CN101705248A - Method for transfecting bovine somatic cells into inducted pluripotent stem cells by adopting transcription factors - Google Patents

Abstract

The invention discloses a method for transfecting bovine somatic cells into inducted pluripotent stem cells (iPSCs) by adopting transcription factors, concretely comprising the following steps: 1) isolation and culture of bovine dermal fibroblasts; 2) cloning of bovine transcription factors maintaining pluripotent genes and construction of retroviral vectors of the transcription factors; 3) retrovirus packaging and preparation; and 4) infection of bovine dermal fibroblasts by retrovirus and acquisition of bovine inducted pluripotent stem cells. The invention first adopts the acellular human amniotic membranes as support to replace the mouse embryonic fibroblasts (MEFs) to maintain in vitro proliferation of the bovine iPSCs and keep the bovine iPSCs in undifferentiated pluripotent states for long time. The method which adopts gene inducing to generate the PSCs not only solves the technical problem that the PSCs of the animals such as cattle, sheep, pigs and other livestock are difficult to obtain but also avoids the problem of heterogeneous animal cell pollution caused by the feeder layer which applies the MEFs as the stem cells.

Description

Utilize the transcription factor transfecting bovine somatic cells to become the method for inductive pluripotent stem cells

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of method of utilizing the transcription factor transfecting bovine somatic cells to become inductive pluripotent stem cells.

Background technology

2006, Japanese scholar Yamanaka ^[1]Reported first is utilized mouse transcription factor Oct4, and Sox2, c-Myc, Klf4 make up common transfection mouse somatocyte, obtained mouse inductive pluripotent stem cells (inducted pluripotent stem cells, iPSCs).Subsequently, started the research boom of inducing pluripotent stem cell in the world wide.All done research from animal varieties, transcription factor kind and quantity, transcription factor array mode and foreign gene introduction method or the like many aspects.Yamanaka in 2007 ^[2]Utilize same transcription factor successfully to obtain human iPSCs again; The same year, Yu (Yu Junying) and Thomson ^[3]Utilize Deng the people that (Nanog Lin28) also successfully obtains human iPS cell for Oct3/4, Sox2 with other four kinds of transcription factors.Rhesus monkey is arranged again subsequently ^[4], rat ^[5], pig ^[6]Report (Li etal., 2009 Deng animal iPSCs achieving success; Liao et al., 2009; Liu et al., 2008).Because iPSCs and embryonic stem cell (ESCs) have closely similar biological characteristics, so culture condition of all having used for reference the ES cell in the process of setting up at existing iPSCs, for example use the nutrient solution of ESCs, using mouse embryo fibroblasts (MEF) provides multiple somatomedin to keep the versatility of iPSCs as feeder layer.But domestic animal, for example animals such as pig, ox, sheep also do not have the generally acknowledged embryonic stem cell that is of building ^[7], from body early embryo, separate very difficulty of these embryonic stem cells, and culture system is not definite fully.Existing embryonic stem cell culture condition all is to adopt mouse embryo fibroblasts (MEF) as culture layer, just can keep ESCs and be in undifferentiated state.Use mouse embryo fibroblasts in the ESCs culture system, directly introduced the heterogenous animal cell, the result has directly influenced the clinical application of ESCs cell, has also increased workload and the difficulty in the culturing process.Since mouse embryo stem cell in 1981 ^[8]With hESC in 1998 ^[9]Build be since, over and done with so far two more than ten years, but to be difficult to so far build be to illustrate that then domestic animal will obtain embryonic stem cell from the body early embryo material separation and also exist many technical and theoretic restraining factors to the livestock embryo stem cell.Therefore, utilize Principles of Gene Engineering, the versatility key gene is imported somatocyte, making its reprogrammed is the stem cell with versatility, has both solved technical barrier, and has enriched the cell reprogrammed and stem cell is built the theory that is.

Reference

[1]Takahashi，K.，and?Yamanaka，S.(2006).Induction?of?pluripotent?stemcells?from?mouse?embryonic?and?adult?fibroblast?cultures?by?defined?factors.Cell126，663-676.

[2]Takahashi，K.，Tanabe，K.，Ohnuki，M.，Narita，M.，Ichisaka，T.，Tomoda，K.，and?Yamanaka，S.(2007).Induction?of?pluripotent?stem?cells?from?adult?humanfibroblasts?by?defined?factors.Cell?131，861-872.

[3]Yu，J.Y.，Vodyanik，M.A.，Smuga-Otto，K.，Antosiewicz-Bourget，J.，Frane，J.L.，Tian，S.，Nie，J.，Jonsdottir，G.A.，Ruotti，V.，Stewart，R.，et?al.(2007).Induced?pluripotent?stem?cell?lines?derived?from?human?somatic?cells.Science?318，1917-1920.

[4]Liu，H.S.，Zhu，F.F.，Yong，J.，Zhang，P.B.，Hou，P.P.，Li，H.G.，Jiang，W.，Cai，J.，Liu，M.，Cui，K.，et?al.(2008).Generation?of?Induced?Pluripotent?StemCells?from?Adult?Rhesus?Monkey?Fibroblasts.Cell?Stem?Cell?3，587-590.

[5]Li，W.L.，Wei，W.，Zhu，S.，Zhu，J.，Shi，Y.，Lin，T.，Hao，E.，Hayek，A.，Deng，H.，and?Ding，S.(2009).Generation?of?Rat?and?Human?Induced?PluripotentStem?Cells?by?Combining?Genetic?Reprogramming?and?Chemical?Inhibitors(vol?4，pg?16，2009).Cell?Stem?Cell?4，370-370.

[6]Esteban，M.A.，Xu，J.，Yang，J.，Peng，M.，Qin，D.，Li，W.，Jiang，Z.，Chen，J.，Deng，K.，Zhong，M.，et?al.(2009).Generation?of?Induced?Pluripotent?Stem?CellLines?from?Tibetan?Miniature?Pig.Journal?of?Biological?Chemistry?284，17634-17640.

[7]Keefer，C.L.，Pant，D.，Blomberg，L.，and?Talbot，N.C.(2007).Challenges?and?prospects?for?the?establishment?of?embryonic?stem?cell?lines?ofdomesticated?ungulates.Animal?Reproduction?Science?98，147-168.

[8]Martin，G.R.(1981).Isolation?of?a?pluripotent?cell?line?from?early?mouseembryos?cultured?in?medium?conditioned?by?tera-tocarcinoma?stem?cells.Proc?NatlAcad?Sci?USA?78，7634-7638.

[9]Thomson，J.A.，Itskovitz-Eldor，J.，Shapiro，S.S.，Waknitz，M.A.，Swiergiel，J.J.，Marshall，V.S.，and?Jones，J.M.(1998).Embryonic?stem?cell?linesderived?from?human?blastocysts.Science?282，1145-1147.

Summary of the invention

Building at the domestic animal stem cell is that a middle above-mentioned prior art difficult problem that exists is with not enough, the object of the present invention is to provide the method for a kind of acquisition inductive pluripotent stem cells (iPSCs), with this method obtain cell at cell colony form, growth characteristics, stem cell surface mark, express dryness gene, main dryness gene promoter sequence zone methylation patterns, embryoid forms and vitro differentiation ability, teratoma form ability, and it is all closely similar with the embryonic stem cell characteristic to participate in eight aspects such as mosaic formation.

Realize that foregoing invention purpose technical scheme is a kind of method of utilizing the transcription factor transfecting bovine somatic cells to produce inductive pluripotent stem cells, it is characterized in that, comprise the steps:

1) fibroblastic separation of ox-hide skin and cultivation

Ox-hide skin inoblast (BDFs) and new born bovine skin flbroblast (NDFs) obtain a large amount of adult ox-hide skin inoblast and new born bovine skin flbroblast respectively through the routine cultivation to grow up;

2) ox is kept the clone and the Expressed by Retrovirus Vector thereof of versatility transcription factor gene

From 50-60 age in days ox fetus, separate sex-ridge, extract total RNA, obtain cDNA through reverse transcription reaction; With cDNA is template, reaction obtains ox Oct4, Sox2, c-Myc and four gene amplification products of Klf4 and correctly then goal gene is inserted among the retroviral vector pMSCVneo through the sequence verification sequence through PCR, makes up the retrovirus expression vector of these 4 kinds of genes;

3) retroviral packing and preparation

Using preceding 1 hour of liposome packaging virus particle, the nutrient solution DMEM substratum of packing cell PT67 changes serum-free medium into, 4-8 μ g includes the retroviral plasmid DNA of transcription factor gene and 10-20 μ l liposome and joins 2 part of 500 μ l Opti-MEM-I+GlutaMAX-I respectively and optimize in the transfection liquid, soft mixing, incubated at room, then with the plasmid DNA and the soft mixing of liposome that dilute, incubated at room again, after 20 minutes, the plasmid-lipidosome mixed solution is dropwise added in the PT67 Tissue Culture Dish.

The PT67 packing cell is cultivated in containing the DMEM substratum of 15% foetal calf serum according to ordinary method, used liposome the retrovirus transfection that makes up is entered packing cell PT67 cell; 8 μ g are contained the heterogeneic retrovirus expression vector plasmid of Oct4, Sox2, c-Myc and Klf4 and 4 part of 20 μ l transfection reagent liposome lipofectamine2000 to be optimized liquid with two part of 500 μ lOpti-MEM-I+GlutaMAX-I transfection respectively and dilutes, mixing gently, hatched under the room temperature 5 minutes, the diluent that will contain liposome lipofectamine2000 then slowly splashes in the diluent that contains retroviral plasmid, mixing gently, after hatching 20 minutes again under the room temperature, above-mentioned mixed solution is dropwise added in the PT67 packing born of the same parents culture dish; After the transfection 24 hours, changed in per 24 hours contain retroviral particle nutrient solution once, collect viral suspension for three days on end, under 4 ℃ of conditions through 25000 rev/mins after centrifugal 90 minutes, 10 times of concentrating virus supernatant liquors; To include Oct4, Sox2, c-Myc and Klf4 gene viruses supernatant liquor and carry out balanced mix, and add the specific four factor genes combination of 8 μ g/ml Polybrene composition ,-80 ℃ of preservations are standby;

4) acquisition of the iPS cell of retroviral infection ox-hide skin inoblast and ox

To grow up ox-hide skin inoblast BDFs and newborn bull skin flbroblast NDFs cultivates in the 60mm plastic culture dish according to ordinary method, treat that cell grows into the about 5ml of retrovirus supernatant liquor mixed solution mixed solution that will comprise Oct4, Sox2, c-Myc and Klf4 gene transcription factor when 70-80% merges in the culture dish, join respectively in inoblast BDFs and the NDFs culture dish and infect inoblast; Cell goes down to posterity by 1: 3 routine after covering with culture dish, visual cell's growing state at 6-10d with cell with 1 * 10 ⁵The density of cells/well is transferred to and is covered with in advance on people's amnion (HAM) 6 well culture plates, and the personnel selection amnion replaces mouse embryo fibroblasts to cultivate metainfective ox cell as feeder layer, and nutrient solution is replaced with the stem cell nutrient solution simultaneously; Measure and change liquid every day half in the culture hole, observes 20-28d continuously, till having cell colony to occur, was designated as for 0 generation, is ox iPSCs.

Consisting of of described stem cell nutrient solution: contain in every 100ml solution: the knockout-DMEM of 82.69ml, 15ml FBS, 1ml concentration are that 200mM glutamine, 1ml concentration are that 10mM non-essential amino acid, 200 μ l concentration are that 55mM beta-mercaptoethanol, 10 μ l concentration are that 400ng/mL people's recombination basic fibroblast somatomedin (bFGF), 100 μ l concentration are 10 ⁵U/mL leukaemia inhibitory factor (LIF).

When ox iPSCs goes down to posterity, use the digestion of 0.05%trypsin+0.02%EDTA Digestive system, through neutralization, centrifugal and resuspended being passaged to again on the new HAM upholder, at 37-38 ℃, 5% left and right sides CO ₂, amplification cultivation under the saturated humidity condition obtains ox iPS cell strain.Ox iPSCs went down to posterity once every 3-5 days, went down to posterity at present 120 days, surpassed for 25 generations.Liquid nitrogen cryopreservation, the back growth vigor that thaws is better, and the 80%-90% survival rate is arranged approximately.

A further object of the invention provides the recombinant retroviral expression vector pMSCV-c-Myc of c-Myc gene and the application in the gene genetically engineered.

A further object of the invention provides the recombinant retroviral expression vector pMSCV-Klf4 of Klf4 gene and the application in the gene genetically engineered.

The present invention obtains inductive pluripotent stem cells and its preparation method compared with prior art, has the following advantages:

1, among the present invention 4 of application autonomous clened cows kinds keep stem cell versatility key gene, utilize the several genes array mode, lead by the stem cell retrovirus-mediated method and to enter ox-hide skin inoblast, make its reprogrammed for having the inductive pluripotent stem cell of embryonic stem cell biological nature fully. many strains multi-functional stem cell of setting up by this method surpassed for 25 generations external having gone down to posterity, growth characteristics are all acted normally. and frozen and thawing test shows that they still have good versatility.

2, the present invention adopts first in culture condition and takes off cell people amnion (HAM) and replace mouse embryo fibroblasts (MEF) to keep ox iPSCs in-vitro multiplication as upholder and keep undifferentiated versatility state for a long time, and has avoided using the heterogenous animal cell contamination problem that feeder layer brought of mouse embryo fibroblasts as stem cell.

3, the present invention adopts the method for gene induced generation multipotent stem cells, has solved the particularly ox multipotent stem cells technical barrier that is difficult to obtain of domestic animal, and to build for other stem cell animals be that theoretical foundation and experiment basis are provided.

Description of drawings

Fig. 1 cow skin flbroblast (BDFs) 50 * microscope figure that grows up.

Newborn bull skin flbroblast (NDFs) 50 * microscope of Fig. 2 figure.

Fig. 3 PT67 packing cell 50 * microscope figure.

100,000 times of Electronic Speculum figure of retroviral particle under Fig. 4 Electronic Speculum.

Fig. 5 colony alkaline phosphatase staining 100 * microscope figure.

Fig. 6 colony alkaline phosphatase staining 200 * microscope figure.

Fig. 7 SSEA-4 bright field microscope figure.

Fig. 8 SSEA-4 dyeing (+++) microscope figure.

Fig. 9 TERT bright field microscope figure.

Figure 10 TERT dyeing (+++) microscope figure.

Figure 11 blister cavities sample embryoid structure microscope figure.

Figure 12 represents the β III-Tubulin of the ectoderm cell system positive microscope figure that dyes.

Figure 13 represents the α-actin stained positive microscope figure of mesoblastema system.

Figure 14 represents the alpha-fetoprotein that the endoderm cell is (the stained positive microscope figure of α-fetoprotein).

Figure 15 body of gland spline structure (entoderm) 400 * microscope figure.

Figure 16 structure of skeletal muscles (mesoderm) 400 * microscope figure.

Figure 17 archineuron structure (ectoderm) 400 * microscope figure.

The RT-PCR detected result gel electrophoresis figure of Figure 18 EB.

The PCR detected result gel electrophoresis figure of each tissue of Figure 19 allophenic mice (each one of male and female).

Embodiment

Below the acquisition ox iPSCs that provides by the applicant concrete grammar and all have and the embryonic stem cell similar biological in all many-sides such as colony form, growth characteristics, stem cell surface sign, inside and outside differentiation capability and mosaic formation through multiple evidence ox iPSCs.

Embodiment fibroblastic separation of 1 ox-hide skin and cultivation

Growing up, (female bovine dermal fibroblasts BDFs) separates from the female Holstein milk the ears of an ox or cow edge skin of growing up ox-hide skin inoblast.Be cut into the fine tissue piece after will organizing cleaning and sterilizing, under conventional culture condition, with cultivating among the high sugared DMEM (Gibco company product) that contains 15%-20% foetal calf serum (FBS) (Gibco company product).Every 2-3d changes and supports liquid 1 time, just has inoblast to shift out from the tissue block edge behind the 7-10d, and a large amount of inoblasts closely are arranged in around the tissue block behind the 12-16d.With going down to posterity after trypsinase and the digestion of EDTA mixture slaking liquid liquid, promptly obtain a large amount of adult ox-hide skin inoblasts, see Fig. 1.(male newborn bovine dermalfibroblasts NDFs) from the newborn bull ear of Holstein kind edge skin, sees Fig. 2 to newborn bull skin flbroblast, and separation is identical with above-mentioned cow skin flbroblast method with cultural method.In order to guarantee cell viability, the present invention adopt 2～6 generations with interior cell as inducing preceding target cell.

2 Ns of clone and Expressed by Retrovirus Vector thereof of keeping versatility key gene transcription factor of embodiment

In the fetus body of 50-60 age in days He Sitan (Holstein) kind milk cow, separate sex-ridge, extract total RNA with TRIzol LS Reagent behind the tissue homogenate, handle to remove genomic dna through DNaseI (RNase free) and pollute.Obtain cDNA through reverse transcription reaction.Be template then with cDNA, through open frame (ORF) complete sequence of reading of 4 kinds of transcription factor genes such as pcr amplification Oct4, Sox2, c-Myc and Klf4, gene clone the primer sequence is shown in Table 1 respectively.

Table 1 amplification ox Oct4, Sox2, c-Myc and four gene the primers of Klf4 information

Loop parameter was when wherein the Oct4 gene PCR increased: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 45sec, 60 ℃ of annealing 45sec, 72 ℃ are extended 1min, circulate 35 times, and 72 ℃ are extended 10min again, and expection PCR product length should be 1083bp.

The loop parameter of Sox2 gene is: 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 45sec, 54 ℃ of annealing 30sec, 72 ℃ are extended 1min, circulate 35 times, and 72 ℃ are extended 10min again, and expection PCR product length should be 963bp.

The loop parameter of c-Myc gene is: 94 ℃ of pre-sex change 4min, and 94 ℃ become 30s, 54 ℃ of annealing 1min, 72 ℃ are extended 1min30sec, totally 30 circulations, 72 ℃ are extended 10min again, and expection PCR product length should be 1320bp.

The loop parameter of Klf4 gene is: 94 ℃ of pre-sex change 4min, and 94 ℃ become 30s, 60 ℃ of annealing 1min, 72 ℃ are extended 1min30sec, totally 30 circulations, 72 ℃ are extended 10min again, and expection PCR product length should be 1434bp.

Above-mentioned PCR product is respectively got 5 μ l, to identify its size, remains ℃ preservation of PCR product-20 at 1% agarose gel electrophoresis.Electrophoresis detection result shows that 4 kinds of transcription factor gene sizes of pcr amplification product length and expection milk cow are in full accord, the Pass Test design requirements.Then 4 kinds of PCR product remainders are passed through dna fragmentation Gel Extraction kit purifying, recovery respectively; Reclaiming product is connected with solution I mixing with cloning vector pMD18-T, 16 ℃ of connections are spent the night. and will connect product and be transformed in the competent cell TGI and clone. through containing Ampicillin (80 μ g/ml), dull and stereotyped last 37 ℃ of screening and culturing 14-16 hours of the LB of X-gal and IPTG. picking 6-10 white colony inoculated and shaken bacterium in the LB nutrient solution that contains penbritin (Ampicillin) in a small amount respectively from 4 kinds of cultures, and according to plasmid extraction test kit specification sheets step extracting trace plasmid. comprise Oct4, Sox2, c-Myc, the plasmid of 4 kinds of genes such as Klf4 is through double digestion, single endonuclease digestion and plasmid PCR identify. four kinds of plasmids are through BglII+EcoRI double digestion and EcoRI single endonuclease digestion and plasmid PCR evaluation, to obtain pMD-18T-Oct4, pMD-18T-Sox2, pMD-18T-cMyc, the positive colony of four kinds of plasmids of pMD-18T-Klf4. select and recommend the positive plasmid of qualification result and check order to biotech firm. reference sequences carries out the homology comparative analysis among sequencing result application DNAstart 7.10 softwares and the GenBank.Analytical results shows, Oct4, and Sox2, c-Myc and Klf4 gene order and reference sequences homology are respectively 99.4%, 99.6%, and 99.4% and 99.3%.

The pMD-18T-Oct4 that above-mentioned order-checking is correct; pMD-18T-Sox2; pMD-18T-cMyc, pMD-18T-Klf4,4 kinds of plasmids reclaim behind the purifying with retrovirus pMSCVneo carrier and pass through target gene fragment and linearizing pMSCVneo carrier behind the BglII+EcoRI double digestion respectively.Retrovirus vector pMSCVneo after the linearizing is connected at 16 ℃ with DNA Ligation Kit Version2.0 with the purpose fragment of recovery spends the night, after 14-16 hour, connect product and be transformed into the JM109 competent cell, through filtering out the positive colony of retroviral plasmid on penbritin (Ampicillin, 50 μ g/mL) the LB flat board.From 4 culture plates, each recombinant plasmid picking 6-10 bacterium colony respectively shakes bacterium in a small amount, and micro-method is extracted the retroviral plasmid of reorganization.Identify and the sequencing analysis evaluation through the two enzymic digestion evaluations of BglII+EcoRI (perhaps BglII+HapI), plasmid pcr amplification.4 kinds of recombinant retrovirus plasmids can obtain the target gene fragment and the retroviral vector fragment of known dimensions through behind the double digestion, illustrate that our constructed recombinant retroviral expression vector structure is correct.Detect by order-checking, the sequence and the pcr amplification sequence of 4 goal gene that comprised in all recombinant retrovirus plasmids are in full accord, also with GenBank in reference sequences in full accord, show that in this patent goal gene in constructed 4 kinds of recombinant retrovirus plasmid processes do not read situations such as the frameshit of frame and base mutation, illustrate that applied 4 kinds of gene orders are entirely true.4 kinds of constructed in this patent recombinant retroviral expression vectors are distinguished called after: pMSCV-Oct4, pMSCV-Sox2, pMSCV-cMyc and pMSCV-Klf4.

Embodiment 3 retroviral packing and preparations

The PT67 packing cell is cultivated in the DMEM substratum according to ordinary method, when treating that cell reaches 70%-80% and converges, use liposome the retrovirus transfection is entered packing cell PT67 cell, carry out the virus packing to obtain to have infectious retroviral particle.Preceding 1 hour of transfection, the DMEM substratum changes serum-free medium into, 4-8 μ g retroviral plasmid DNA and 10-20 μ l liposome join 500 μ l Opti-MEM-I+GlutaMAX-I (Gibco company product) respectively and optimize in the transfection liquid, soft mixing, incubated at room, with the plasmid DNA and the soft mixing of liposome of dilution, incubated at room dropwise added mixed solution in the PT67 Tissue Culture Dish after 20 minutes more then.Cell is at 37 ℃, 5%CO ₂After cultivating 4-6h under the saturated humidity condition, transfection liquid changes the new DMEM nutrient solution that contains 15%FBS into.After transfection in 24 hours, collect PT67 cell culture fluid supernatant, just comprise infectious retroviral particle in this supernatant.Supernatant liquor is through the membrane filtration in 0.45 μ m aperture.Collected once, and collected 3d continuously in per 24 hours.Viral suspension under 4 ℃ of conditions, through 25,000 rev/mins, centrifugal 90 minutes, 10 times of concentrating virus supernatant liquors.Oct4, Sox2, c-Myc and four kinds of gene viruses supernatant liquors of Klf4 are carried out balanced mix, and add 8 μ g/ml polybrene and form specific four factor genes combination, transfection ox-hide skin inoblast is prepared in-80 ℃ of preservations.

The acquisition of the iPS cell of embodiment 4 retroviral infection ox-hide skin inoblasts and ox and going down to posterity

Ox-hide skin inoblast (BDFs) and the newborn bull skin flbroblast (NDFs) of will growing up cultivated according to ordinary method and inoculate 2 * 10 in the 60mm plastic culture dish ⁵Individual cell, when treating that cell grows into the 70-80% fusion in the culture dish, the retrovirus supernatant liquor mixed solution that will comprise Oct4, Sox2, c-Myc and Klf4 gene transcription factor joins respectively in inoblast BDFs and the NDFs culture dish and infects inoblast; Cell goes down to posterity by the 1:3 routine after covering with culture dish, visual cell's growing state at 6-10d with cell with 1 * 10 ⁵The density of cells/well is transferred to and is covered with in advance on people's amnion 6 well culture plates, replaces MEF to cultivate metainfective ox cell as feeder layer with HAM, and nutrient solution is replaced with the stem cell nutrient solution simultaneously; Measure and change liquid every day half in the culture hole, observes 20-28d continuously, till having ES cell sample colony to occur, was designated as for 0 generation, is ox iPSCs.

When ox iPSCs goes down to posterity, use the digestion of 0.05%trypsin+0.02%EDTA Digestive system, through neutralization, centrifugal and resuspended being passaged to again on the new HAM upholder, at 37-38 ℃, 5% left and right sides CO ₂, amplification cultivation under the saturated humidity condition obtains ox iPS cell strain.Ox iPSCs went down to posterity once every 3-5 days, went down to posterity at present 120 days, surpassed for 25 generations.Liquid nitrogen cryopreservation, the back growth vigor that thaws is better, nearly 85%-90% survival rate.

The stem cell nutrient solution consists of: contain in every 100ml solution: the knockout-DMEM of 82.69ml, 15ml FBS, 1ml concentration are that 200mM glutamine, 1ml concentration are that 10mM non-essential amino acid, 200 μ l concentration are that 55mM beta-mercaptoethanol, 10 μ l concentration are that 400ng/mL people's recombination basic fibroblast somatomedin (bFGF), 100 μ l concentration are 10 ⁵U/ml leukaemia inhibitory factor (LIF).

The evaluation of the ox iPSCs system that test example 1 is set up

The ox inductive pluripotent stem cells of setting up in order to identify among the present invention (bovine inducedpluripotent stem cells, iPSCs) with traditional sense on embryonic stem cell have very similarly biological characteristics, the contriver identifies the iPS cell of the ox that the present invention set up in a plurality of different aspect designs

1. as the ox-hide skin inoblast form of target cell, see Fig. 1-2.

2.PT67 the retroviral particle form after packing cell and the packing is seen Fig. 3-4.

3.iPSCs colony form and AP stained positive (redness) are identified, are seen Fig. 5-6.

4.iPSCs the immunofluorescence cell chemical staining of colony is identified, is seen Fig. 7-10.

5. the vitro differentiation that is formed at of embryoid is identified

Utilize the external suspension culture of ox iPSCs just can form after 7 days a plurality of spheries and blister cavities sample embryoid (Embryoid Body, EB) structure is seen Figure 11, wherein A is shown as spheric embryoid structure, what B showed is blister cavities sample embryoid structure.

The embryoid (EB) that utilizes ox iPSCs to form passed through adherent culture 14-21 days again, and made its directed differentiation by the method for adding inducing culture, formed the different cellular fories of representing 3 germinal layers.3 germinal layers are represented clone, see shown in Figure 12-14.

6. the differentiation of teratoma formation and three germinal layer cells

It is subcutaneous that ox iPSCs is expelled to the nude mice buttocks, grows through the 6-9 time-of-week, then can be in the nude mice injection site subcutaneous formation tumour, be teratoma.Be prepared into tissue slice with the teratoma collection, after fixing,, can observe 3 germinal layer cellular fories and exist in the teratoma simultaneously and cut into slices, illustrate that ox iPSCs has the versatility of growth through H.E. dyeing back microscopic examination.Shown in observations following Figure 15-17 (arrow).In addition, to the total RNA of teratoma tissue extraction, use three germinal layers and represent gene primer to carry out the RT-PCR augmentation detection, the result has also shown the existence of three germinal layer cells, and the ox iPSCs that same explanation is set up has the growth versatility.On behalf of the Gene RT-PCR detected result, three germinal layers of embryoid see Figure 18, and swimming lane 1 among the figure: β-Actin is confidential reference items; Swimming lane 2:Nestin, swimming lane 3: β-tubulin (ectoderm); Swimming lane 4:GATA4, swimming lane 5:Actin alpha 2 (mesoderm); Swimming lane 6:Keratin-14, swimming lane 7:PDX-1, swimming lane 8:AFP (entoderm), the primer sees Table 2.

Table 2. detects noble cells and represents the gene PCR the primer

Test example 2 utilizes ox iPSCs to set up " ox-mouse " mosaic

A strain ox iPSCs wherein is injected in the 8-cell stage or morula of mouse by the method for microinjection, and 12～15 ox iPS cells of each embryo's injection are transplanted to the uterus of false pregnancy mouse afterwards.Inject 115 pieces of embryos altogether, transplant and give 5 false pregnancy mouse, wherein a gestation is given birth to 6 mouse.D-LOOP hypervariable region sequences Design primer according to the Mitochondrial DNA of ox, the D-LOOP hypervariable region pcr amplification that two newborn mices (each one of male and female) is wherein carried out Mitochondrial DNA detects, chimeric have the histiocytic tissue of ox to include: the heart, liver, spleen, lung, kidney, blood, blood vessel, testis a plurality of tissues such as (or ovaries), see Figure 20, proving all chimericly in these two newborn mice different tissues organs has an ox cell.Test-results has disclosed us and has set up ox iPS cell and participated in the chimeric formation of ox-mouse.

When being injected into ox iPS cell among the mouse 8-cell embryo and making allophenic mice, 6 of the allophenic mices of being born altogether, still, the white furs of 6 allophenic mice whole bodies are given birth to by institute, and it is chimeric to find no fur.

Electrophoresis Figure 19 top 1-17 swimming lane is represented each tissue detection result of chimeric female mice: 1 heart, 2 livers, 3 brains, 4 lungs, 5 kidneys, 6 digestive tubes, 7 muscle, 8 spleens, 9 spinal cords, 10 ovaries, 11 pancreases, 12 blood, 13 skins (-), 14 acceptor mouse (-), 15 common mouse (-), the 16BDF cell, the 17BDF-iPSO cell.

Shown in D-LOOP hypervariable region PCR detected result gel electrophoresis Figure 19 of the Mitochondrial DNA of ox: the 1-17 swimming lane is represented each tissue detection result of chimeric male mice among the figure: 1 heart, 2 livers, 3 brains, 4 lungs, 5 kidneys, 6 digestive tubes, 7 muscle, 8 spleens, 9 spinal cords, 10 testis, 11 blood, 12 cartilages (-), 13 skins (-), 14BDF cell, 15BDF-iPSO cell, 16 acceptor mouse (-), 17 common mouse (-).

＜110〉Xibei Univ. of Agricultural ﹠ Forest Science ﹠ Technology

＜120〉utilize the transcription factor transfecting bovine somatic cells to become the method for inductive pluripotent stem cells

<160>4

<210>1

<211>1083bp

<212>DNA

<213>OCT4

<400>1

ATGGCGGGACACCTCGCTTCTGACTTCGCCTTCTCGCCCCCGCCGGGCGGTGGAGGCGAT 60

GGGCCGGGAGGGCCAGAGCCGGGCTGGGTTGATCCTCGGACCTGGATGAGCTTCCAAGGG 120

CCTCCCGGTGGGTCGGGGATCGGGCCGGGGGTTGTGCCTGGCGCCGAGGTGTGGGGGCTT 180

CCCCCGTGCCCCCCGCCCTATGACTTGTGTGGAGGGATGGCCTACTGTGCGCCGCAGGTT 240

GGAGTGGGGCCGGTGCCCCCAGGCGGCCTGGAGACCCCTCAGCCCGAGGGCGAGGCGGGA 300

GCCGGGGTGGAGAGCAACTCCGAGGGGGCCTCCCCGGACCCCTGCGCCGCACCCGCAGGC 360

GCCCCGAAACTGGACAAGGAGAAGCTGGAGCCGAACCCTGAGGAGTCCCAGGACATCAAA 420

GCTCTTCAGAAAGACCTTGAACAATTTGCCAAGCTCCTAAAGCAGAAGAGGATCACACTA 480

GGATATACCCAGGCCGATGTGGGGCTCACCCTGGGGGTTCTCTTTGGAAAGGTGTTCAGC 540

CAAACGACTATCTGCCGTTTTGAGGCTTTGCAGCTCAGTTTCAAGAACATGCGTAAGCTG 600

CGGCCCCTGCTGCAGAAGTGGGTGGAGGAAGCTGACAACAACGAGAATCTGCAGGAGATA 660

TGCAAGGCAGAGACCCTTGTGCAGGCCCGAAAGAGAAAGCGGACGAGTATCGAGAACCGA 720

GTGAGAGGCAACCTGGAGAGCATGTTCCTGCAGTGCCCGAAGCCCACCCTGCAGCAAATT 780

AGCCACATCGCCCAGCAGCTCGGGCTGGAGAAAGACGTGGTCCGAGTGTGGTTTTGCAAC 840

CGTCGCCAGAAGGGCAAACGATCAAGCAGTGACTACTCCCAACGTGAGGATTTTGAGGCT 900

GCTGGGTCTCCTTTCGCAGGGGGACCCGTATCCTTTCCTCTGGCGCCGGGGCCCCATTTT 960

GGTACCCCAGGCTACGGGGGCCCTCACTTCACTACTCTGTACTCTTCGGTCCCATTCCCT 1020

GAGGGTGAGGCCTTTCCCTCGGTGTCTGTCACCGCTCTGGGCTCCCCTATGCATGCAAAC 1080

TGA 1083

<210>2

<211>963bp

<212>DNA

<213>Sox2

<400>2

ATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGC 60

GGCGGCGGCGGCGGCGGCAACTCCACCGCGGCGGCGGCGGGCGGCAACCAGAAGAACAGC 120

CCGGACCGAGTCAAGCGGCCCATGAACGCCTTCATGGTGTGGTCCCGCGGGCAGCGGCGC 180

AAGATGGCCCAAGAGAACCCTAAGATGCACAACTCGGAGATCAGCAAGCGCTTGGGCGCC 240

GAGTGGAAACTTTTGTCCGAGACGGAGAAGCGGCCGTTCATCGACGAGGCCAAGCGGCTG 300

CGAGCGCTGCACATGAAGGAACACCCGGATTATAAATACCGGCCCCGGCGGAAAACCAAG 360

ACGCTCATGAAGAAGGATAAGTACACACTGCCGGGAGGGCTGCTCGCCCCGGGCGGCAAC 420

AGCATGGCGAGCGGGGTCGGGGTGGGCGCCGGCCTCGGCGCGGGCGTGAACCAACGCATG 480

GACAGCTACGCGCACATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGACCAG 540

CTGGGCTACCCGCAACACCCGGGCCTCAACGCGCACGGCGCCGCTCAGATGCAGCCCATG 600

CACCGCTACGACGTGAGCGCCCTGCAGTACAACTCTATGACCAGCTCGCAGACCTACATG 660

AACGGCTCGCCCACCTACAGCATGTCCTATTCTCAGCAGGGCACCCCTGGCATGGCGCTT 720

GGCTCCATGGGCTCGGTGGTGAAGTCCGAGGCCAGCTCCAGCCCCCCCGTGGTTACCTCT 780

TCTTCCCACTCCAGGGCGCCCTGCCAAGCCGGGGACCTCCGGGACATGATCAGCATGTAC 840

CTCCCCGGCGCCGAGGTGCCGGAGCCCGCCGCCCCCAGCAGACTTCACATGTCCCAGCAC 900

TACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTCTCGCACATG 960

TGA 963

<210>3

<211>1320bp

<212>DNA

<213>CMYC

<400>3

ATGCCCCTCAACGTCAGCTTCGCCAACAAGAACTATGACCTCGACTACGATTCGGTGCAG 60

CCTTATTTCTACTGCGACGAGGAGGAGAACTTCTACCACCAGCAGCAGCAGAGCGAACTG 120

CAGCCGCCGGCGCCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCC 180

CTGTTCCCTAGCCGCCGCTCCGGGCTCTGCTCGCCGTCGTACGTCGCGGTCGCCTCCTTC 240

TCGCCCAGGGGAGACGACGACGGCGGCGGCGGCAGCTTCTCCTCAGCGGACCAGTTGGAG 300

ATGGTGACCGAGCTACTAGGAGGCGACATGGTGAACCAGAGCTTCATCTGCGACCCCGAC 360

GATGAGACCCTCATCAAAAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCTCGGCC 420

GCCGCCAAGCTCGTCTCGGAGAAGCTGGCCTCTTACCAGGCTGCGCGCAAAGACGGCGGC 480

AGCCCGAGCCCCGCCCGCGGGCACGGCGGCTGCTCCACCTCCAGCTTGTACCTGCAGGAC 540

CTGAGCGCCGCCGCCTCCGAATGCATCGACCCCTCGGTGGTCTTCCCCTACCCGCTCAAC 600

GACAGCAGCTCGCCCAAGCCCTGCGCTTCCCCGGACTCCACCGCCTTTTCTCCGTCCTCT 660

GACTCTCTGCTCTCCTCTGCTGAGTCCTCCCCGCGGGCCAGTCCCGAGCCCCTGGCGCTC 720

CATGAGGAGACCCCACCCGCGACCAGTAGCGACTCTGAGGAAGAACAAGAGGATGAGGAA 780

GAAATTGATGTTGTTTCTGTGGAAAAGAGGCAGCCCCCTGCCAAAAGGTCAGAATCGGGG 840

TCACCCTCTGCCGGCAGCCACAGCAAACCTCCTCACAGCCCGTTAGTCCTAAAGAGATGC 900

CACGTGTCTACCCATCAGCACAATTACGCAGCGCCCCCCTCCACTAGGAAGGACTATCCC 960

GCCGCCAAGAGGGCTAAGTTGGACAGTGGCAGGGTCCTGAAACAGATCAGCAACAACCGC 1020

AAATGTGCCAGCCCGAGGTCTTCGGACACGGAGGAGAATGACAAGAGGCGGACACACAAC 1080

GTTTTGGAGCGCCAGAGGAGAAACGAGCTGAAACGCAGCTTTTTTGCTCTTCGTGACCAG 1140

ATCCCAGAGTTGGAGAACAATGAAAAAGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACA 1200

GCGTACATCCTGTCGGTCCAAGCAGAGCAGCAAAAGCTCAAGTCAGAAATAGACGTGTTG 1260

CAGAAGAGGCGAGAACAGTTGAAACTCAAACTTGAACAGATACGGAACTCTTGCGCCTAA 1320

<210>4

<211>1434bp

<212>DNA

<213>KLF4

<400>4

ATGGCTGTCAGCGACGCGCTGCTCCCGTCCTTCTCCACGTTCGCGTCCGGCCCGGCGGGA 60

AGGGAGAAGACACTGCGTCCAGCAGGTGCCCCAAATAACCGCTGGCGGGAGGAGCTCTCC 120

CACATGAAGCGACTTCCCCCGGTGCTTCCCGGCCGCCCCTACGACCTGGCGGCGGCGACC 180

GTGGCCACCGACCTGGAGAGTGGAGGAGTCGGCGCGGCTTGCGGCAGCAGCAACCCGGCT 240

CTCCTGCCCCGGAGGGAGACGGAGGAGTTCAATGATCTCCTGGACCTGGACTTTATCCTC 300

TCCAACTCGCTGTCCCATCAGGAGTCCGTGGCCGCCACGGTGTCCTCGTCGGCATCAGCC 360

TCATCCTCGTCCTCCCCGTCGAGCAGCGGTCCAGCCAGTGCGCCTTCCACCTGCAGCTTC 420

AGCTATCCAATCCGGGCCGGGGGCGACCCGGGCGTGGCGGCGCCGGGCGGCGCGGGCGGC 480

GGCCTCCTGTACGGCCGGGAGTCTGCACCGCCTCCGACGGCTCCCTTCAACCTGGCGGAC 540

ATCAACGATGTGAGCCCCTCCGGCGGCTTCGTGGCCGAGCTCCTGCGGCCTGAATTGGAC 600

CCAGTGTACATTCCGCCGCAGCAGCCGCAGCCGCCAGGTGGCGGGCTGATGGGCGAGTTC 660

GTGTTGAAGGCGTCGCCGAGTGCCCCTGGCAGCGAGTACGGCAGCCCGTCGGTCATCAGT 720

GTTAGCAAAGGCAGCCCGGACGGCAGCCACCCGGTGGTGGTGGCGCCCTACAGCGGCGGG 780

CCGCCACGCATGTGCCCCAAGATCAAGCAGGAGGCTGTCTCCTCGTGCACCGTCGGTCGG 840

CCCCTAGAGGCCCACTTGGGCACTGGACCTCCTCTCAGCAATGGCCACCGGCCGCCTGCT 900

CACGACTTTCCCTTGGGGCGGCAGCTCCCCAGCAGGACTACCCCGACCCTGGGTGCCGAG 960

GAACTGCTGAGCAGCCGGGACTGTCATCCTGCCCTGCCGCTCCCCCCGGGCTTCCATCCC 1020

CACCCCGGGCCCAACTACCCTCCCTTCCTGCCCGACCAGATGCAGCCGCAGGTCCCACCG 1080

CTCCATTACCAAGAGCTCATGCCACCCGGTTCCTGCATGCCGGAGGAGCCCAAACCAAAG 1140

AGGGGAAGACGGTCGTGGCCCCGGAAAAGGACGGCCACTCACACTTGTGATTATGCAGGC 1200

TGCGGCAAAACCTACACGAAGAGTTCTCATCTCAAGGCACACCTGCGCACCCACACAGGT 1260

GAGAAACCTTACCACTGTGACTGGGATGGTTGTGGGTGGAAGTTTGCCCGCTCAGATGAA 1320

CTGACCAGGCACTACCGCAAACACACCGGGCACCGCCCCTTCCAGTGCCAGAAGTGCGAC 1380

CGGGCATTCTCGAGGTCGGACCACCTCGCCTTACACATGAAGAGGCACTTTTAA 1434

Claims (7)

1. a method of utilizing the transcription factor transfecting bovine somatic cells to become inductive pluripotent stem cells comprises the steps:

1) fibroblastic separation of ox-hide skin and cultivation

With ox-hide skin inoblast BDF and the new born bovine skin flbroblast NDF of growing up, nutrient does not obtain a large amount of adult ox-hide skin inoblast and new born bovine skin flbroblast after the routine training;

2) ox is kept the clone and the Expressed by Retrovirus Vector thereof of versatility transcription factor gene

From 50-60 age in days ox fetus, separate sex-ridge, extract total RNA, obtain cDNA through reverse transcription reaction; With cDNA is template, reaction obtains ox Oct4, Sox2, c-Myc and four gene amplification products of Klf4 and correctly then goal gene is inserted among the retroviral vector pMSCVneo through the sequence verification sequence through PCR, makes up the retrovirus expression vector of these 4 kinds of genes;

3) retroviral packing and preparation

The PT67 packing cell is cultivated in containing the DMEM substratum of 15% foetal calf serum according to ordinary method, used liposome the retrovirus transfection that makes up is entered packing cell PT67 cell; 8 μ g are contained Oct4, Sox2, c-Myc and four heterogeneic retrovirus expression vector plasmids of Klf4 and 4 part of 20 μ l transfection reagent liposome lipofectamine2000 to be optimized liquid with 500 μ lOpti-MEM-I+GlutaMAX-I transfections respectively and dilutes, mixing gently, hatched under the room temperature 5 minutes, the diluent that will contain liposome lipofectamine2000 then slowly splashes in the diluent that contains retroviral plasmid, mixing gently, after hatching 20 minutes again under the room temperature, then above-mentioned mixed solution is dropwise added in the PT67 packing born of the same parents culture dish; After the transfection 24 hours, change every day contain retroviral particle nutrient solution once, for three days on end, collect viral suspension, under 4 ℃ of conditions through 25000 rev/mins after centrifugal 90 minutes, 10 times of concentrating virus supernatant liquors; To include Oct4, Sox2, c-Myc and Klf4 gene viruses supernatant liquor and carry out balanced mix, and add the specific four factor genes combination of 8 μ g/ml Polybrene composition ,-80 ℃ of preservations are standby;

4) acquisition of the iPS cell of retroviral infection ox-hide skin inoblast and ox

To grow up ox-hide skin inoblast BDFs and newborn bull skin flbroblast NDFs cultivates in the 60mm plastic culture dish according to ordinary method, treats in the culture dish that cell grows into the mixed solution that will comprise the retrovirus supernatant liquor of Oct4, Sox2, c-Myc and Klf4 gene transcription factor when 70-80% merges and joins respectively in inoblast BDFs and the NDFs culture dish and infect inoblast; Cell goes down to posterity by 1: 3 routine after covering with culture dish, visual cell's growing state at 6-10d with cell with 1 * 10 ⁵The density of cells/well is transferred to and is covered with in advance on people's amnion (HAM) 6 well culture plates, cultivates metainfective ox cell as feeder layer, and nutrient solution is replaced with the stem cell nutrient solution simultaneously; Measure and change liquid every day half in the culture hole, observes 20-28d continuously, till having cell colony to occur, was designated as for 0 generation, is ox iPSCs.

2. method according to claim 1, it is characterized in that: using preceding 1 hour of liposome packaging virus particle, change the nutrient solution DMEM substratum of packing cell PT67 into serum-free medium, 4-8 μ g includes the retroviral plasmid DNA of transcription factor gene and 10-20 μ l liposome and joins 2 part of 500 μ l Opti-MEM-I+GlutaMAX-I respectively and optimize in the transfection liquid, soft mixing, incubated at room, then with the plasmid DNA and the soft mixing of liposome that dilute, incubated at room dropwise added the plasmid-lipidosome mixed solution in the PT67 Tissue Culture Dish after 20 minutes again.

3. method according to claim 1 is characterized in that: the consisting of of described stem cell nutrient solution: contain in every 100ml solution: the knockout-DMEM of 82.69ml, 15ml FBS, 1ml concentration are that 200mM glutamine, 1ml concentration are that 10mM non-essential amino acid, 200 μ l concentration are that 55mM beta-mercaptoethanol, 10 μ l concentration are that 400ng/ml people's recombination basic fibroblast somatomedin, 100 μ l concentration are 10 ⁵The U/mL leukaemia inhibitory factor.

4. the recombinant retroviral expression vector pMSCV-c-Myc of the described c-Myc gene of claim 1.

5. the application of the described recombinant retroviral expression vector pMSCV-c-Myc of claim 4 in the gene genetically engineered.

6. the recombinant retroviral expression vector pMSCV-Klf4 of the described Klf4 gene of claim 1.

7. the application of the described recombinant retroviral expression vector pMSCV-Klf4 of claim 6 in the gene genetically engineered.

Images