CN108410894A - A kind of carrier and method improving ox cloning efficiency based on histone methylated horizontal modification - Google Patents
A kind of carrier and method improving ox cloning efficiency based on histone methylated horizontal modification Download PDFInfo
- Publication number
- CN108410894A CN108410894A CN201810187279.7A CN201810187279A CN108410894A CN 108410894 A CN108410894 A CN 108410894A CN 201810187279 A CN201810187279 A CN 201810187279A CN 108410894 A CN108410894 A CN 108410894A
- Authority
- CN
- China
- Prior art keywords
- kdm4e
- somatic cells
- bovine somatic
- clone embryos
- mrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
- C12N15/877—Techniques for producing new mammalian cloned embryos
- C12N15/8771—Bovine embryos
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/11—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (1.14.11)
- C12Y114/11027—[Histone H3]-lysine-36 demethylase (1.14.11.27)
Abstract
The invention discloses a kind of carriers and method improving ox cloning efficiency based on histone methylated horizontal modification.Carrier provided by the invention includes the in-vitro transcription template vector containing ox KDM4E genes.Carrier reacts the mRNA that can get a large amount of ox KDM4E genes through in-vitro transcription, then is injected into successful fusion and the bovine somatic cells clone embryos of activation, makes embryo's overexpression ox KDM4E albumen.It is horizontal in histone H 3 K9me3 and the H3K9me2 epigenetic modification in zygote activation period that the present invention can effectively weaken somatic cell clone embryo, to significantly improve the developmental rate and quality of later stage bovine somatic cells cloned blastocysts, efficient produced in vitro bovine somatic cells clone embryos are can be used to, the birth rate of embryo transfer rear clone ox also significantly improves.
Description
Technical field
The invention belongs to animalsomaticcellcloningtechnology field, it is related to a kind of modification based on histone methylated level and carries
The carrier and method of high ox cloning efficiency.
Background technology
Somatic cell clone is a technology with huge research and commercial value, may be used on therapeutic cloning, disease
Model, human organ transplantation, Animal Transgenic research, the protection of endangered animal varieties, excellent domestic animal kind amplification etc..
But somatic cell clone efficiency is not still high so far, significantly restricts the extensive use of this technology.
It is not rearranged completely by receptor ooecium matter it is now recognized that the main reason for cloning efficiency is low is donor somatic cell nuclei
Journey, i.e. reprogramming failure or incomplete.It is repaiied without reference to the variation of gene order, mainly epigenetic during this reprogramming
The variation of decorations, these epigenetic modifications include mainly three aspect of histone methylated, acetylation of histone and DNA methylation.
Although histone methylated equal epigenetic modifications are widely present in Embryonic Development in Animal, at present not yet
There is the angle of research epigenetic modification difference between clone embryos and fertilized embryo, discloses epigenetic modification and endogenous egg
The relationship of white expression causes, for how to improve animal embryo ectogenesis efficiency, still to lack clear and effective
Resolution policy improves bovine somatic cells clone embryos developmental rate, blastomere number in particular with KDM4 family gene differential expressions
Effect with birth rate is there is not yet report.
Invention content
The purpose of the present invention is to provide a kind of loads improving ox cloning efficiency based on histone methylated horizontal modification
Body and method.
In order to achieve the above objectives, present invention employs following technical schemes：
A kind of in-vitro transcription template vector, which includes the recombinant gene expression box for expressing aim sequence, described
Aim sequence includes KDM4E genes, which there is coding to go in histone H 3 K9 methylase KDM4 protein families strictly to protect
The critical sites sequence for the decision enzymatic activity kept.
Preferably, the aim sequence further includes the green fluorescent protein EGFP bases with the KDM4E Tandem gene expressions
Cause.
Preferably, the recombinant gene expression box further includes the Kozak sequences positioned at the aim sequence upstream.Kozak
Sequence is the sequence more guarded on eucaryote transcription gained mRNA, it can promote mRNA effectively to be combined with ribosomes,
Ensure being normally carried out for translation.
Preferably, the KDM4E genes are selected from ox KDM4E gene reading frames.
Preferably, the KDM4E genes are as shown in SEQ.ID.NO.1.
Preferably, the carrier specifically includes pcDNA3.1 (+) carrier as skeleton and is inserted in pcDNA3.1 (+)
Above-mentioned recombinant gene expression box in vector multiple cloning site area, the recombinant gene expression box use pcDNA3.1 (+) carrier institute
Promoter containing T7 starts aim sequence expression, further includes being arranged in order after the T7 promoters contained by pcDNA3.1 (+) carrier
Kozak sequences, green fluorescent protein EGFP gene reading frame and ox KDM4E gene reading frames.
A kind of bovine somatic cells clone embryos processing side for improving ox cloning efficiency based on histone methylated horizontal modification
Method, the processing method include the following steps：
It is reacted through in-vitro transcription and obtains mRNA of the transcription from aim sequence, the aim sequence includes KDM4E genes, the base
Because having coding to go the critical sites sequence of the decision enzymatic activity of strict conservation in histone H 3 K9 methylase KDM4 protein families
Row；The mRNA is injected into again in the bovine somatic cells clone embryos for completing fusion and activation processing, makes embryo's overexpression
KDM4E albumen.
Preferably, before the zygote activation phase that the mRNA injection lengths are bovine somatic cells clone embryos.
Preferably, the processing method specifically includes following steps：
1) in-vitro transcription of aim sequence
KDM4E genes, green fluorescent protein EGFP gene and the Kozak sequences positioned at front end are inserted into skeleton carrier
Row；Then in-vitro transcription will be carried out after the linearized processing of the carrier, obtained glimmering for amalgamation and expression KDM4E genes and green
The mRNA is diluted to 800~1200ng/ μ L by the mRNA of the stabilization of photoprotein EGFP gene；
2) it is based on body-cell neucleus transplanting and builds bovine somatic cells clone embryos
Using by inducing the bovine fetal fibroblast of hungry culture as donorcells, donorcells are injected into stoning
Reconstructed volume is obtained in bovine oocyte, fusion treatment is carried out to reconstructed volume, and the bovine somatic cells clone embryos that fusion obtains are carried out
Activation is handled；
3) mRNA injections and bovine somatic cells clone embryos culture
Renewal cultivation is carried out to the bovine somatic cells clone embryos by activation processing, then by mRNA (its obtained by step 1)
In, KDM4E mRNA effective concentrations are 500~750ng/ μ L) ox is injected by microinjection according to the dosage of 8~10pL
Somatic cell clone embryo；The bovine somatic cells clone embryos for injecting mRNA were persistently cultivated to 8 cell stages or blastula stage.
Preferably, in the step 1), KDM4E genes are selected from ox KDM4E genes reading frame (such as SEQ.ID.NO.1 institutes
Show), using pcDNA3.1 (+) expression vector as skeleton carrier；
In the step 2), 1~1.5h after carrying out electro' asion to reconstructed volume selects the bovine somatic cells clone of successful fusion
Embryo carries out following activation processing：First in the mSOF solution containing 5 μm of ol/L ionomycins in 25 DEG C be incubated 4min, then containing
4~4.5h is cultivated in the mSOF solution of 2mmol/L 6-DMAP；
The mSOF solution is basic culture solution, BME, volume fraction 1% also containing volume fraction 2% with SOF solution
MEM, the glutamine of ITS, 1mmol/L of volume fraction 1%, 80mg/mL BSA, 100IU/mL penicillin and
The streptomysin of 0.1mg/mL；
The electro' asion includes the following steps：Reconstructed volume is pre-equilibrated into 3min in electro' asion liquid；Then in donorcells
It shocks by electricity 1 time with applying at enucleation oocyte film contact surface, for the voltage used that shocks by electricity for 35V, the burst length is 10 μ s；
In the step 3), renewal cultivation includes the following steps：Bovine somatic cells clone embryos are shifted after activation is handled
To 1.5~2h of culture in mSOF solution；Bovine somatic cells clone embryos are placed in the 10%FBS's containing volume fraction when microinjection
In M199 culture solutions；The lasting culture includes the following steps：18~20 pieces of bovine somatic cells through microinjection processing are cloned
Embryo continues the culture in 120~150 μ L mSOF solution and then absorbs 60~75 μ L original fluids to 72~96h, adds same
The fresh mSOF solution of sample volume continues culture to 7~8d.
Compared with prior art, the present invention has technique effect beneficial below：
The present invention constructs the carrier for in-vitro transcription KDM4E gene mRNAs, gained mRNA injection bovine somatic cells clones
The active KDM4E albumen of histone demethylase can have been translated after in embryo, can effectively weaken bovine somatic cells clone embryos
It is horizontal in histone H 3 K9me3 and the H3K9me2 epigenetic modification in zygote activation period.The results show that the present invention can be significantly
The developmental rate and quality for improving bovine somatic cells cloned blastocysts, can efficiently produce bovine somatic cells clone embryos, can be applied to carry in vitro
High ox cloning efficiency.
Further, the mRNA of present invention injection bovine somatic cells clone embryos can be with fusion expression of green fluorescent protein EGFP
Gene and KDM4E genes can be used for quick screening of histone H3K9me3 and H3K9me2 epigenetic modification after microinjection
The bovine somatic cells clone embryos that level weakens.
Further, the present invention is based on " bovine somatic cells clone embryos compare IVF Embryos KDM4E in 8 cell stages
The KDM4E genes of the discovery of the expression that gene has notable exception low ", expression are originated from ox, have both facilitated development produced in vitro
Bovine somatic cells clone embryos are also beneficial to realize stable, safe and efficient produced in vitro bovine somatic cells clone embryos.
Further, the object that the present invention expresses is the complete reading frame of ox KDM4E genes, with function of injection deletion mutation
The control group of type mRNA with do not inject group and compare, the wild type KDM4E gene mRNAs for injecting doses and concentration can be in ox body
The active KDM4E albumen of zygote activation successful expression early period of cell clone embryo, to effectively weaken somatic cell clone
Embryo is horizontal in histone H 3 K9me3 and the H3K9me2 epigenetic modification in zygote activation period.
Further, the carrier that the present invention is built has Kozak sequences, stablizes translation after mRNA can be promoted to inject, carries
The developmental rate and quality of high later stage bovine somatic cells cloned blastocysts are conducive to external efficiently production bovine somatic cells clone embryos.
Further, pcDNA3.1 (+) carrier that the present invention uses contains T7 promoters, and it is a large amount of to be suitable for in-vitro transcription
mRNA。
Description of the drawings
Fig. 1 is the histone H 3 K9me3 (red) of bovine somatic cells clone embryos and IVF Embryos in embryo's each period
With H3K9me2 (green) epigenetic modification level, white is the nucleus of DAPI dyeing.
Fig. 2 is the KDM4 family gene expressions of bovine somatic cells clone embryos and IVF Embryos in 8 cell stages.
Fig. 3 is the vector construction flow diagram of in-vitro transcription KDM4E genes wild type and afunction saltant type mRNA
(illustrate reading frame, the EGFP labels of KDM4E, the row of the Expression elements such as Kozak sequences and pcDNA3.1 (+) multiple cloning sites
Row relationship).
Fig. 4 is the real-time fluorescence quantitative PCR result after bovine somatic cells clone embryos microinjection KDM4E gene mRNAs.
Fig. 5 is KDM4E overexpression design sketch in 8 cell stage bovine somatic cells clone embryos.
Fig. 6 is the microscopical view through microinjection KDM4E gene mRNAs treated bovine somatic cells cloned blastocysts.
Fig. 7 be blastula stage bovine somatic cells clone embryos KDM4E (wild type) overexpressions and control group (saltant type) and
Cell number microscopic analysis that group is compared is not injected as a result, wherein：CDX2 is the specific expression protein of trophocyte in blastaea.
Specific implementation mode
The present invention is described in further details with reference to the accompanying drawings and examples.The embodiment is the solution to the present invention
It releases rather than limits.
By immunofluorescence dyeing technology, find bovine somatic cells clone embryos in zygote activation early stage (8 cell stage) tool
Have the histone H 3 lysine K9 of unusual high levels 3 methylate (H3K9me3) and 2 methylate (H3K9me2), and Fig. 1 results
It has been shown that, bovine somatic cells clone embryos compare IVF Embryos in 8 cell stages, the histone with unusual high levels
H3K9me3 and H3K9me2 epigenetic modifications.In addition, by real-time fluorescence quantitative PCR, determine bovine somatic cells clone embryos this
Histone methylated (Fig. 2 results display ox related with KDM4E genes of its own exception low expression level of one unusual high levels
Somatic cell clone embryo compares the genes such as IVF Embryos KDM4A, KDM4B, KDM4C without significantly expression in 8 cell stages
Difference and expression quantity is extremely low, it is horizontal that KDM4D and KDM4E genes all have significantly abnormal low expression, but KDM4D gene expression abundances do not have
KDM4E genes are high, and gene quantification PCR detection primer sequences refer to table 1), it is final to determine that KDM4E plays main demethyl and is turned into
With.Albumen expressed by KDM4E genes goes first for specificity removal histone H 3 K9me3 and H3K9me2 epigenetic modification
Base enzyme.The endogenous defective expression factor K DM4E for causing bovine somatic cells clone embryos cloning efficiency low is identified as a result,.Root
Upper according to this to find, it is thin effectively to weaken body for the artificial overexpression KDM4E albumen before somatic cell clone embryo's zygote activation period
Born of the same parents' clone embryos are horizontal in histone H 3 K9me3 and the H3K9me2 epigenetic modification in zygote activation period, improve bovine somatic cells
The endogenous of clone embryos reprograms obstacle, achievees the purpose that promote somatic cell clone embryo's normal development.
Accordingly, the present invention provides the processing methods of the bovine somatic cells clone embryos built based on body-cell neucleus transplanting, will
After bovine somatic cells inject non-nucleus egg mother cell and carry out electro' asion and activation, that is, 1.5 after the completion of reconstructed volume is built
~2h injects bovine somatic cells clone embryos using microinjection technique the mRNA of ox KDM4E genes, and bovine somatic cells is made to clone embryo
Tire overexpression ox KDM4E albumen corrects the histone methylated of bovine somatic cells clone embryos unusual high levels, to improve ox body
Cell clone quality of blastocysts and developmental rate, and improve clened cows birth rate.It is described as follows：
(1) source of reagent, culture solution and treatment fluid or preparation method
DMEM/F12 fluid nutrient mediums, PBS, TE buffer solution, superfine fetal calf serum (FBS), M199 culture solutions (including contain
The culture liquid product of HEPES and the culture liquid product without HEPES), BME and MEM be Gibco products.H3K9me3 and
The antibody of H3K9me2 is purchased from Abcam companies, and article No. is respectively ab8898 and ab1220；CDX2 antibody is purchased from BioGenex companies,
Article No. is AM392.Using Thermo Products ITS-G, (i.e. the ITS of sodium selenite dissolving, ITS-G includes two hatching eggs to ITS
In vain：Insulin and transferrins).Ionomycin, 6-DMAP, hyaluronidase, cytochalasin B, Hoechst 33342,
DAPI, paraffin oil and other not specified reagents are Sigma Products.
A, oocyte in vitro maturation culture solution
Above-mentioned maturation culture solution is addition 2.2mg/mL NaHCO in the M199 culture solutions without HEPES3、0.075IU/mL
HMG (people's menopause menotropins), 1 μ g/mL, 17 β-E2, 0.33mM Sodium Pyruvates, 2mM L-Glutamines and 100IU/mL it is green
Mycin and 100 μ g/mL streptomysins.
B, mSOF solution
MSOF solution is using SOF culture solutions as basic culture medium, also includes BME, the volume fraction of volume fraction 2%
1% MEM, the glutamine of ITS, 1mmol/L of volume fraction 1%, 80mg/mL BSA, 100IU/mL penicillin and
The streptomysin of 0.1mg/mL；
It is prepared by SOF solution：By the KH of KCl, 0.162g of NaCl, 0.0534g of 0.6294g2PO4, 0.0172g
CaCl2·2H2O, the MgCl of 0.00996g2·6H2O, the NaHCO of 0.2106g3, 0.0033g Sodium Pyruvate and 28.24 μ L
Sodium lactate is added in 98mL water, 1mM NaOH tune pH to 7.2~7.4, deionized water constant volume to 100mL.
C, electro' asion liquid
The group of electro' asion liquid becomes：0.3mol/L mannitol, 0.05mol/L calcium chloride, 0.1mol/L magnesium sulfate,
0.27mol/L histidines and 0.1%BSA.
D, the preparation of DMEM cell culture fluids
10%FBS and 10ng/mL bFGF are added in finished product DMEM/F12 fluid nutrient mediums, are cultivated completely as cell
Liquid.0.5%FBS and 10ng/mL bFGF are added in finished product DMEM/F12 fluid nutrient mediums, as cell starvation culture solution.
(2) a large amount of ox KDM4E gene wild type mRNA and afunction saltant type mRNA are obtained in vitro
Ox KDM4E genes are located on No. 15 chromosomes, the long 1284bp of coded sequence, coded amino acid 427.Referring to Fig. 3,
(three bridge of Xi'an City, Shanxi Province and Ba bridge animal-slaughtering in fixed place are picked up from using the Trizol extraction bull testis tissues of Invitrogen companies
, acquisition time：In April, 2014) after RNA, corresponding cDNA is obtained by reverse transcription PCR, it is public using Takara as template
The High fidelity PCR enzyme PrimerStar of department obtains the reading frame overall length of wild type KDM4E genes by Standard PCR.Then splicing
Enter HindIII the and BamHI restriction enzyme sites in Clontech companies pEGFP-C1 vector multiple cloning sites region, is contained with this
The KDM4E Tandem gene expression structures of Kozak sequences and green fluorescent protein EGFP labels.The correct, sequence without mutation is sequenced
It again through NheI and BamHI digestions, is connected into the multiple cloning sites region of Invitrogen companies pcDNA3.1 (+) carrier, obtains
It may finally be as the carrier of in-vitro transcription template.The reading frame overall length of afunction saltant type KDM4E genes is fixed using band
The primer in point mutation site, is obtained by Overlap extension PCR, and it is consistent with wild type that subsequent template vector builds flow and method.
Expand the primer (making amplified production both ends addition HindIII and BamHI restriction enzyme sites) of wild type KDM4E genes
For：Upstream 5 '-CCTCAAGCTTCTATGCAGGCTAAGC-3 '；Downstream 5 '-GCTCGGATCCTCATATCTGAGTCTT-3 '.Expand
Increase saltant type KDM4E genes rite-directed mutagenesis primer be：Upstream 5 '-GCAGGAGGACATGGACCTTTATAG-3 '；Downstream 5 '-
TGCTGCCAGGCGAAGGCGGTCTTC-3’。
Expanding obtained KDM4E gene reading frame nucleic acid sequences (SEQ.ID.NO.1, SEQ.ID.NO.2) is：
5’-ATGCAGGCTAAGCACTTTGGTTCCCAGAACCCAAGTTGTAAGATCATGACCTTCCACCCAACTATG
GAAGAATATGCGGATTTCAACAAATACATTGCTTACATAGAATCGCAAGGGGCCCACCGAGCAGGCTTGGCTAAGAT
AGTGCCACCCAAGGAATGGAAAGCCAGACAGACCTACGACGATATCGATGACATCTTAATAGCCGCTCCGCTCCAGC
AGGTGGTCTCTGGGCGGGCAGGTGTGTTTACTCAATACCACAAAAAGAAGAAAGCCATGACCGTGGCAGAGTACCGC
CACTTAGCAAATACTGAAAAATACCAGACTCCATTCTACTCCGATTTTGAGGAATTGGAGCGAAAATATTGGAAAAC
CCGCCTCTTTGAGTCCCCAATATACGGCGCGGACATCAGTGGCTCTTTATTTGATGAAAACACGAAGCAGTGGAACC
TGGGACGCCTGGGGACCATCCAGGACCTGCTGGAGCAGGAGTGCGGGGTGGTCATCGAGGGCGTCAACACCCCCTAC
CTGTACTTCGGCATGTGGAAGACCGCCTTCGCCTGGCACAC(GCA)GGAGGACATGGACCTTTATAGCATCAACTTC
CTGCACTTCGGGGAGCCCAAGACCTGGTACGCGGTGCCACCCGAGCACGGCCGGCGCCTGGAACGCCTGGCCGGCGC
GCTCTTCCCGGGCAGCTCGAGGGGCTGCGAGGCCTTCCTGCGCCACAAGGCGGCGCTCATCTCGCCCACGGTGCTCC
GGGACAACGGCATCCCCTTCGGTCGGGTCACGCAGGAGGCGGGCGAGTTCATGGTGACCTTCCCCTACGGCTACCAC
TCGGGCTTCAACCACGGCTTCAACTGCGCCGAGGCCATCAATTTCGCCACCCCGCGCTGGATCGATTATGGCAAAGT
GGCCTCGCAGTGCAGCTGCGGCGAGGCGCAGGTGGCCTTCTCCATGGACGCCTTCGTGCGCATCCTGCAGCCCGAGC
GCTATGAGCTGTGGAAGCGCGGGCAGGACCGGGCGGTGGTGAACCACGCCGAGCCCGCGGCGCCGGGCGGCCAGGAG
CTGAGTGCCTGGAGGGAGGTGCACTCGCCCTGGGGAACCCGGCTCGCCTGCAATTCCCAGGAGCCGCGCCAGACCCC
GCCGCGGACGCCAGGTCCATCTCCTCCAGATCACCACCCAACTGGCAGATGTGTTTCTCGTCGTCGTCGTCCTCGGA
AAAGGGGTACTCCAGAGCTGACTGTCCGACCCGGGCGAAGAGGAGCCTCTCCAAAGACTCAGATATGA-3’
In the above sequence, the mutational site of underscore display function deficient mutant KDM4E genes, the interior display mutation of bracket
Sequence results afterwards.
The reading frame of amplification wild type KDM4E is to obtain the nucleic acid sequence of the correct expressing K DM4E albumen of energy, inserted
Enter in the expression vector of the promoter containing T7, you can go out phase according to reading frame nucleic acid sequence efficient transcription using in-vitro transcription kit
MRNA is answered, correct peptide chain can just be translated by being subsequently injected into bovine somatic cells clone embryos, and be assembled into active KDM4E eggs
In vain.The purpose of complex functionality deficient mutant gene is, as without the active control sample of histone methylase is gone, to disappear
The influence that bovine somatic cells clone embryos are developed except experiments Microinjection.Kozak sequences are GCCACC, certainly for pEGFP-C1 carriers
Band element, is added in the front end of reading frame sequence ATG, and the mRNA transcribed out is promoted effectively to be combined with ribosomes, ensures translation
It is normally carried out.To KDM4E protein fusion expression EGFP labels, convenient for the translation effect of visual inspection target gene injection, and track
The subcellular localization of target gene.
Institute's structure carrier then carries out staying overnight linearization for enzyme restriction (Fig. 3) using the PciI restriction enzymes of NEB companies, then
Through 1% agarose gel electrophoresis (120V) 30min.The sample fully cut uses the AxyPrep DNA gels of Axygen companies
QIAquick Gel Extraction Kit carries out glue recycling and obtains template.Next the mRNA in-vitro transcription kits mMESSAGE of Ambion companies is used
MMACHINE T7Ultra Kit, by capping transcription and Poly (A) tailings reactions, it includes largely ox KDM4E bases to obtain
It is pure to product progress by the RNA extracts kits RNeasy Mini Kit of Qiagen companies because of the mRNA of transcription product, and again
Change.The tri-distilled water of no RNase is finally used to dilute mRNA to 800ng/ μ L, wherein KDM4E mRNA effective concentrations are 500ng/ μ
L, the microinjection for subsequent bovine somatic cells clone embryos operate.
(3) preparation of somatic cell nuclear transfer technique production bovine somatic cells clone embryos and processing procedure
A. the preparation of donor bovine fetal fibroblast
It (is acquired from the bovine fetal fibroblast taken in liquid nitrogen container within 5 generations from Yangling Keyuan Clone Co., Ltd.
Cattle farm, acquisition time：In January, 2014 in March, 2016) after 38 DEG C of defrostings, the DMEM cell complete culture solution mixings for adding 1mL
1000rpm centrifuges 5min.Supernatant is abandoned, cell is resuspended in the cell complete culture solution for adding 4mL new, and is inoculated in the cell culture of 60mm
In ware, 38.5 DEG C are placed in, 5%CO2It is cultivated in incubator, next day changes liquid.Wait for that bovine fetal fibroblast reaches 90% and converges journey
When spending, culture solution is abandoned in suction, rinses cell with PBS, TE buffer solution vitellophags are added.Cell is observed under inverted microscope, is waited for
When most cells bounce back, are rounded, space between cells expands, digestion is terminated with new DMEM cell complete culture solutions, uses pipettor
It centrifuges and suspends after piping and druming, be uniformly inoculated in 24 orifice plates, be placed again into incubator and cultivate.Next day is by the culture of donorcells
Liquid replaces with cell starvation culture solution, and cells arrest is can induce after 48h in G0/G1 cell cycles, as suitable donorcells.
B. the maturation culture of egg mother cell
Ox ovary picks up from three bridge of Xi'an City, Shanxi Province and Ba bridge animal-slaughtering in fixed place field (acquisition time：In January, 2014 was to 2016
March), ovary is dipped in the physiological saline heat preservation bottle containing penicillin and streptomycin, 20~25 DEG C of water temperature transports laboratory back within 5h.Ovum
After nest is transported back, the extra connective tissue of Ovarian surface is wiped out with sterilizing scissors, bloodstain is cleaned in sterile saline.With equipped with
The 10mL syringes of 12G syringe needles extract the liquor folliculi of Ovarian surface 2~8mm ovarian follicles, and liquid is then squeezed into 60mm cell culture
In ware, cumulus oocytes complesxes (COCs) are collected under stereomicroscope.The COCs of collection is containing 5~15%FBS's
It is cleaned three times in PBS, and selects morphologically normal A, B grade of egg mother cell for In-vitro maturation.A grades of egg mother cells are cytoplasm
Uniformly, cumulus cell is fine and close, be at least of five storeys the fully wrapped around egg mother cell of cumulus cell；The cumulus cell of B grades of egg mother cells is
2~4 layers, substantially wrap up egg mother cell.Qualified COCs is washed twice in oocyte in vitro maturation culture solution, is then moved into
In the 35mm culture dishes of above-mentioned maturation culture solution equipped with 4mL preheatings, in 38.5 DEG C, 5%CO2, cultivate under the conditions of saturated humidity
20~for 24 hours.The ripe egg mother cell of culture is put into containing 0.1% hyaluronidase without Ca2+、Mg2+In PBS digestion 1~
2min is used in combination liquid-transfering gun to blow and beat repeatedly, to remove the cumulus cell sticked outside egg mother cell.After piping and druming is clean, 3 are washed in PBS
It is secondary, then egg mother cell is stirred with glass needle under entity stereomicroscope, the egg mother cell for selecting polar body is for use.
C. the structure of bovine somatic cells clone embryos
Stoning：Egg mother cell is first containing 7.5 μ g/mL cytochalasin Bs, 10 μ g/mL Hoechst 33342 before stoning
It is incubated 15min in the M199 culture solutions of volumetric concentration 10%FBS；Then under micromanipulation instrument, it is 20 μm with internal diameter and goes
Core pipe draws first polar body and surrounding ooecium matter, and the ooecium matter that ultraviolet light is sucked out is to check stoning situation；It goes completely
Except the egg mother cell of first polar body and chromosome can be used for nuclear transfer.
Note donorcells and electro' asion：A diameter of 15~20 μm of bovine somatic cells to be transplanted (donorcells) are selected, are injected
To under the oolemma of enucleation oocyte.Reconstructed volume after note core is merged using the method for microelectrode.Carrying out electro' asion
Before, reconstructed volume pre-equilibrates 3min in electro' asion liquid.Two zigzag microelectrode top end diameters for mixing operation are 15 μm,
Rear end is connected on micromanipulation instrument, is in a line by the donorcells of reconstructed volume and enucleation oocyte film contact surface and two electrodes
It clamps, fusion parameters are：Voltage is 35V, and the burst length is 10 μ s, and electric shock is primary.1h observes fusion under the microscope after fusion
Situation abandons the reconstructed volume merged not successfully suction, reconstructed volume, that is, bovine somatic cells clone embryos (1 cell stage) of successful fusion.
D, the activation of bovine somatic cells clone embryos
1~1.5h after electro' asion, the bovine somatic cells clone embryos (1 cell stage) for selecting successful fusion carry out below successively
Activation is handled：25 DEG C of incubation 4min in mSOF solution containing 5 μm of ol/L ionomycins, then containing 2mmol/L6-DMAP's
In mSOF solution, in 38.5 DEG C, 5%CO2, cultivate 4h under the conditions of saturated humidity.Bovine somatic cells clone embryos are at line activating
After reason, it is transferred in mSOF solution (every 120~150 μ L mSOF drops contain 18~20 embryos), in 38.5 DEG C, 5%CO2, it is full
After cultivating 1.5~2h (renewal cultivation) under damp condition, microinjection operation is carried out.
E, the microinjection of bovine somatic cells clone embryos
It is by the volume fraction that the bovine somatic cells clone embryos of 1.5~2h of renewal cultivation are transferred to preheating in mSOF solution
In the culture solution drops of M199 containing HEPES of 10%FBS.It is placed in and is equipped with Eppendorf company micromanipulation arm TransferMan
On the inverted microscope of NK2 and microinjection air pump FemtoJet.Microinjection glass needle is Eppendorf companies
Femtotip II type products (are contained 800ng/ μ LmRNA prepared above by the Microloader of Eppendorf companies
The afunction saltant type mRNA of 500ng/ μ L oxen wild type KDM4E gene mRNAs or ox KDM4E genes) it injects at needle point.Often
A embryo about injects the mRNA of 10pL, and diffusivity, which occurs, with embryo's cytoplasm is diluted to the standard successfully injected.
F, the culture of bovine somatic cells clone embryos and coherent detection project
Bovine somatic cells clone embryos through microinjection processing continue in mSOF solution (every 120~150 μ L mSOF drops
Containing 18~20 embryos, as being also covered with paraffin oil on the mSOF solution of culture medium, and in advance in CO2Balanced in incubator to
Few 2h) in 38.5 DEG C, 5%CO2, culture is to 72h (0h is at the time of being transferred to mSOF after Embryo activation) under the conditions of saturated humidity, so
60~75 μ L original fluids are absorbed afterwards, add the fresh mSOF solution of same volume, are continued in 38.5 DEG C, 5%CO2, saturation it is wet
It is cultivated to 7d under the conditions of degree.ASSOCIATE STATISTICS (table 3) is made to cleavage rates, 8 cell stage developmental rates and blastocyst rate during this,
Utilize microscopical view such as Fig. 6 of bovine somatic cells cloned blastocysts prepared by the processing method of the present invention.Subsequent blastaea is by the injection same period
The cornua uteri of Hong'an Gus's recipient cattle of heat, to detect the birth efficiency (table 5) of final clened cows.In addition, to processing procedure
2 cell stages, 4 cell stages, 8 cell stages, mulberry body and the blastaea of middle gained carry out cracking and reverse transcription PCR, pass through reality
When quantitative fluorescent PCR, judge the injection situation and expression pattern (Fig. 4) of ox wild type KDM4E gene mRNAs.What is be related to quantifies
PCR detection primer sequences refer to table 1.Finally, the bovine somatic cells for collecting processing gained clone 8 cell stages and blastaea, by exempting from
Epidemic disease fluorescent staining technique judges the bovine somatic cells clone embryos using the processing method preparation of the present invention in 8 cell cycles
The epigenetic modification situation (table 2, Fig. 5) of H3K9me3 or H3K9me2, and the blastaea to finally developing carry out cell number inspection
It surveys (table 4, Fig. 7).
1. real-time fluorescence quantitative PCR primer sequence of table
(4) testing result
The processing method of the present invention can significantly improve the developmental rate and quality of bovine somatic cells cloned blastocysts, can in vitro efficiently
Bovine somatic cells clone embryos are produced, and improve the production efficiency of clened cows.It is embodied in：
1) epigenetic of the overexpression effect of KDM4E and H3K9me3 and H3K9me2 in bovine somatic cells clone embryos
The horizontal variation of modification
To bovine somatic cells clone embryos injection ox wild type KDM4E gene mRNAs (processing group) and the mutation of its afunction
Type mRNA (control group) makes embryo's overexpression carry the wild type KDM4E albumen of EGFP labels or express its afunction and dashes forward
Modification albumen.2 cell stages, 4 cell stages, 8 cell stages, mulberry body and the blastaea of processing gained are cracked first
And reverse transcription PCR judges the injection situation and expression mould of ox wild type KDM4E gene mRNAs by real-time fluorescence quantitative PCR
Formula.The results show that KDM4E gene mRNA high levels were present in 2 to the 8 cell stage period of bovine somatic cells clone embryos, it is significantly high
In the bovine somatic cells clone embryos that do not inject, mulberry body and the downward of the blastaea period mRNA are mainly due to the translation of mRNA later
The generation (Fig. 4) of degradation mechanism afterwards.
In addition, collecting processing group, control group and the 8 cell stage embryos for not injecting group after 72h, immunofluorescence dyeing detects embryo
The epigenetic modification of tire H3K9me3 and H3K9me2 are horizontal.As shown in figure 5, white is the nucleus (first of DAPI dyeing
Row), red is the immunostaining (the second row) of embryo H3K9me3 or H3K9me2, and green is that embryo's expression carries green fluorescence egg
The KDM4E albumen (the third line) of white EGFP.The results show that the mRNA microinjections amount of 10pL 800ng/ μ L is enough in body cell
Expressing K DM4E in clone embryos, and go histone H 3 K9me3 and H3K9me2 function uninfluenced accordingly, illustrate KDM4E's
Overexpression effect is normal.It does not inject or the mRNA of the KDM4E of function of injection deficient mutant can not remove 8 cell stage oxen
The intraembryonic histone H 3 K9me3 and H3K9me2 of somatic cell clone.As shown in table 2, KDM4E is in bovine somatic cells clone embryos
The removal efficiency of the apparent modifications of H3K9me3 and H3K9me2 is respectively H3K9me3：95.0 ± 4.6%vs, 37.1 ± 6.8% Hes
35.8 ± 4.8%；H3K9me2：91.4 ± 5.5%vs 28.9 ± 10.4% and 32.1 ± 4.7% (P<0.05).
The influence of 2. overexpression KDM4E of table modification removals apparent to bovine somatic cells clone embryos H3K9me3 and H3K9me2
Note：Every group of experiment all repeats five times.H3K9me3 and H3K9me2 epigenetic modifications removal efficiency (mean ±
SD%).The data in same column, subscript difference indicate significant difference (P<0.05).
According to Fig. 5 and table 2, it is thin not simply fail to removal 8 for the overexpression of the KDM4E of afunction saltant type in control group
Histone H 3 K9me3 and H3K9me2 in born of the same parents' period bovine somatic cells clone embryos, and with do not inject group it is histone methylated
There is some difference for abnormal embryo's ratio (although not significantly), shows using expressed intact KDM4E when processing method of the present invention
The importance of albumen.
2) developmental rate of bovine somatic cells cloned blastocysts
As shown in table 3 and Fig. 6, the influence that overexpression KDM4E develops bovine somatic cells clone embryos includes：Processing group capsule
The developmental rate of embryo significantly improves about 15~20%, is 48.6 ± 5.1%vs 27.3 ± 4.8% and 30.7 ± 3.5% (P<
0.05).As a result compared with showing with control group and not injecting group, the mRNA of injection ox wild type KDM4E genes can be significantly improved
The developmental rate of ox cloned blastocysts.
Influences of the 3. overexpression KDM4E of table to bovine somatic cells clone embryos developmental rate
Note：Every group of experiment all repeats five times.Data in bracket are developmental rate (mean ± SD%).2 cell stages, 8 are carefully
In recombination embryo culture 36h, 72h and 7d detection, (0h is transferred to mSOF to the developmental rate of blastula tire and blastaea after representing Embryo activation respectively
At the time of).The data in same column, subscript difference indicate significant difference (P<0.05).
3) testing result of bovine somatic cells cloned blastocysts cell number
As shown in fig. 7, blue (the third line) and the nucleus that white (the first row) is DAPI dyeing, indicate that blastomere is total
Number；Red is the immunostaining (CDX2 tag antibodies, the second row) of trophocyte；Composite diagram (closing figure) is that differential dyeing is shown
As a result, pink is trophocyte, blue is inner cell mass cells (the third line).As a result display with control group and do not inject group
It compares, the mRNA of injection ox wild type KDM4E genes can significantly improve the inner cell mass cells number in ox cloned blastocysts.By table
4 it can also be seen that blastaea its total number of cells that the processing method of the present invention obtains are significantly higher than control group (131.9 ± 39.2vs
110.8 ± 27.1, P<0.05), with do not inject group and be not significantly different；Its inner cell mass cells of the blastaea that this processing method obtains
Number is significantly higher than control group and does not inject group (34.1 ± 15.0vs 21.0 ± 11.9 and 26.2 ± 12.5, P<0.05)；This processing
Its inner cell mass cells number ratio of the blastaea that method obtains is significantly higher than control group and does not inject group (34.6 ± 12.7%vs
23.6 ± 12.0% and 27.9 ± 9.3%, P<0.05).
Influences of the 4. overexpression KDM4E of table to bovine somatic cells clone embryos cell number
Note：Every group of sample is that all results of repetition experiment summarize (mean ± SD).Data subscript is not in same column
With expression significant difference (P<0.05).
4) birth rate of bovine somatic cells cloned blastocysts
As shown in table 5, embryo's histone methylated H3K9me3 and H3K9me2 levels are reduced based on overexpression KDM4E
Processing method is remarkably improved the birth rate of cloned animal.The internal developmental potency for the blastaea that this processing method obtains is significantly high
Group (23.6 ± 4.2%vs 12.1 ± 7.6% and 7.0 ± 6.8%, P are not injected in control group and<0.05).
Influences of the 5. overexpression KDM4E of table to bovine somatic cells cloned animal birth rate
Note：7d blastaeas are subsequently injected into the cornua uteri of Hong'an Gus's recipient cattle of estrus synchronization, and every recipient cattle transplants 1 piece
Embryo.Every group of sample is that the experimental result repeated five times summarizes (mean ± SD%).The data in same column, subscript difference table
Show significant difference (P<0.05).
It is experimentally confirmed：With injection ox KDM4E genes Loss-of-function mutant mRNA control group and do not inject
Group is compared, and the mRNA of injection ox wild type KDM4E genes can significantly reduce somatic cell clone embryo in zygote activation period
Histone H 3 K9me3 and H3K9me2 epigenetic modification level (Fig. 5, table 2) (P<0.05) hair of blastaea can, be significantly improved
Educate rate (Fig. 6, table 3), the ICM in inner cell mass cells number and blastaea in blastaea:TE ratios (Fig. 7, table 4) (P<0.05).This
Outside, the birth rate of embryo transfer rear clone ox also significantly improves (table 5).
In the present invention, first according to Fig. 1, Fig. 2 determine KDM4E 8 cell stage of embryo remove H3K9me3 and
It plays a major role during H3K9me2 epigenetic modifications, assert that KDM4E is endogenous defective table in bovine somatic cells clone embryos
The factor reached, and its mRNA is obtained by in-vitro transcription, artificial compensation expressing K DM4E is carried out to bovine somatic cells clone embryos.Choosing
It is and other albumen in family because KDM4E is the factor that endogenous defective is expressed in a bovine somatic cells clone embryos to take KDM4E
It is not, it is believed that be overexpressed KDM4E in bovine somatic cells clone embryos and more meet original gene expression pattern in embryo.At
Ox embryo's microinjection of work(needs to observe the phenomenon that embryo's after birth slightly expands, and cytoplasm slightly dilutes.Injection dosage is general
Concentration for 8~10pL, the mRNA solution of injection is more than that 1200ng/ μ L be easy to cause injection needle blocking, in 800ng/ μ L
Can then have an impact below to demethylation effect.MRNA without Kozak sequences can cause KDM4E protein translation expression quantity to drop
It is low, enough removal H3K9me3 and H3K9me2 rhetorical functions are played to influence KDM4E in embryo, it is final to influence experiment knot
Fruit.
In short, overexpression ox KDM4E albumen, can effectively weaken bovine somatic cells clone embryos zygote activation period group
Albumen H3K9me3 and H3K9me2 epigenetic modification are horizontal, to significantly improve the developmental rate of later stage bovine somatic cells cloned blastocysts
And quality, bovine somatic cells clone embryos can be efficiently produced in vitro, and improve the birth rate of embryo transfer rear clone ox.
Sequence table
<110>Xibei Univ. of Agricultural ＆ Forest Science ＆ Technology
<120>A kind of carrier and method improving ox cloning efficiency based on histone methylated horizontal modification
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1284
<212> DNA
<213> Bos taurus
<400> 1
atgcaggcta agcactttgg ttcccagaac ccaagttgta agatcatgac cttccaccca 60
actatggaag aatatgcgga tttcaacaaa tacattgctt acatagaatc gcaaggggcc 120
caccgagcag gcttggctaa gatagtgcca cccaaggaat ggaaagccag acagacctac 180
gacgatatcg atgacatctt aatagccgct ccgctccagc aggtggtctc tgggcgggca 240
ggtgtgttta ctcaatacca caaaaagaag aaagccatga ccgtggcaga gtaccgccac 300
ttagcaaata ctgaaaaata ccagactcca ttctactccg attttgagga attggagcga 360
aaatattgga aaacccgcct ctttgagtcc ccaatatacg gcgcggacat cagtggctct 420
ttatttgatg aaaacacgaa gcagtggaac ctgggacgcc tggggaccat ccaggacctg 480
ctggagcagg agtgcggggt ggtcatcgag ggcgtcaaca ccccctacct gtacttcggc 540
atgtggaaga ccgccttcgc ctggcacacg gaggacatgg acctttatag catcaacttc 600
ctgcacttcg gggagcccaa gacctggtac gcggtgccac ccgagcacgg ccggcgcctg 660
gaacgcctgg ccggcgcgct cttcccgggc agctcgaggg gctgcgaggc cttcctgcgc 720
cacaaggcgg cgctcatctc gcccacggtg ctccgggaca acggcatccc cttcggtcgg 780
gtcacgcagg aggcgggcga gttcatggtg accttcccct acggctacca ctcgggcttc 840
aaccacggct tcaactgcgc cgaggccatc aatttcgcca ccccgcgctg gatcgattat 900
ggcaaagtgg cctcgcagtg cagctgcggc gaggcgcagg tggccttctc catggacgcc 960
ttcgtgcgca tcctgcagcc cgagcgctat gagctgtgga agcgcgggca ggaccgggcg 1020
gtggtgaacc acgccgagcc cgcggcgccg ggcggccagg agctgagtgc ctggagggag 1080
gtgcactcgc cctggggaac ccggctcgcc tgcaattccc aggagccgcg ccagaccccg 1140
ccgcggacgc caggtccatc tcctccagat caccacccaa ctggcagatg tgtttctcgt 1200
cgtcgtcgtc ctcggaaaag gggtactcca gagctgactg tccgacccgg gcgaagagga 1260
gcctctccaa agactcagat atga 1284
<210> 2
<211> 1284
<212> DNA
<213>Artificial sequence ()
<400> 2
atgcaggcta agcactttgg ttcccagaac ccaagttgta agatcatgac cttccaccca 60
actatggaag aatatgcgga tttcaacaaa tacattgctt acatagaatc gcaaggggcc 120
caccgagcag gcttggctaa gatagtgcca cccaaggaat ggaaagccag acagacctac 180
gacgatatcg atgacatctt aatagccgct ccgctccagc aggtggtctc tgggcgggca 240
ggtgtgttta ctcaatacca caaaaagaag aaagccatga ccgtggcaga gtaccgccac 300
ttagcaaata ctgaaaaata ccagactcca ttctactccg attttgagga attggagcga 360
aaatattgga aaacccgcct ctttgagtcc ccaatatacg gcgcggacat cagtggctct 420
ttatttgatg aaaacacgaa gcagtggaac ctgggacgcc tggggaccat ccaggacctg 480
ctggagcagg agtgcggggt ggtcatcgag ggcgtcaaca ccccctacct gtacttcggc 540
atgtggaaga ccgccttcgc ctggcagcag gaggacatgg acctttatag catcaacttc 600
ctgcacttcg gggagcccaa gacctggtac gcggtgccac ccgagcacgg ccggcgcctg 660
gaacgcctgg ccggcgcgct cttcccgggc agctcgaggg gctgcgaggc cttcctgcgc 720
cacaaggcgg cgctcatctc gcccacggtg ctccgggaca acggcatccc cttcggtcgg 780
gtcacgcagg aggcgggcga gttcatggtg accttcccct acggctacca ctcgggcttc 840
aaccacggct tcaactgcgc cgaggccatc aatttcgcca ccccgcgctg gatcgattat 900
ggcaaagtgg cctcgcagtg cagctgcggc gaggcgcagg tggccttctc catggacgcc 960
ttcgtgcgca tcctgcagcc cgagcgctat gagctgtgga agcgcgggca ggaccgggcg 1020
gtggtgaacc acgccgagcc cgcggcgccg ggcggccagg agctgagtgc ctggagggag 1080
gtgcactcgc cctggggaac ccggctcgcc tgcaattccc aggagccgcg ccagaccccg 1140
ccgcggacgc caggtccatc tcctccagat caccacccaa ctggcagatg tgtttctcgt 1200
cgtcgtcgtc ctcggaaaag gggtactcca gagctgactg tccgacccgg gcgaagagga 1260
gcctctccaa agactcagat atga 1284
<210> 3
<211> 25
<212> DNA
<213>Artificial sequence ()
<400> 3
cctcaagctt ctatgcaggc taagc 25
<210> 4
<211> 25
<212> DNA
<213>Artificial sequence ()
<400> 4
gctcggatcc tcatatctga gtctt 25
<210> 5
<211> 24
<212> DNA
<213>Artificial sequence ()
<400> 5
gcaggaggac atggaccttt atag 24
<210> 6
<211> 24
<212> DNA
<213>Artificial sequence ()
<400> 6
tgctgccagg cgaaggcggt cttc 24
<210> 7
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 7
tcctccagat caccacccaa 20
<210> 8
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 8
tcgtccacac ccaagaacag 20
<210> 9
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 9
gtcttggagt acctgaccgc 20
<210> 10
<211> 20
<212> DNA
<213>Artificial sequence ()
<400> 10
agtcttcttc gggagcaaca 20
Claims (10)
1. a kind of in-vitro transcription template vector, it is characterised in that：The carrier includes the recombination table for expressing aim sequence
Up to box, the aim sequence includes KDM4E genes, which there is coding to remove histone H 3 K9 methylase KDM4 protein families
Determine the critical sites sequence of enzymatic activity.
2. a kind of in-vitro transcription template vector according to claim 1, it is characterised in that：The aim sequence further includes and institute
State the green fluorescent protein EGFP gene of KDM4E Tandem gene expressions.
3. a kind of in-vitro transcription template vector according to claim 1, it is characterised in that：The recombinant gene expression box also wraps
Include the Kozak sequences positioned at the aim sequence upstream.
4. a kind of in-vitro transcription template vector according to claim 1, it is characterised in that：The KDM4E genes are selected from ox
KDM4E gene reading frames.
5. according to a kind of in-vitro transcription template vector of claim 1 or 4, it is characterised in that：The KDM4E genes are such as
Shown in SEQ.ID.NO.1.
6. a kind of in-vitro transcription template vector according to claim 1, it is characterised in that：The carrier is specifically included as bone
PcDNA3.1 (+) carrier of frame and be inserted in pcDNA3.1 (+) vector multiple cloning site area be arranged in order in
Kozak sequences, green fluorescent protein EGFP gene reading frame after T7 promoters contained by pcDNA3.1 (+) carrier and ox
KDM4E gene reading frames.
7. a kind of bovine somatic cells clone embryos processing method improving ox cloning efficiency based on histone methylated horizontal modification,
It is characterized in that：The processing method includes the following steps：
It is reacted through in-vitro transcription and obtains mRNA of the transcription from aim sequence, the aim sequence includes KDM4E genes, gene tool
There is the critical sites sequence that coding goes histone H 3 K9 methylase KDM4 protein families to determine enzymatic activity；The mRNA is noted again
Enter into the bovine somatic cells clone embryos completed fusion and activated, makes embryo's overexpression KDM4E albumen.
8. according to the method described in claim 7, it is characterized in that：The mRNA injection lengths are bovine somatic cells clone embryos
Before the zygote activation phase.
9. according to the method described in claim 7, it is characterized in that：The processing method specifically includes following steps：
1) in-vitro transcription of aim sequence
KDM4E genes, green fluorescent protein EGFP gene and the Kozak sequences positioned at front end are inserted into skeleton carrier；So
In-vitro transcription will be carried out after the linearized processing of the carrier afterwards, obtains being used for amalgamation and expression KDM4E genes and green fluorescence egg
The mRNA of the stabilization of white EGFP gene, 800~1200ng/ μ L are diluted to by the mRNA；
2) it is based on body-cell neucleus transplanting and builds bovine somatic cells clone embryos
Using bovine fetal fibroblast as donorcells, will be reconstructed in the bovine oocyte of donorcells injection stoning
Body carries out fusion treatment to reconstructed volume, is handled into line activating the bovine somatic cells clone embryos that fusion obtains；
3) mRNA injections and bovine somatic cells clone embryos culture
Renewal cultivation is carried out to the bovine somatic cells clone embryos by activation processing, then by mRNA obtained by step 1) according to 8~
The dosage of 10pL injects the bovine somatic cells clone embryos by microinjection；The bovine somatic cells clone embryos for injecting mRNA are held
It is continuous to cultivate to 8 cell stages or blastula stage.
10. according to the method described in claim 9, it is characterized in that：In the step 1), KDM4E genes are selected from ox KDM4E bases
Because of reading frame, using pcDNA3.1 (+) expression vector as skeleton carrier；
In the step 2), 1~1.5h after carrying out electro' asion to reconstructed volume selects the bovine somatic cells clone embryos of successful fusion
Carry out following activation processing：First in the mSOF solution containing 5 μm of ol/L ionomycins in 25 DEG C be incubated 4min, then containing
4~4.5h is cultivated in the mSOF solution of 2mmol/L 6-DMAP；
The mSOF solution is basic culture solution with SOF solution, the BME's, volume fraction 1% also containing volume fraction 2%
MEM, the glutamine of ITS, 1mmol/L of volume fraction 1%, 80mg/mL BSA, 100IU/mL penicillin and 0.1mg/
The streptomysin of mL；
The electro' asion includes the following steps：Reconstructed volume is pre-equilibrated into 3min in electro' asion liquid；Then apply electric shock 1 time, electricity
The voltage used is hit as 35V, the burst length is 10 μ s；
In the step 3), renewal cultivation includes the following steps：Bovine somatic cells clone embryos are transferred to after activation is handled
1.5~2h is cultivated in mSOF solution；Bovine somatic cells clone embryos are placed in the M199 of the 10%FBS containing volume fraction when microinjection
In culture solution；The lasting culture includes the following steps：The bovine somatic cells clone embryos that 18~20 pieces are handled through microinjection
Continue the culture in 120~150 μ L mSOF solution then to absorb 60~75 μ L culture solutions to 72~96h, add 60~75 μ L
Fresh mSOF solution, continue culture to 7~8d.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810187279.7A CN108410894A (en) | 2018-03-07 | 2018-03-07 | A kind of carrier and method improving ox cloning efficiency based on histone methylated horizontal modification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810187279.7A CN108410894A (en) | 2018-03-07 | 2018-03-07 | A kind of carrier and method improving ox cloning efficiency based on histone methylated horizontal modification |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108410894A true CN108410894A (en) | 2018-08-17 |
Family
ID=63130515
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810187279.7A Pending CN108410894A (en) | 2018-03-07 | 2018-03-07 | A kind of carrier and method improving ox cloning efficiency based on histone methylated horizontal modification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108410894A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110042123A (en) * | 2019-01-07 | 2019-07-23 | 西北农林科技大学 | A method of bovine somatic cells cloning efficiency is improved by inducing expression zfp57 |
| CN114196703A (en) * | 2021-12-22 | 2022-03-18 | 西北农林科技大学 | Vector, cell and method for improving cloned embryo development rate of yaks |
| CN116411022A (en) * | 2022-11-21 | 2023-07-11 | 华中农业大学 | Vector and cell for indicating activation degree of porcine somatic clone embryo genome |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296090A (en) * | 2011-08-29 | 2011-12-28 | 西北农林科技大学 | Method for processing bovine somatic cell cloned embryos constructed on basis of somatic cell nuclear transplantation |
| CN105524940A (en) * | 2015-12-31 | 2016-04-27 | 西北农林科技大学 | Vector, cell and method for improving bovine cloning efficiency on the basis of histone methylation modifying level |
| CN105543230A (en) * | 2016-03-02 | 2016-05-04 | 华南农业大学 | Method for improving pig cloning efficiency on basis of inhibition of H3K9me3 methylation |
-
2018
- 2018-03-07 CN CN201810187279.7A patent/CN108410894A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296090A (en) * | 2011-08-29 | 2011-12-28 | 西北农林科技大学 | Method for processing bovine somatic cell cloned embryos constructed on basis of somatic cell nuclear transplantation |
| CN105524940A (en) * | 2015-12-31 | 2016-04-27 | 西北农林科技大学 | Vector, cell and method for improving bovine cloning efficiency on the basis of histone methylation modifying level |
| CN105543230A (en) * | 2016-03-02 | 2016-05-04 | 华南农业大学 | Method for improving pig cloning efficiency on basis of inhibition of H3K9me3 methylation |
Non-Patent Citations (4)
| Title |
|---|
| CANOVAS,SEBASTIAN 等: "Jumonji domain-containing protein 3 regulates histone 3 lysine 27 methylation during bovine preimplantation development", 《PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA》 * |
| LIU Y.等: "Sequence:AC223099.1", 《EMBL-EBI》 * |
| LIU，XIN 等: "H3K9 demethylase KDM4E is an epigenetic regulator for bovine embryonic development and a defective factor for nuclear reprogramming", 《DEVELOPMENT》 * |
| ZIMIN,A.V.等: "GenBank: DAA22462.1 TPA: lysine (K)-specific demethylase 4C-like [Bos taurus]", 《GENBANK》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110042123A (en) * | 2019-01-07 | 2019-07-23 | 西北农林科技大学 | A method of bovine somatic cells cloning efficiency is improved by inducing expression zfp57 |
| CN110042123B (en) * | 2019-01-07 | 2023-01-17 | 西北农林科技大学 | Method for improving bovine somatic cell cloning efficiency through induction expression of zfp57 |
| CN114196703A (en) * | 2021-12-22 | 2022-03-18 | 西北农林科技大学 | Vector, cell and method for improving cloned embryo development rate of yaks |
| CN114196703B (en) * | 2021-12-22 | 2023-02-03 | 西北农林科技大学 | Vector, cell and method for improving cloned embryo development rate of yaks |
| CN116411022A (en) * | 2022-11-21 | 2023-07-11 | 华中农业大学 | Vector and cell for indicating activation degree of porcine somatic clone embryo genome |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105524940B (en) | A kind of carrier, cell and method improving ox cloning efficiency based on histone methylated horizontal modification | |
| CN104419719B (en) | A kind of method that transgene pig riddled basins are knocked out | |
| CN103725710B (en) | One oneself can delete free carrier and application thereof | |
| CN108410894A (en) | A kind of carrier and method improving ox cloning efficiency based on histone methylated horizontal modification | |
| CN105177044B (en) | The method for obtaining lymthoma miniature pig disease model by knocking out P53 gene | |
| US20190032086A1 (en) | Method for preparing a gene knock-out canine with somatic cell cloning technology | |
| CN103993027B (en) | A kind of method that transgene pig riddled basins are knocked out | |
| Betthauser et al. | Nucleoplasmin facilitates reprogramming and in vivo development of bovine nuclear transfer embryos | |
| CN107318719B (en) | Method for inducing gynogenesis of grass carp by aid of koi sperms and application of gynogenesis grass carp | |
| CN105039402B (en) | A kind of method for improveing pig muscle quality | |
| Rivera-Pérez et al. | Culture of whole mouse embryos at early postimplantation to organogenesis stages: developmental staging and methods | |
| CN106086080B (en) | A method of ox cloning efficiency is improved using miRNA | |
| CN107988257B (en) | Carrier, cell and the method for goat cloning efficiency are improved based on the horizontal modification of donorcells DNA methylation | |
| CN101956003A (en) | Method for detecting exogenous gene integration sites in pig genome | |
| CN108624621B (en) | The preparation method of the somatic cell clone animal of non-human primates | |
| CN107177630A (en) | A kind of anti-PCV2 transgene pigs preparation method without exogenous marker gene | |
| CN103952424B (en) | Method for producing double-muscular trait somatic cell cloned pig with MSTN (myostatin) bilateral gene knockout | |
| CN107018955A (en) | A kind of transgene pig of the type of resisting porcine circovirus 2 | |
| KR20080077738A (en) | A methods to improve in vitro maturation of pig oocytes | |
| CN105755047A (en) | Method for obtaining cloned pigs with modified genes through continuous cloning | |
| Hashem et al. | Effect of potassium simplex optimization medium and NCSU23 supplemented with beta-mercaptoethanol and amino acids of in vitro fertilized porcine embryos | |
| CN103992409B (en) | Fusion protein and its application for rejecting marker gene | |
| CN104630137B (en) | The method of one boar ICSI operations | |
| CN110117618A (en) | A kind of labeling method of Sepiella maindroni archaeocyte | |
| CN109402178A (en) | A kind of method and application that spermatogonial stem cells into mouse efficiently reprograms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |