to
The picking of cell monoclonal is carried out under inverted microscope；The cell of picking is reached in 48 orifice plates, and carries out corresponding label.To
Cell reaches 24 orifice plates when covering with 48 orifice plate, positive cell is reached 12 orifice plates again when cell covers with 24 orifice plate, is passed again with this
Enter in 6 orifice plates.
4) the PCR detection of monoclonal cell
When the monoclonal cell that picking goes out is passaged to 6 orifice plates, the good monoclonal cell of growth conditions is reached into nothing on a small quantity
In the PCR pipe of bacterium, culture solution is abandoned in centrifugation.(2X RIPA cell pyrolysis liquid: Tris alkali 0.2416g, NaCl are weighed using lysate
18mL ddH is added in 0.3505g, SDS 0.04g, NaTDC 0.4g2O, which is stirred well to, to be completely dissolved, and is added
TritonX-1000.2mL uses ddH2O is settled to 20mL, and tubule packing, -20 DEG C save backup) cell, each PCR pipe is resuspended
Middle addition 10-20ul lysate, 65 DEG C of 15min, 95 DEG C of 5min, lytic cell.
After cracking, the cell pyrolysis liquid containing lytic cell is made into template and carries out PCR, the insertion situation of testing goal segment.
PCR system is as follows: template 1ul, upstream and downstream primer (Zfp57-KZ) each 0.6ul, HiFi DNA Polymerase 0.2ul,
DNTP Mixture 2ul, HiFi bufferII 2ul, ddH2O 13.6ul.PCR response parameter: 94 DEG C of 3min；94 DEG C of 30s,
60 DEG C of 30s, 72 DEG C of 12s are recycled 35 times；72℃2min；4 DEG C reaction was completed.
There is purpose band to 6 plants of monoclonal cells in detected through gel electrophoresis after PCR.Target fragment will be identified through PCR
6 plants of positive cells that stable integration enters genome mark, and reach 12 orifice plates and continue to cultivate；After positive cell covers with 12 orifice plates
6 orifice plates are reached, then reach 6cm ware again, part cell is reached into 12 orifice plates after cell covers with, remaining cell reaches 6cm ware
Continue to cultivate.Positive colony cell in 12 orifice plates is used to do quantitative PCR detection, and cell is used to be WesternBlot in 6cm ware
Protein Detection.
5) quantitative PCR detection of monoclonal cell
Total RNAs extraction is carried out to the positive colony cell in 12 orifice plates, and marks its good serial number respectively.
(1) Trizol method extracts cell total rna, and extraction step is as follows:
1. about 500 μ L of Trizol is added after cell is paved with the 95% of hole area, cracking 10min is stood, and use pipettor
1.5mL is collected into without in RNA enzyme centrifuge tube；
2. 0.1mL chloroform is added, lid is covered tightly, 15s is acutely rocked, is stored at room temperature 2min；
3. 13000rpm is centrifuged 15min (4 DEG C of refrigerated centrifuges), RNA is in the water phase of top layer；Water phase is drawn, and is put into
In new RNase-free EP pipe, isometric isopropanol is added, mixing of turning upside down, 4 DEG C of standing 30min；
4. 13000rpm is centrifuged 10min (4 DEG C of refrigerated centrifuges), supernatant is completely removed, every 1mL Trizol is added 1mL's
75% ethyl alcohol of RNase-free, and the cleaning precipitating that turns upside down；
5. 7500rpm is centrifuged 5min (4 DEG C of refrigerated centrifuges), supernatant, and 5~10min of natural drying at room temperature are abandoned, 30 μ L are added
RNase-free ddH2O dissolves RNA, and measures concentration and 260/280, carries out reverse transcription according to its concentration.
(2) RNA reverse transcription
By TaKaRa company reverse transcription reagent box PrimeScript TM RT reagentKit specification, reverse transcription system
It is as follows: 1 μ L, Random 6mers of 5X PrimeScriptBuffer4 μ L, PrimeScript RT Enzyme Mix I, 1 μ
1 μ L, RNase-free ddH of L, RNA2O 13μL.Reverse transcription program: 37 DEG C of 15min；85 DEG C of 5s, 4 DEG C of 5min.It obtains
CDNA is put in -20 DEG C of preservations.
(3) real-time fluorescence quantitative PCR
Zfp57 quantitative detection primer (Zfp57-DL) is designed according to Zfp57 complete genome sequence, primer sequence is as follows:
Zfp57-DL-F:GAAACAGTGGGAAGCGGATC；SEQ ID NO.4；
Zfp57-DL-R:ACAGTCCCCTCATCTCCCA；SEQ ID NO.5.
Real- is carried out using TaKaRa company SYBR Premix Ex Taq (Perfect Real Time) kit
Time PCR prepares reaction system according to kit operation instructions.Each sample is repeated 3 times.After sample-adding, use
AppliedBiosystems company Steponeplus real-time PCR carries out real time PCR reaction.
Response procedures are as follows: 95 DEG C of 30s；95 DEG C of 5s, 60 DEG C of 30s；Circulation 40 times.After reaction, with 2- Δ Δ cT
Method calculates the relative expression quantity of target gene, as a result as shown in Figure 5.
The highest 4th plant of monoclonal cell strain of expression quantity is chosen, culture is expanded.Cellular control unit is extracted with TRIZOL
(con) and be overexpressed zfp57 monoclonal cell, as a result as shown in fig. 6, qPCR zfp57 is significant in mRNA level in-site as the result is shown
Rise.
6) immune-blotting method of monoclonal cell
(1) extraction of protein
1. exhausting DMEM cell culture fluid, 300 μ L pancreatin are added and digest 2min, isometric cell culture fluid is added to stop disappearing
Change, is dispensed into 1.5mL centrifuge tube；
2. 1000r/min is centrifuged 5min, supernatant is abandoned, is hanged with 500 μ L PBS piping and druming, 300g is centrifuged 5min, abandons supernatant, adds
Enter 100~200 μ L cell pyrolysis liquids (inner protein enzyme inhibitor), ice bath cracks 15min；
3. being centrifuged 20min at 4 DEG C with 12000r/min, supernatant is taken, is added solidifying with 2 isometric × SDS of cell pyrolysis liquid
Glue sample loading buffer, 95~100 DEG C of water-baths boil 10min；
(2) protein quantification
1. the supernatant after cracking in 50 μ L previous steps is taken, with 10 times of cell lysis buffer；
2. 4 samples (including a blank control) respectively take 20 μ L in detachable ELISA Plate；
3. BCA reagent A and BCA reagent B mixed liquor (1:50, totally 180 μ L), 37 DEG C of incubation 30min are added in each hole；
4. the micro OD value surveyed liquid instrument and survey each sample.
(3) SDS- polyacrylamide gel electrophoresis
1. assembling SDS-PAGE electrophoretic apparatus, two blocks of offset plates are prepared, one piece compares for internal reference, and another piece for detecting；
2. being put into electrophoresis tank after glue is fixed, electrophoretic buffer is poured into, is loaded with micro liquid inlet device, Blue Plus II
25~30 μ L samples are added in 5 μ L of Protein Marker, test sample, and internal reference is corresponding to add 5 μ L, less than 1 × Loading
Buffer polishing；
3. starting electrophoresis after the completion of sample-adding, it is 85V that voltage is adjusted when glue is concentrated, and illustrates sample when Marker starts point band
Separation gel is entered, voltage is increased to 120V and continues electrophoresis；Electrophoresis can be stopped by running out of gel when discovery bromophenol blue.
(4) transferring film
1. pvdf membrane impregnates 1~2min using preceding in methyl alcohol, then with the transferring film buffer immersion of pre-cooling, glue cut after from
Cathode is successively placed to anode by sponge, filter paper, gel, pvdf membrane, filter paper, sponge；
2. assembling 0.25A electrophoresis 2.5h after membrane-transferring device, this process carries out in ice chest.
(5) it closes
Pvdf membrane is put into 100g/L skimmed milk power TBST confining liquid, closes 3h in low speed shaking table.
(6) antibody incubation and development
After 1. primary antibody dilutes (respectively Flag antibody 1:500, β-actin antibody 1:2000) with 50g/L skimmed milk power,
Even drop is on pvdf membrane；4 DEG C are incubated overnight, next day, and TBST low speed shaking table washs 3 times, each 10min；
2. HRP marks goat anti-rabbit igg to be diluted with 50g/L skimmed milk power 1:1000 and drops evenly on pvdf membrane, room temperature
It is incubated for 2h, TBST low speed shaking table washs 3 times, each 10min；
TBST is done 3. falling, each 1mL of luminescent solution A, B is mixed, and is dropped evenly on film in darkroom, and 3s~4min is exposed；
4. being put into 30s or more in developer solution, places into cleaning solution and clean；It is placed in fixing solution, until egative film transparence, then wash
It washs clean.
Testing result is as shown in Figure 7.
5 expression of embodiment/influence of the interference zfp57 to embryonic development
It is nucleome with normal cell strain (control clone's group), zfp57 transgenosis cell strain (ZFP57 clone group), it is thin does body
Karyon transplanting, obtains the bovine somatic cells clone embryos of early development；Made in two batches of Niu Jingzi and egg mother cell it is in vitro fertilization, one
It criticizes and (is injected with the control siRNA for not interfering with effect to zfp57 gene) for control IVF group, another batch of egg mother cell is used
Zfp57siRNA interferes small fragment ZFP57-1580 injection, obtains IVF Embryos (interference ZFP57-IVF group)；As a result as schemed
Shown in 8.
Wherein, zfp57siRNA interferes the sequence of small fragment ZFP57-1580 as follows:
ZFP57-1580:GCAGAAGAAAGAAAGCAAAGG；SEQ ID NO.6.
Such as table 1, the cleavage rates of ZFP57-IVF group embryo are interfered to be substantially less than other three groups (P < 0.05), other three groups of embryos
Tire cleavage rates difference is not significant.The 7th day blastocyst rate of interference ZFP57-IVF group also significantly lower than control IVF group blastocyst rate (P <
0.05), and ZFP57 clone organizes the 7th day cloned blastocysts developmental rate and is significantly higher than control clone's group (P < 0.05).Inducing expression
ZFP57 is remarkably improved the developmental rate (P < 0.05) of the 7th day cloned blastocysts, and IVF group difference is not significant with compareing.
1 expression of table/influence of the interference zfp57 to embryonic development
Note: being embryo development rate (average value ± standard error %) in bracket, other numbers are ten duplicate egg mother cells
Or total number of embryos.Cleavage rates and blastocyst rate are the embryo development rate that statistics is developed second day and the 7th day respectively.With subscript in organizing
Difference display significant difference (P < 0.05).
In order to study whether inducing expression zfp57 can improve development and birth rate in ox clone embryos body,
Control clone group and ZFP57 clone are organized into the 7th day blastaea transplant recipient cow, transplanted respectively 62 and 78 times
Recipient cattle.The results are shown in Table 2,40d after clone embryo transplantation, and two groups of pregnancy rate differences are not significant.But since 90d,
The pregnancy rate that ZFP57 clone organizes embryo is significantly higher than control clone's group (P < 0.05).Control group has 2 calves to survive, and ZFP57
Clone's group has 8 survivals (P < 0.05).The result shows that inducing expression zfp57 significantly improves bovine somatic cells cloning efficiency.
2 inducing expression zfp57 of table improves bovine somatic cells cloning efficiency
Note: 7d blastaea transplants the recipient cattle of estrus synchronization, and every recipient cattle transplants one piece of embryo.
a,b(P < 0.05) is the same as mutual significant difference between the expression of column data subscript difference.
6 expression of embodiment/influence of the interference zfp57 to ox embryonic blastula quality
The present invention analyze each group blastaea embryonic cell sum, TE cell number, ICM cell number and ICM cell number and
The ratio (ICM/TCN) of blastaea sum.(table 3) as the result is shown, the embryonic cell sum of interference the 7th day blastaea of ZFP57-IVF group,
TE cell number, ICM cell number and ICM cell number and the ratio (ICM/TCN) of blastaea sum substantially lower than compare IVF group embryo
Tire (P < 0.05), and ZFP57 clone organize the embryonic cell sums of the 7th day cloned blastocysts, TE cell number, ICM cell number and
ICM cell number and the ratio (ICM/TCN) of blastaea sum are all significantly higher than control clone and organize embryo (P < 0.05).
Table 3 is different to organize blastaea analysis in the 7th day
Note: blastomere sum passes through immune dye by analyzing all nucleus on the embryo that DAPI is dyed, TE cell number
Color CDX2 analysis, ICM cell number=blastomere sum-TE cell number.Data are indicated with average value ± standard error.
A, b, c subscript difference indicate sample room significant difference (P < 0.05).
Apoptosis rate is another standard for assessing embryo quality.Each group blastaea is subjected to apoptosis dyeing, as a result such as Fig. 9 institute
Show, counts the apoptosis rate of various blastaeas.Interference ZFP57-IVF group and control clone organize the apoptosis rate of the 7th day blastaea
It is significantly higher than control group and ZFP57 clone group (P < 0.05) in vitro fertilization.
7 expression of embodiment/influence of the interference zfp57 to cattle early embryo imprinted genes methylation level
Analyze methylation level of the area ICR of imprinted genes XIST, H19/IGF2 and IGF2R on each group embryo.With
For H19/IGF2ICR, the survey region of selection must be positioned at the area ICR in methylation differential area, and the region will be contained
The specific recognition sites " TGCCGC " of KAP1/ZFP57 protein complexes.With MethPrimer online software to H19 and IGF2 base
Sequence because between carries out the prediction of the island CpG, finds there are 4 islands CpG (Figure 10) in the range of the about 2.5kb-4kb of the upstream H19, the
There is the CTCF recognition site (red overstriking mark in Figure 11) on ICR on four islands CpG, are the area ICR.Contain KAP1/ZFP57 in this area
Protein complexes specific recognition sites " TGCCGC " (blue overstriking mark in Figure 11).With MethPrimer and methyl
Primer express software_v1.0 (ABI, the U.S.) software design is used for the specific primer of BS-PCR.By this ICR
Research segment of the 426bp in region as H19/IGF2ICR in the present invention, this segment include 23 sites CpG.Primer sequence
Are as follows:
F:5'-GGAGTTTGGGTGAGGTATAGTTTTAG-3'；SEQ ID NO.7；
R:5'-CCAAACATAAAAATCCCTCATTATC-3'；SEQ ID NO.8.
H19/IGF2ICR is exhaustive methylation modification on sperm, and almost without methylation modification on egg mother cell.
Embryo's (SCNT-C) methylation level, which is organized, in the control clone of 2 cell stages and blastula stage is substantially less than control IVF group embryo (IVF-
C), illustrate that H19/IGF2ICR has trace loss.Interfere ZFP57-IVF group (IVF-T) 2 cell stage embryo H19/
IGF2ICR methylation level, which is substantially less than, compares IVF group embryo (IVF-C) (P < 0.05).Inducing expression zfp57 clone's group
(SCNT-T) the DNA methylation level of the H19/IGF2ICR of embryo is significantly higher than control clone's group embryo (SCNT- in blastula stage
C) (P < 0.05), methylation level with to compare IVF group embryo's difference not significant, as shown in figure 12.
XIST is modified on sperm almost without methylation, and has superelevation methylation modification on egg mother cell.XIST is 4
The control clone of cell stage and blastula stage organize embryo's (SCNT-C) methylation level and are substantially less than control IVF group embryo (IVF-C),
Illustrate that XIST has trace loss.Interfere ZFP57-IVF group (IVF-T) in the methylation water of 4 cell stage embryo of XIST
It is flat to be substantially less than control IVF group embryo (IVF-C) (P < 0.05).The XIST of inducing expression zfp57 clone group (SCNT-T) embryo
DNA methylation level 4 cell stages and blastula stage be significantly higher than control clone organize embryo (SCNT-C) (P < 0.05), methylation
It is horizontal with to compare IVF group embryo's difference not significant, as shown in figure 13.Result of study illustrate inducing expression zfp57 can correct gram
Abnormal methylation, which methylates, on grand embryo loses.
As XIST, IGF 2R ICR is modified on sperm almost without methylation, and on egg mother cell is super first
Base；Methylation level of the IGF 2R ICR on 4 cell stage clone embryos (SCNT-C) is substantially lower than IVF Embryos
(IVF-C), illustrating IGF 2R ICR, there is also different degrees of demethylation phenomenons on ox clone embryos；Interfere ZFP57-
IVF group 4 cell stage embryo (IVF-T) IGF 2R ICR methylation level, which is substantially less than, compares IVF group embryo (P < 0.05), and lures
The DNA methylation level for leading the IGF 2R ICR that expression zfp57 clone organizes embryo (SCNT-T) is all aobvious in 4 cell stages and blastula stage
It writes and is higher than control clone's group embryo (SCNT-C) (P < 0.05), methylation level is not shown in vitro fertilization group of embryo's difference is compareed
It writes, as shown in figure 14.
The foregoing description of the disclosed embodiments enables those skilled in the art to implement or use the present invention.
Various modifications to these embodiments will be readily apparent to those skilled in the art, as defined herein
General Principle can be realized in other embodiments without departing from the spirit or scope of the present invention.Therefore, of the invention
It is not intended to be limited to the embodiments shown herein, and is to fit to and the principles and novel features disclosed herein phase one
The widest scope of cause.
Sequence table
<110>Xibei Univ. of Agricultural & Forest Science & Technology Xining animal and veterinary station
<120>a kind of method that bovine somatic cells cloning efficiency is improved by inducing expression zfp57
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1683
<212> DNA
<213> Artificial Sequence
<400> 1
atggagccta gtcacccttg gtggccagac caggcatgga taaagcttaa aagagacagc 60
atggaagaga aggtgtctga ccagccaaag ccagtggaac ctgtacagaa gctgctccct 120
caggtggacg aggagggtct gccgaaagcc tggaagggag agtgctggtg gaaggagtgg 180
gtgaagaagc cagtcacctt tgaggatgtg gcagtaaact tcacccagga agagtggaaa 240
tgtctagatg tcagtcagag ggtcctctac caggatgtta tatcagagac tgtcagaaac 300
ctgatgtctg tggatctgat cgccaagctt gagcaagaag agaaacagtg ggaagcagat 360
ctctgttccc cgaatggaga aggctttcat tcaggaggca aggaggaaag ccaagaacag 420
agtcagagtt tgggagatga ggggactgtt gatgacaaga aggcctccct tgctcacaga 480
ggcttgggcc caacctctcc tccagctggg tccccggaca agacgccaac attgccagaa 540
tcctgggctc ggccagcctt tacctgtcac acctgtggca agtgcttcag caagcgctcc 600
agcctctaca accatcagct tgttcacaac agcgcccagt gtgggaagtc cttccagaac 660
cccaaggacc tcagctccgg ccggcgcaag caacccaggg aaaggccctt ccgctgctcg 720
ctctgtggca agacctactg cgatgcttct ggactgagcc gtcaccgccg tgtccatctg 780
ggctaccggc cccatgcgtg ccctttctgt gggaagtgct tcagggacca gtctgagctc 840
aaacgccacc agaagacgca ccaaggccag aagctggggg ctggaaacca gaagcatatt 900
gtgaggactc cggataccag agctggatta cagggcctgg caacagggaa ccatgcagca 960
gtggctgtga cccaaggacc cacacttaaa accaagggtc ccaagactca gccccagccg 1020
tcaatagaca ggaaccaggt acctgccacc aagaacatgg taatcactgt gagagctcag 1080
gccccagagc ctgtgaccag gaccccagcc ccagagcctg tgaccaggac cccagcccca 1140
gagcctgtga ccaggaccct ggcagccaac atgcgagcta ctcgcctgaa caccaagtcc 1200
aactctcacc cagagaagcc ttcaagactc aaggtcttct cttgccctca ttgtccctta 1260
acttttagca ggaaaacccg tctctccagt catcagaagg tccactacac agagcagtcc 1320
aaccgctgct tccactgtgg caagtccttc actttattct ccgggctgat ccggcaccag 1380
cagactcact ggaagcagag ggtctactgt tgccctatat gcgacgtctg ctttggggag 1440
aaagaggacc ttttgggtca ctgggggggc tacagaagca aggggctatt cctgggcagt 1500
ccccacaagt gctgggccat cctgggtcag tggcttggct tctttcccaa tgcctctgct 1560
gtggcaggga aggaaatgga tctttctcct ggatccagac cctcaggaaa ggggaggaag 1620
ggagaggaaa aggcacgcag aagaaagaaa gcaaaggcaa tgaaggtctt agaagggaaa 1680
tga 1683
<210> 2
<211> 31
<212> DNA
<213> Artificial Sequence
<400> 2
gccaccatgg agcctagtca cccttggtgg c 31
<210> 3
<211> 52
<212> DNA
<213> Artificial Sequence
<400> 3
tcacttatcg tcgtcatcct tgtaatcttt cccttctaag accttcattg cc 52
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 4
gaaacagtgg gaagcggatc 20
<210> 5
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 5
acagtcccct catctccca 19
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 6
gcagaagaaa gaaagcaaag g 21
<210> 7
<211> 26
<212> DNA
<213> Artificial Sequence
<400> 7
ggagtttggg tgaggtatag ttttag 26
<210> 8
<211> 25
<212> DNA
<213> Artificial Sequence
<400> 8
ccaaacataa aaatccctca ttatc 25
Claims (5)
1. a kind of method for improving bovine somatic cells cloning efficiency, which is characterized in that the method passes through inducing expression zfp57 gene
So that the imprinted genes in ox clone embryos growth course is methylated and restore normal level, to improve bovine somatic cells cloning efficiency.
2. a kind of method for improving bovine somatic cells cloning efficiency according to claim 1, which is characterized in that the method is logical
Cross following steps realization:
(1) zfp57 expression vector is constructed
1. zfp57 gene cloning:
According to the CDS sequence design amplimer Zfp57-KZ of zfp57 gene；Using tire bovine fibroblasts cDNA as template,
Zfp57-KZ is primer, and PCR amplification obtains zfp57 gene；
2. constructing zfp57 expression vector:
Zfp57 gene connects pMD-18T carrier, obtains plasmid pMD-18T-zfp57；By plasmid pMD-18T-zfp57 and
PTRE3G-BI carries out double digestion respectively, connects, and conversion obtains expression vector pTRE3G-BI-zfp57；
(2) transgenosis cell strain is established
1. expression vector pTRE3G-BI-zfp57 and assistant carrier cotransfection tire bovine fibroblasts are screened monoclonal cell；
2. the monoclonal cell to acquisition carries out PCR, real-time fluorescence quantitative PCR and immune-blotting method；
(3) influence of detection expression zfp57 gene pairs ox embryonic development；
(4) influence of detection expression zfp57 gene pairs ox embryonic blastula quality；
(5) influence of detection expression zfp57 gene pairs cattle early embryo imprinted genes methylation level.
3. a kind of method for improving bovine somatic cells cloning efficiency according to claim 2, which is characterized in that the amplification is drawn
The primer sequence of object Zfp57-KZ is as follows:
Zfp57-KZ-F:GCCACCATGGAGCCTAGTCACCCTTGGTGGC；SEQ ID NO.2；
Zfp57-KZ-R:TCACTTATCGTCGTCATCCTTGTAATCTTTCCCTTCTAAGACCTTCATTGCC；SEQ ID
NO.3；
Wherein, Kozak sequence is added in upstream primer, and Flag sequence is added in downstream primer.
4. a kind of method for improving bovine somatic cells cloning efficiency according to claim 2, which is characterized in that the auxiliary carries
Body is pEF1 α-Tet3G.
5.zfp57 gene is improving the application in bovine somatic cells cloning efficiency.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910013384 | 2019-01-07 | ||
| CN2019100133843 | 2019-01-07 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110042123A true CN110042123A (en) | 2019-07-23 |
| CN110042123B CN110042123B (en) | 2023-01-17 |
Family
ID=67277548
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910307633.XA Active CN110042123B (en) | 2019-01-07 | 2019-04-17 | Method for improving bovine somatic cell cloning efficiency through induction expression of zfp57 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110042123B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114214270A (en) * | 2021-12-17 | 2022-03-22 | 中国农业科学院北京畜牧兽医研究所 | Method for regulating and controlling developmental capacity of frozen bovine oocyte and application thereof |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110071033A1 (en) * | 2009-09-23 | 2011-03-24 | Celmatix, Inc. | Methods and devices for assessing infertility and/or egg quality |
| CN104284903A (en) * | 2012-01-31 | 2015-01-14 | Sbi生物技术有限公司 | Anti-phospholipase D4 antibody |
| CN105524940A (en) * | 2015-12-31 | 2016-04-27 | 西北农林科技大学 | Vector, cell and method for improving bovine cloning efficiency on the basis of histone methylation modifying level |
| WO2017024311A1 (en) * | 2015-08-06 | 2017-02-09 | The University Of Utah Research Foundation | Methods of identifying male fertility status and embryo quality |
| CN107299113A (en) * | 2017-06-12 | 2017-10-27 | 内蒙古大学 | Application processes of the H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo |
| CN107988257A (en) * | 2017-12-12 | 2018-05-04 | 西北农林科技大学 | Carrier, cell and the method for goat cloning efficiency are improved based on the horizontal modification of donorcells DNA methylation |
| CN108410894A (en) * | 2018-03-07 | 2018-08-17 | 西北农林科技大学 | A kind of carrier and method improving ox cloning efficiency based on histone methylated horizontal modification |
| CN108715869A (en) * | 2018-06-01 | 2018-10-30 | 华南农业大学 | A method of improving cloning of mammalian animal efficiency based on specific donorcells are obtained |
| CN113801851A (en) * | 2020-06-17 | 2021-12-17 | 中国科学院动物研究所 | Somatic cell nuclear transplantation method and application thereof |
-
2019
- 2019-04-17 CN CN201910307633.XA patent/CN110042123B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110071033A1 (en) * | 2009-09-23 | 2011-03-24 | Celmatix, Inc. | Methods and devices for assessing infertility and/or egg quality |
| CN104284903A (en) * | 2012-01-31 | 2015-01-14 | Sbi生物技术有限公司 | Anti-phospholipase D4 antibody |
| WO2017024311A1 (en) * | 2015-08-06 | 2017-02-09 | The University Of Utah Research Foundation | Methods of identifying male fertility status and embryo quality |
| CN105524940A (en) * | 2015-12-31 | 2016-04-27 | 西北农林科技大学 | Vector, cell and method for improving bovine cloning efficiency on the basis of histone methylation modifying level |
| CN107299113A (en) * | 2017-06-12 | 2017-10-27 | 内蒙古大学 | Application processes of the H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo |
| CN107988257A (en) * | 2017-12-12 | 2018-05-04 | 西北农林科技大学 | Carrier, cell and the method for goat cloning efficiency are improved based on the horizontal modification of donorcells DNA methylation |
| CN108410894A (en) * | 2018-03-07 | 2018-08-17 | 西北农林科技大学 | A kind of carrier and method improving ox cloning efficiency based on histone methylated horizontal modification |
| CN108715869A (en) * | 2018-06-01 | 2018-10-30 | 华南农业大学 | A method of improving cloning of mammalian animal efficiency based on specific donorcells are obtained |
| CN113801851A (en) * | 2020-06-17 | 2021-12-17 | 中国科学院动物研究所 | Somatic cell nuclear transplantation method and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| HONGLIANG LIU 等: "Potential Roles of Intrinsic Disorder in Maternal-Effect Proteins Involved in the Maintenance of DNA Methylation", 《INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES》 * |
| LI XIAJUN: "A Maternal-Zygotic Effect Gene,Zfp57, Maintains Both Maternal and Paternal Imprints", 《DEVELOPMENT CELL》 * |
| 安全利 等: "ZPF57对牛早期克隆胚胎发育及印迹基因甲基化的影响", 《中国畜牧兽医学会2017学会论文集》 * |
| 张美玲等: "哺乳动物基因组印记的保护与维持", 《中国细胞生物学学报》 * |
| 苏建民 等: "基因组印迹的调控机制及其对动物克隆的影响", 《自然科学进展》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114214270A (en) * | 2021-12-17 | 2022-03-22 | 中国农业科学院北京畜牧兽医研究所 | Method for regulating and controlling developmental capacity of frozen bovine oocyte and application thereof |
| CN114214270B (en) * | 2021-12-17 | 2023-11-24 | 中国农业科学院北京畜牧兽医研究所 | Method for regulating and controlling developmental capacity of frozen bovine oocytes and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110042123B (en) | 2023-01-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104004708B (en) | The separation and purification of a kind of sheep stem spermatogonium, the long-term cultivation that goes down to posterity, frozen and recovery method | |
| JP2008501356A5 (en) | ||
| JP2005151907A5 (en) | ||
| CN108642054A (en) | Reduce immunogenicity sgRNA, low immunogenicity dressing and preparation method thereof | |
| US11180763B2 (en) | CRISPR/Cas9 vector combination and application thereof in gene knockout | |
| JP2003517261A (en) | Production of avian embryonic germ (EG) cell lines by long-term culture of PGCs, their use for cloning and chimera formation | |
| CN105112446A (en) | Method for high-efficiency establishment of genetically modified animal model through haploid stem cells | |
| CN111926037A (en) | Plasmid for knocking out MSTN gene by using double sgRNA technology and method for knocking out MSTN gene | |
| CN103993027B (en) | A kind of method that transgene pig riddled basins are knocked out | |
| CN102453716A (en) | Clone and application of pig skeletal muscle specificity expression gene alpha-actin promoters | |
| CN101705247B (en) | Method for transfecting bovine somatic cells into inducted pluripotent stem cells by adopting transcription factors | |
| CN110042123A (en) | A method of bovine somatic cells cloning efficiency is improved by inducing expression zfp57 | |
| CN103695466B (en) | The carrier of the reversible immortalization of a kind of induced animal cell in vitro and application thereof | |
| CN101705248B (en) | Method for transfecting bovine somatic cells into inducted pluripotent stem cells by adopting transcription factors | |
| CN104830752B (en) | A kind of unicellular cultural method of porcine fetus fibroblasts | |
| CN106978416A (en) | A kind of assignment of genes gene mapping integrant expression system and its application | |
| CN104726490A (en) | Targeting carrier expressing human serum albumin and construction method thereof | |
| CN109055379A (en) | A kind of preparation method of transgenic chicken oviduct bioreactor | |
| CN104212837A (en) | Lentiviral vector for expression of human serum albumin and construction method thereof | |
| CN108660112A (en) | A kind of cultural method of mesenchymal stem cell and transgenic mice | |
| CN109750000A (en) | Novel animal cell line R6-MEFs method and purposes are prepared using XistTale inhibition transcription factor R6 | |
| CN110628818B (en) | Preparation method and application of fish skin mucous gland bioreactor | |
| CN101993895A (en) | Construction and application method of efficient double promoter PLEGFP-N1-spMyoD1 green fluorescence retrovirus vector | |
| CN101412999A (en) | A kind of gene targeting locus-specific transgenic method and application thereof | |
| CN113502289A (en) | Cell strain for knocking out human normal hepatocyte GSTZ1 gene, preparation method and specific sgRNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |