Summary of the invention
Building to the domestic animal stem cell is that a middle above-mentioned prior art difficult problem that exists is with not enough; The object of the present invention is to provide the method for a kind of acquisition inductive pluripotent stem cells (iPSCs); With this method obtain cell at cell colony form, growth characteristics, stem cell surface mark, express dryness gene, main dryness gene promoter sequence zone methylation patterns, embryoid forms and vitro differentiation ability, teratoma form ability, and it is all closely similar with the embryonic stem cell characteristic to participate in eight aspects such as mosaic formation.
Realize that foregoing invention purpose technical scheme is a kind of method of utilizing the transcription factor transfecting bovine somatic cells to produce inductive pluripotent stem cells, it is characterized in that, comprise the steps:
1) fibroblastic separation of ox-hide skin and cultivation
Ox-hide skin inoblast (BDFs) and new born bovine SF (NDFs) obtain a large amount of adult ox-hide skin inoblast and new born bovine SF respectively through conventional the cultivation to grow up;
2) ox is kept the clone and the Expressed by Retrovirus Vector thereof of versatility transcription factor gene
From 50-60 age in days ox fetus, separate sex-ridge, extract total RNA, obtain cDNA through reverse transcription reaction; With cDNA is template; Reaction obtains ox Oct4, Sox2, c-Myc and four gene amplification products of Klf4 and correctly then goal gene is inserted among the retroviral vector pMSCVneo through the sequence verification sequence through PCR, makes up the retrovirus expression vector of these 4 kinds of genes;
3) retroviral packing and preparation
Using preceding 1 hour of liposome packaging virus particle; The nutrient solution DMEM substratum of packing cell PT67 changes serum-free medium into; Retroviral plasmid DNA and 10-20 μ l liposome that 4-8 μ g includes transcription factor gene join 2 part of 500 μ l Opti-MEM-I+GlutaMAX-I respectively and optimize in the transfection liquid soft mixing, incubated at room; Then with the DNA and the soft mixing of liposome that dilute; Incubated at room after 20 minutes, dropwise adds the plasmid-lipidosome mixed solution in the PT67 Tissue Culture Dish again.
The PT67 packing cell is cultivated in containing the DMEM substratum of 15% foetal calf serum according to ordinary method, used liposome the retrovirus transfection that makes up is got into packing cell PT67 cell; 8 μ g are contained the heterogeneic retrovirus expression vector plasmid of Oct4, Sox2, c-Myc and Klf4 and 4 part of 20 μ l transfection reagent liposome lipofectamine2000 to be optimized liquid with two part of 500 μ lOpti-MEM-I+GlutaMAX-I transfection respectively and dilutes; Mixing gently; Hatched under the room temperature 5 minutes; The diluent that will contain liposome lipofectamine2000 then slowly splashes in the diluent that contains retroviral plasmid; Mixing gently, hatch 20 minutes again under the room temperature after, above-mentioned mixed solution is dropwise added in the PT67 packing born of the same parents petridish; After the transfection 24 hours, changed in per 24 hours contain retroviral particle nutrient solution once, collect viral suspension for three days on end, under 4 ℃ of conditions through 25000 rev/mins after centrifugal 90 minutes, 10 times of concentrating virus supernatants; To include Oct4, Sox2, c-Myc and Klf4 gene viruses supernatant and carry out balanced mix, and add the specific four factor genes combination of 8 μ g/ml Polybrene composition ,-80 ℃ of preservations are subsequent use;
4) acquisition of the iPS cell of retroviral infection ox-hide skin inoblast and ox
To grow up ox-hide skin inoblast BDFs and newborn bull SF NDFs cultivates in the 60mm plastic culture dish according to ordinary method; Treat that cell grows into the about 5ml of retrovirus supernatant mixed solution mixed solution that will comprise Oct4, Sox2, c-Myc and Klf4 gene transcription factor when 70-80% merges in the petridish, join respectively in inoblast BDFs and the NDFs petridish and infect inoblast; Cell goes down to posterity by 1: 3 routine after covering with petridish, visual cell's growing state at 6-10d with cell with 1 * 10
5The density of cells/well is transferred to and is covered with in advance on people's amnion (HAM) 6 well culture plates, and the personnel selection amnion replaces MEC to cultivate metainfective ox cell as feeder layer, and nutrient solution is replaced with the stem cell nutrient solution simultaneously; Measure and change liquid every day half in the culture hole, observes 20-28d continuously, till having cell colony to occur, was designated as for 0 generation, is ox iPSCs.
Consisting of of described stem cell nutrient solution: contain in every 100ml solution: the knockout-DMEM of 82.69ml, 15ml FBS, 1ml concentration are that 200mM Stimulina, 1ml concentration are that 10mM non-essential amino acid, 200 μ l concentration are that 55mM beta-mercaptoethanol, 10 μ l concentration are that 400ng/mL people's recombination basic fibroblast growth factor (bFGF), 100 μ l concentration are 10
5U/mL LIF (LIF).
When ox iPSCs goes down to posterity, use the digestion of 0.05%trypsin+0.02%EDTA Digestive system, through neutralization, centrifugal and resuspended being passaged to again on the new HAM upholder, at 37-38 ℃, 5% left and right sides C0
2, amplification cultivation under the saturated humidity condition obtains ox iPS cell strain.Ox iPSCs is every to go down to posterity once at a distance from 3-5 days, went down to posterity at present 120 days, surpassed for 25 generations.Liquid nitrogen cryopreservation, the back growth vigor that thaws is better, and the 80%-90% survival rate is arranged approximately.
The recombinant retroviral expression vector pMSCV-c-Myc that a further object of the invention provides the c-Myc gene reaches in gene-based because of application in engineering.
The recombinant retroviral expression vector pMSCV-Klf4 that a further object of the invention provides the Klf4 gene reaches in gene-based because of application in engineering.
The present invention obtains inductive pluripotent stem cells and its preparation method compared with prior art, has the following advantages:
1, among the present invention 4 of application autonomous clened cows kinds keep stem cell versatility key gene; Utilize the several genes array mode; Lead entering ox-hide skin inoblast through the stem cell retrovirus-mediated method, make its reprogrammed for having the inductive pluripotent property stem cell of embryonic stem cell biological nature fully.Many strains multi-functional stem cell of setting up through this method surpassed for 25 generations external having gone down to posterity, and growth characteristics are all acted normally.Frozen and thawing test shows that they still have good versatility.
2, the present invention adopts first in culture condition and takes off cell people amnion (HAM) and replace MEC (MEF) to keep ox iPSCs in-vitro multiplication as upholder and keep undifferentiated versatility state for a long time, and has avoided using the heterogenous animal cell contamination problem that feeder layer brought of MEC as stem cell.
3, the present invention adopts the method for gene induced generation multipotent stem cells, has solved the particularly ox multipotent stem cells technical barrier that is difficult to obtain of domestic animal, and to build for other stem cell animals be that theoretical foundation and experiment basis are provided.
Embodiment
Below the acquisition ox iPSCs that provides through the applicant concrete grammar and all have and the embryonic stem cell similar biological aspect many in colony form, growth characteristics, stem cell surface sign, inside and outside differentiation capability and mosaic formation etc. through multiple evidence ox iPSCs.
Embodiment fibroblastic separation of 1 ox-hide skin and cultivation
Growing up, (female bovine dermal fibroblasts BDFs) separates from the female Holstein milk the ears of an ox or cow edge skin of growing up ox-hide skin inoblast.Be cut into the fine tissue piece after will organizing cleaning and sterilizing, under conventional culture condition, with cultivating among the high sugared DMEM (Gibco Company products) that contains 15%-20% foetal calf serum (FBS) (Gibco Company products).Every 2-3d changes and supports liquid 1 time, just has inoblast to shift out from the tissue block edge behind the 7-10d, and a large amount of inoblasts closely are arranged in around the tissue block behind the 12-16d.With going down to posterity after trypsinase and the digestion of EDTA mixture slaking liquid liquid, promptly obtain a large amount of adult ox-hide skin inoblasts, see Fig. 1.(male newborn bovine dermalfibroblasts NDFs) from the newborn bull ear of Holstein kind edge skin, sees Fig. 2 to newborn bull SF, and separation is identical with above-mentioned cow SF method with cultural method.In order to guarantee cell viability, the present invention adopt 2~6 generations with interior cell as inducing preceding target cell.
2 Ns of clone and Expressed by Retrovirus Vector thereof of keeping versatility key gene transcription factor of embodiment
In the fetus body of 50-60 age in days He Sitan (Holstein) kind milk cow, separate sex-ridge, extract total RNA with TRIzol LS Reagent behind the tissue homogenate, handle to remove genomic dna through DNaseI (RNase free) and pollute.Obtain cDNA through reverse transcription reaction.Be template then with cDNA, through open frame (ORF) complete sequence of reading of 4 kinds of transcription factor genes such as pcr amplification Oct4, Sox2, c-Myc and Klf4, gene clone the primer sequence is seen shown in the table 1 respectively.
Table 1 amplification ox Oct4, Sox2, c-Myc and four gene the primers of Klf4 information
Loop parameter was when wherein the Oct4 gene PCR increased: 94 ℃ of preparatory sex change 5min, and 94 ℃ of sex change 45sec, 60 ℃ of annealing 45sec, 72 ℃ are extended 1min, circulate 35 times, and 72 ℃ are extended 10min again, and expection PCR product length should be 1083bp.
The loop parameter of Sox2 gene is: 94 ℃ of preparatory sex change 5min, and 94 ℃ of sex change 45sec, 54 ℃ of annealing 30sec, 72 ℃ are extended 1min, circulate 35 times, and 72 ℃ are extended 10min again, and expection PCR product length should be 963bp.
The loop parameter of c-Myc gene is: 94 ℃ of preparatory sex change 4min, and 94 ℃ become 30s, 54 ℃ of annealing 1min, 72 ℃ are extended 1min30sec, totally 30 circulations, 72 ℃ are extended 10min again, and expection PCR product length should be 1320bp.
The loop parameter of Klf4 gene is: 94 ℃ of preparatory sex change 4min, and 94 ℃ become 30s, 60 ℃ of annealing 1min, 72 ℃ are extended 1min30sec, totally 30 circulations, 72 ℃ are extended 10min again, and expection PCR product length should be 1434bp.
Above-mentioned PCR product is respectively got 5 μ l, to identify its size, remains ℃ preservation of PCR product-20 at 1% agarose gel electrophoresis.Electrophoresis detection result shows that 4 kinds of transcription factor gene sizes of pcr amplification product length and expection milk cow are in full accord, the Pass Test design requirements.Then 4 kinds of PCR product remainders are passed through dna fragmentation Gel Extraction kit purifying, recovery respectively; Reclaim product and be connected with solution I mixing with cloning vector pMD18-T, 16 ℃ of connections are spent the night.To connect product is transformed in the competent cell TGI and clones.Through the LB that contains Ampicillin (80 μ g/ml), X-gal and IPTG dull and stereotyped last 37 ℃ of screening and culturing 14-16 hours.Picking 6-10 white colony inoculated and shaken bacterium in the LB nutrient solution that contains penbritin (Ampicillin) in a small amount respectively from 4 kinds of cultures, and according to plasmid extraction test kit specification sheets step extracting trace plasmid.Comprise Oct4, Sox2, c-Myc, the plasmid of 4 kinds of genes such as Klf4 is identified through double digestion, single endonuclease digestion and plasmid PCR.Four kinds of plasmids are through Bgl II+EcoRI double digestion and EcoRI single endonuclease digestion and plasmid PCR evaluation, to obtain the positive colony of pMD-18T-Oct4, pMD-18T-Sox2, pMD-18T-cMyc, four kinds of plasmids of pMD-18T-Klf4.Selecting and recommending the positive plasmid of qualification result checks order to biotech firm.Reference sequences carries out the homology comparative analysis among sequencing result Application of DNA start 7.10 softwares and the GenBank.Analytical results shows, Oct4, and Sox2, c-Myc and Klf4 gene order and reference sequences homology are respectively 99.4%, 99.6%, and 99.4% and 99.3%.
The pMD-18T-Oct4 that above-mentioned order-checking is correct; PMD-18T-Sox2; PMD-18T-cMyc, pMD-18T-Klf4,4 kinds of plasmids reclaim behind the purifying with retrovirus pMSCVneo carrier and pass through target gene fragment and linearizing pMSCVneo carrier behind the BglII+EcoRI double digestion respectively.Retrovirus vector pMSCVneo after the linearizing is connected at 16 ℃ with DNA Ligation Kit Version2.0 with the purpose fragment of recovery spends the night; After 14-16 hour; Connect product and be transformed into the JM109 competent cell; Through filtering out the positive colony of retroviral plasmid on penbritin (Ampicillin, 50 μ g/mL) the LB flat board.From 4 culture plates, each recombinant plasmid picking 6-10 bacterium colony respectively shakes bacterium in a small amount, and micro-method is extracted the retroviral plasmid of reorganization.Identify and the sequencing analysis evaluation through the two enzymic digestion evaluations of BglII+EcoRI (perhaps BglII+HapI), plasmid pcr amplification.4 kinds of recombinant retrovirus plasmids can obtain the target gene fragment and the retroviral vector fragment of known dimensions through behind the double digestion, explain that our constructed recombinant retroviral expression vector structure is correct.Detect through order-checking; The sequence and the pcr amplification sequence of 4 goal gene that comprised in all recombinant retrovirus plasmids are in full accord; Also with GenBank in reference sequences in full accord; Be illustrated in this patent goal gene in constructed 4 kinds of recombinant retrovirus plasmid processes and do not read the situation such as frameshit and base mutation of frame, explain that applied 4 kinds of gene orders are entirely true.4 kinds of constructed in this patent recombinant retroviral expression vectors are distinguished called after: pMSCV-Oct4, pMSCV-Sox2, pMSCV-cMyc and pMS CV-Klf4.
Embodiment 3 retroviral packing and preparations
The PT67 packing cell is cultivated in the DMEM substratum according to ordinary method; When treating that cell reaches 70%-80% and converges; Use liposome the retrovirus transfection is got into packing cell PT67 cell, carry out the virus packing to obtain to have infectious retroviral particle.Preceding 1 hour of transfection; The DMEM substratum changes serum-free medium into, and 4-8 μ g retroviral plasmid DNA and 10-20 μ l liposome join 500 μ l Opti-MEM-I+GlutaMAX-I (Gibco Company products) respectively optimizes in the transfection liquid soft mixing; Incubated at room; With the DNA and the soft mixing of liposome of dilution, incubated at room dropwise added mixed solution in the PT67 Tissue Culture Dish after 20 minutes more then.Cell is at 37 ℃, 5%CO
2After cultivating 4-6h under the saturated humidity condition, transfection liquid changes the new DMEM nutrient solution that contains 15%FBS into.After transfection in 24 hours, collect PT67 cell culture fluid supernatant, just comprise infectious retroviral particle in this supernatant.Supernatant is through the membrane filtration in 0.45 μ m aperture.Collected once, and collected 3d continuously in per 24 hours.Viral suspension under 4 ℃ of conditions, through 25,000 rev/mins, centrifugal 90 minutes, 10 times of concentrating virus supernatants.Oct4, Sox2, c-Myc and four kinds of gene viruses supernatants of Klf4 are carried out balanced mix, and add 8 μ g/ml polybrene and form specific four factor genes combination, transfection ox-hide skin inoblast is prepared in-80 ℃ of preservations.
The acquisition of the iPS cell of embodiment 4 retroviral infection ox-hide skin inoblasts and ox and going down to posterity
To grow up ox-hide skin inoblast (BDFs) and newborn bull SF (NDFs) cultivated according to ordinary method and in the 60mm plastic culture dish, inoculated 2 * 10
5Individual cell; When treating that cell grows into the 70-80% fusion in the petridish, the retrovirus supernatant mixed solution that will comprise Oct4, Sox2, c-Myc and Klf4 gene transcription factor joins respectively in inoblast BDFs and the NDFs petridish and infects inoblast; Cell goes down to posterity by 1: 3 routine after covering with petridish, visual cell's growing state at 6-10d with cell with 1 * 10
5The density of cells/well is transferred to and is covered with in advance on people's amnion 6 well culture plates, replaces MEF to cultivate metainfective ox cell as feeder layer with HAM, and nutrient solution is replaced with the stem cell nutrient solution simultaneously; Measure and change liquid every day half in the culture hole, observes 20-28d continuously, till having ES cell appearance colony to occur, was designated as for 0 generation, is ox iPSCs.
When ox iPSCs goes down to posterity, use the digestion of 0.05%trypsin+0.02%EDTA Digestive system, through neutralization, centrifugal and resuspended being passaged to again on the new HAM upholder, at 37-38 ℃, 5% left and right sides CO
2, amplification cultivation under the saturated humidity condition obtains ox iPS cell strain.Ox iPSCs is every to go down to posterity once at a distance from 3-5 days, went down to posterity at present 120 days, surpassed for 25 generations.Liquid nitrogen cryopreservation, the back growth vigor that thaws is better, nearly 85%-90% survival rate.
The stem cell nutrient solution consists of: contain in every 100ml solution: the knockout-DMEM of 82.69ml, 15ml FBS, 1ml concentration are that 200mM Stimulina, 1ml concentration are that 10mM non-essential amino acid, 200 μ l concentration are that 55mM beta-mercaptoethanol, 10 μ l concentration are that 400ng/mL people's recombination basic fibroblast growth factor (bFGF), 100 μ l concentration are 10
5U/ml LIF (LIF).
The evaluation of the ox iPSCs system that Test Example 1 is set up
The ox inductive pluripotent stem cells of setting up in order to identify among the present invention (bovine inducedpluripotent stem cells; IPSCs) with traditional sense on embryonic stem cell have very similarly biological characteristics; The contriver identifies the iPS cell of the ox that the present invention set up in a plurality of different aspect designs
1. as the ox-hide skin inoblast form of target cell, see Fig. 1-2.
2.PT67 the retroviral particle form after packing cell and the packing is seen Fig. 3-4.
3.iPSCs colony form and AP stained positive (redness) are identified, are seen Fig. 5-6.
4.iPSCs the immunofluorescence cell chemical staining of colony is identified, is seen Fig. 7-10.
5. the vitro differentiation that is formed at of embryoid is identified
Utilize the external suspension culture of ox iPSCs just can form after 7 days a plurality of spheries and blister cavities appearance embryoid (Embryoid Body, EB) structure is seen Figure 11, wherein A is shown as spheric embryoid structure, what B showed is blister cavities appearance embryoid structure.
The embryoid (EB) that utilizes ox iPSCs to form passed through adherent culture 14-21 days again, and made its directed differentiation through the method for adding inducing culture, formed the different cellular fories of representing 3 germinal layers.3 germinal layers are represented clone, see shown in Figure 12-14.
6. the differentiation of teratoma formation and three germinal layer cells
It is subcutaneous that ox iPSCs is expelled to the nude mice buttocks, grows through the 6-9 time-of-week, then can be in the nude mice injection site subcutaneous formation tumour, be teratoma.Be prepared into tissue slice with the teratoma collection, after fixing,, can observe 3 germinal layer cellular fories and exist in the teratoma simultaneously and cut into slices, explain that ox iPSCs has the versatility of growth through H.E. dyeing back microscopic examination.Shown in observations following Figure 15-17 (arrow).In addition, to the total RNA of teratoma tissue extraction, use three germinal layers and represent gene primer to carry out the RT-PCR augmentation detection, the result has also shown the existence of three germinal layer cells, and the ox iPSCs that same explanation is set up has the growth versatility.On behalf of the Gene RT-PCR detected result, three germinal layers of embryoid see Figure 18, and swimming lane 1 among the figure: β-Actin is confidential reference items; Swimming lane 2:Nestin, swimming lane 3: β-tubulin (ectoderm); Swimming lane 4:GATA4, swimming lane 5:Actin alpha 2 (mesoderm); Swimming lane 6:Keratin-14, swimming lane 7:PDX-1, swimming lane 8:AFP (entoderm), the primer is seen table 2.
Table 2. detects noble cells and represents the gene PCR the primer
Test Example 2 utilizes ox iPSCs to set up " ox-mouse " mosaic
Be injected into a strain ox iPSCs wherein in the 8-cell stage or morula of mouse through the method for microinjection, 12~15 ox iPS cells of each embryo's injection are transplanted to the uterus of false pregnancy mouse afterwards.Inject 115 pieces of embryos altogether, transplant and give 5 false pregnancy mouse, wherein a gestation is given birth to 6 mouse.D-LOOP hypervariable region sequences Design primer according to the Mitochondrial DNA of ox; The D-LOOP hypervariable region pcr amplification that two newborn mices (each one of male and female) is wherein carried out Mitochondrial DNA detects; Chimeric have the histiocytic tissue of ox to include: the heart, liver, spleen, lung, kidney, blood, blood vessel, testis a plurality of tissues such as (or ovaries); See Figure 20, proving all chimericly in these two newborn mice different tissues organs has an ox cell.Test-results has disclosed us and has set up ox iPS cell and participated in the chimeric formation of ox-mouse.
When being injected into ox iPS cell among the mouse 8-cell embryo and making allophenic mice, 6 of the allophenic mices of being born altogether, still, the white furs of 6 allophenic mice whole bodies are given birth to by institute, and discovery has fur chimeric.
Electrophoresis Figure 19 top 1-17 swimming lane is represented each tissue detection result of chimeric female mice: 1 heart, 2 livers, 3 brains, 4 lungs, 5 kidneys; 6 digestive tubes, 7 muscle, 8 spleens, 9 spinal cords; 10 ovaries, 11 pancreases, 12 blood, 13 skins (-); 14 acceptor mouse (-), 15 common mouse (-), 16BDF cell, 17BDF-iPSO cell.
Shown in D-LOOP hypervariable region PCR detected result gel electrophoresis Figure 19 of the Mitochondrial DNA of ox: the 1-17 swimming lane is represented each tissue detection result of chimeric male mice among the figure: 1 heart, 2 livers, 3 brains, 4 lungs, 5 kidneys; 6 digestive tubes, 7 muscle, 8 spleens, 9 spinal cords; 10 testis, 11 blood, 12 cartilages (-), 13 skins (-); The 14BDF cell, 15BDF-iPSO cell, 16 acceptor mouse (-), 17 common mouse (-).
< 110>Xibei Univ. of Agricultural & Forest Science & Technology
< 120>utilize the transcription factor transfecting bovine somatic cells to become the method for inductive pluripotent stem cells
<160>4
<210>1
<211>1083bp
<212>DNA
<213>OCT4
<400>1
ATGGCGGGACACCTCGCTTCTGACTTCGCCTTCTCGCCCCCGCCGGGCGGTGGAGGCGAT 60
GGGCCGGGAGGGCCAGAGCCGGGCTGGGTTGATCCTCGGACCTGGATGAGCTTCCAAGGG 120
CCTCCCGGTGGGTCGGGGATCGGGCCGGGGGTTGTGCCTGGCGCCGAGGTGTGGGGGCTT 180
CCCCCGTGCCCCCCGCCCTATGACTTGTGTGGAGGGATGGCCTACTGTGCGCCGCAGGTT 240
GGAGTGGGGCCGGTGCCCCCAGGCGGCCTGGAGACCCCTCAGCCCGAGGGCGAGGCGGGA 300
GCCGGGGTGGAGAGCAACTCCGAGGGGGCCTCCCCGGACCCCTGCGCCGCACCCGCAGGC 360
GCCCCGAAACTGGACAAGGAGAAGCTGGAGCCGAACCCTGAGGAGTCCCAGGACATCAAA 420
GCTCTTCAGAAAGACCTTGAACAATTTGCCAAGCTCCTAAAGCAGAAGAGGATCACACTA 480
GGATATACCCAGGCCGATGTGGGGCTCACCCTGGGGGTTCTCTTTGGAAAGGTGTTCAGC 540
CAAACGACTATCTGCCGTTTTGAGGCTTTGCAGCTCAGTTTCAAGAACATGCGTAAGCTG 600
CGGCCCCTGCTGCAGAAGTGGGTGGAGGAAGCTGACAACAACGAGAATCTGCAGGAGATA 660
TGCAAGGCAGAGACCCTTGTGCAGGCCCGAAAGAGAAAGCGGACGAGTATCGAGAACCGA 720
GTGAGAGGCAACCTGGAGAGCATGTTCCTGCAGTGCCCGAAGCCCACCCTGCAGCAAATT 780
AGCCACATCGCCCAGCAGCTCGGGCTGGAGAAAGACGTGGTCCGAGTGTGGTTTTGCAAC 840
CGTCGCCAGAAGGGCAAACGATCAAGCAGTGACTACTCCCAACGTGAGGATTTTGAGGCT 900
GCTGGGTCTCCTTTCGCAGGGGGACCCGTATCCTTTCCTCTGGCGCCGGGGCCCCATTTT 960
GGTACCCCAGGCTACGGGGGCCCTCACTTCACTACTCTGTACTCTTCGGTCCCATTCCCT 1020
GAGGGTGAGGCCTTTCCCTCGGTGTCTGTCACCGCTCTGGGCTCCCCTATGCATGCAAAC 1080
TGA 1083
<210>2
<211>963bp
<212>DNA
<213>Sox2
<400>2
ATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGC 60
GGCGGCGGCGGCGGCGGCAACTCCACCGCGGCGGCGGCGGGCGGCAACCAGAAGAACAGC 120
CCGGACCGAGTCAAGCGGCCCATGAACGCCTTCATGGTGTGGTCCCGCGGGCAGCGGCGC 180
AAGATGGCCCAAGAGAACCCTAAGATGCACAACTCGGAGATCAGCAAGCGCTTGGGCGCC 240
GAGTGGAAACTTTTGTCCGAGACGGAGAAGCGGCCGTTCATCGACGAGGCCAAGCGGCTG 300
CGAGCGCTGCACATGAAGGAACACCCGGATTATAAATACCGGCCCCGGCGGAAAACCAAG 360
ACGCTCATGAAGAAGGATAAGTACACACTGCCGGGAGGGCTGCTCGCCCCGGGCGGCAAC 420
AGCATGGCGAGCGGGGTCGGGGTGGGCGCCGGCCTCGGCGCGGGCGTGAACCAACGCATG 480
GACAGCTACGCGCACATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGACCAG 540
CTGGGCTACCCGCAACACCCGGGCCTCAACGCGCACGGCGCCGCTCAGATGCAGCCCATG 600
CACCGCTACGACGTGAGCGCCCTGCAGTACAACTCTATGACCAGCTCGCAGACCTACATG 660
AACGGCTCGCCCACCTACAGCATGTCCTATTCTCAGCAGGGCACCCCTGGCATGGCGCTT 720
GGCTCCATGGGCTCGGTGGTGAAGTCCGAGGCCAGCTCCAGCCCCCCCGTGGTTACCTCT 780
TCTTCCCACTCCAGGGCGCCCTGCCAAGCCGGGGACCTCCGGGACATGATCAGCATGTAC 840
CTCCCCGGCGCCGAGGTGCCGGAGCCCGCCGCCCCCAGCAGACTTCACATGTCCCAGCAC 900
TACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTCTCGCACATG 960
TGA 963
<210>3
<211>1320bp
<212>DNA
<213>CMYC
<400>3
ATGCCCCTCAACGTCAGCTTCGCCAACAAGAACTATGACCTCGACTACGATTCGGTGCAG 60
CCTTATTTCTACTGCGACGAGGAGGAGAACTTCTACCACCAGCAGCAGCAGAGCGAACTG 120
CAGCCGCCGGCGCCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCC 180
CTGTTCCCTAGCCGCCGCTCCGGGCTCTGCTCGCCGTCGTACGTCGCGGTCGCCTCCTTC 240
TCGCCCAGGGGAGACGACGACGGCGGCGGCGGCAGCTTCTCCTCAGCGGACCAGTTGGAG 300
ATGGTGACCGAGCTACTAGGAGGCGACATGGTGAACCAGAGCTTCATCTGCGACCCCGAC 360
GATGAGACCCTCATCAAAAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCTCGGCC 420
GCCGCCAAGCTCGTCTCGGAGAAGCTGGCCTCTTACCAGGCTGCGCGCAAAGACGGCGGC 480
AGCCCGAGCCCCGCCCGCGGGCACGGCGGCTGCTCCACCTCCAGCTTGTACCTGCAGGAC 540
CTGAGCGCCGCCGCCTCCGAATGCATCGACCCCTCGGTGGTCTTCCCCTACCCGCTCAAC 600
GACAGCAGCTCGCCCAAGCCCTGCGCTTCCCCGGACTCCACCGCCTTTTCTCCGTCCTCT 660
GACTCTCTGCTCTCCTCTGCTGAGTCCTCCCCGCGGGCCAGTCCCGAGCCCCTGGCGCTC 720
CATGAGGAGACCCCACCCGCGACCAGTAGCGACTCTGAGGAAGAACAAGAGGATGAGGAA 780
GAAATTGATGTTGTTTCTGTGGAAAAGAGGCAGCCCCCTGCCAAAAGGTCAGAATCGGGG 840
TCACCCTCTGCCGGCAGCCACAGCAAACCTCCTCACAGCCCGTTAGTCCTAAAGAGATGC 900
CACGTGTCTACCCATCAGCACAATTACGCAGCGCCCCCCTCCACTAGGAAGGACTATCCC 960
GCCGCCAAGAGGGCTAAGTTGGACAGTGGCAGGGTCCTGAAACAGATCAGCAACAACCGC 1020
AAATGTGCCAGCCCGAGGTCTTCGGACACGGAGGAGAATGACAAGAGGCGGACACACAAC 1080
GTTTTGGAGCGCCAGAGGAGAAACGAGCTGAAACGCAGCTTTTTTGCTCTTCGTGACCAG 1140
ATCCCAGAGTTGGAGAACAATGAAAAAGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACA 1200
GCGTACATCCTGTCGGTCCAAGCAGAGCAGCAAAAGCTCAAGTCAGAAATAGACGTGTTG 1260
CAGAAGAGGCGAGAACAGTTGAAACTCAAACTTGAACAGATACGGAACTCTTGCGCCTAA 1320
<210>4
<211>1434bp
<212>DNA
<213>KLF4
<400>4
ATGGCTGTCAGCGACGCGCTGCTCCCGTCCTTCTCCACGTTCGCGTCCGGCCCGGCGGGA 60
AGGGAGAAGACACTGCGTCCAGCAGGTGCCCCAAATAACCGCTGGCGGGAGGAGCTCTCC 120
CACATGAAGCGACTTCCCCCGGTGCTTCCCGGCCGCCCCTACGACCTGGCGGCGGCGACC 180
GTGGCCACCGACCTGGAGAGTGGAGGAGTCGGCGCGGCTTGCGGCAGCAGCAACCCGGCT 240
CTCCTGCCCCGGAGGGAGACGGAGGAGTTCAATGATCTCCTGGACCTGGACTTTATCCTC 300
TCCAACTCGCTGTCCCATCAGGAGTCCGTGGCCGCCACGGTGTCCTCGTCGGCATCAGCC 360
TCATCCTCGTCCTCCCCGTCGAGCAGCGGTCCAGCCAGTGCGCCTTCCACCTGCAGCTTC 420
AGCTATCCAATCCGGGCCGGGGGCGACCCGGGCGTGGCGGCGCCGGGCGGCGCGGGCGGC 480
GGCCTCCTGTACGGCCGGGAGTCTGCACCGCCTCCGACGGCTCCCTTCAACCTGGCGGAC 540
ATCAACGATGTGAGCCCCTCCGGCGGCTTCGTGGCCGAGCTCCTGCGGCCTGAATTGGAC 600
CCAGTGTACATTCCGCCGCAGCAGCCGCAGCCGCCAGGTGGCGGGCTGATGGGCGAGTTC 660
GTGTTGAAGGCGTCGCCGAGTGCCCCTGGCAGCGAGTACGGCAGCCCGTCGGTCATCAGT 720
GTTAGCAAAGGCAGCCCGGACGGCAGCCACCCGGTGGTGGTGGCGCCCTACAGCGGCGGG 780
CCGCCACGCATGTGCCCCAAGATCAAGCAGGAGGCTGTCTCCTCGTGCACCGTCGGTCGG 840
CCCCTAGAGGCCCACTTGGGCACTGGACCTCCTCTCAGCAATGGCCACCGGCCGCCTGCT 900
CACGACTTTCCCTTGGGGCGGCAGCTCCCCAGCAGGACTACCCCGACCCTGGGTGCCGAG 960
GAACTGCTGAGCAGCCGGGACTGTCATCCTGCCCTGCCGCTCCCCCCGGGCTTCCATCCC 1020
CACCCCGGGCCCAACTACCCTCCCTTCCTGCCCGACCAGATGCAGCCGCAGGTCCCACCG 1080
CTCCATTACCAAGAGCTCATGCCACCCGGTTCCTGCATGCCGGAGGAGCCCAAACCAAAG 1140
AGGGGAAGACGGTCGTGGCCCCGGAAAAGGACGGCCACTCACACTTGTGATTATGCAGGC 1200
TGCGGCAAAACCTACACGAAGAGTTCTCATCTCAAGGCACACCTGCGCACCCACACAGGT 1260
GAGAAACCTTACCACTGTGACTGGGATGGTTGTGGGTGGAAGTTTGCCCGCTCAGATGAA 1320
CTGACCAGGCACTACCGCAAACACACCGGGCACCGCCCCTTCCAGTGCCAGAAGTGCGAC 1380
CGGGCATTCTCGAGGTCGGACCACCTCGCCTTACACATGAAGAGGCACTTTTAA 1434