CN116411022A

CN116411022A - Vector and cell for indicating activation degree of porcine somatic clone embryo genome

Info

Publication number: CN116411022A
Application number: CN202211456794.3A
Authority: CN
Inventors: 苗义良; 刘鑫; 王婷婷; 周凯; 张霞
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2022-11-21
Filing date: 2022-11-21
Publication date: 2023-07-11
Anticipated expiration: 2042-11-21
Also published as: CN116411022B

Abstract

The invention discloses a vector and a cell for indicating activation degree of porcine somatic cell clone embryo genome, and relates to the technical field of mammalian somatic cell cloning. The vector is inserted with a reporting system for indicating the activation degree of porcine embryo genome, comprising a DNA binding motif (PRDL-motif) of a porcine PRD-Like homeodomain transcription factor, a mini-promoter, a red fluorescent protein mCherry coding frame, an SV40poly (A) signal and an enzyme cutting site. The vector can be used for screening positive cells with genome inserted into the report system, the cells are used as donor cells for constructing cloned embryos of pig somatic cells, and the obtained cloned embryos can indicate the genome activation degree of the cloned embryos of pig somatic cells through fluorescence intensity in the in-vitro culture process, so that the cells can be used for screening high-quality cloned embryos at the stage before implantation for embryo transplantation and cloned pig preparation.

Description

Vector and cell for indicating activation degree of porcine somatic clone embryo genome

Technical Field

The invention belongs to the technical field of mammal somatic cell cloning, and particularly relates to a vector and a cell for indicating activation degree of genome of a pig somatic cell clone embryo according to fluorescence intensity of the embryo.

Background

The somatic cell cloning technology is an important technology applied to the field of livestock embryo engineering and the field of regenerative medicine, and can be applied to livestock breeding seed conservation, developing disease models, producing organ transplantation donors, protecting endangered species, producing transgenic animals and the like. However, embryo obtained by somatic cell cloning technology has low blastocyst development rate at the stage before implantation, and abnormal conditions such as abortion, dead fetus and the like often occur after implantation, so that the overall birth efficiency of cloned animals is still not high.

At present, one of the reasons for the low cloning efficiency of mammals is that the cloned embryo has the phenomenon of genome activation failure, most researches focus on the problem, and the aim of improving the birth efficiency of cloned animals is achieved by carrying out methods such as small molecule inhibitor treatment or microinjection of nucleic acid fragments of regulatory factors on the cloned embryo. However, a method for instantly indicating the genome activation of cloned embryos is still lacking, so that the cloned embryos with normal genome activation and high quality can be screened out at the stage before implantation, thereby improving the accuracy of embryo transfer and the birth efficiency of cloned animals.

Therefore, it would be a highly desirable problem for those skilled in the art to provide a vector and cell that indicates the degree of activation of the genome of a cloned embryo of a somatic cell of a pig.

Disclosure of Invention

The invention aims to provide a vector and a cell for indicating the activation degree of a clone embryo genome of a pig somatic cell according to the fluorescence intensity of the embryo. The report system indicating the activation degree of the genome of the pig embryo can be inserted into the genome of the donor cell by using the vector, then the pig cloned embryo is constructed by using the donor cell, and the cloned embryo can be sorted according to the fluorescence intensity after in vitro culture for 72 hours, so that the normal high-quality cloned embryo with the genome activated can be selected for embryo transfer and cloned pig preparation.

In order to achieve the above object, the present invention is realized by the following technical scheme:

in order to achieve the above purpose, the present invention adopts the following technical scheme:

a vector indicative of the degree of activation of a porcine somatic cloned embryo genome, the vector comprising a reporter system indicative of the degree of activation of a porcine embryo genome;

the report system contains a DNA binding motif (PRDL-motif) of a porcine PRD-Like homeodomain transcription factor which is repeated 6 times, and the total of 89bp, and the nucleotide sequence is shown as SEQ.ID.NO. 1.

Furthermore, the report system is also added with a mini promoter, a red fluorescent protein mCherry coding frame, an SV40poly (A) signal and an XhoI restriction enzyme site at the downstream of the PRDL-motif, and a SwaI restriction enzyme site at the upstream of the PRDL-motif, wherein the total nucleotide sequence is 1111bp, and the whole nucleotide sequence is shown as SEQ.ID.NO. 2.

A cell indicating the degree of activation of the genome of a porcine somatic clone embryo, the cell having a Rosa26 locus inserted therein with a reporter system indicating the degree of activation of the porcine embryo genome.

Further, the cell is used as a donor cell for constructing the pig somatic cell cloned embryo, and after the obtained cloned embryo is cultured for 72 hours, red fluorescence can be emitted under excitation light with the wavelength of 587nm, and the stronger the fluorescence intensity is, the higher the activation degree of the genome of the pig somatic cell cloned embryo is indicated, and the stronger the capability of the pig somatic cell cloned embryo to develop to the blastula stage is.

Compared with the prior art, the invention has the following beneficial technical effects:

1. compared with untreated normal pig ear fibroblasts, the vector and the cell for indicating the activation degree of the pig somatic cell cloned embryo genome according to the fluorescence intensity of the embryo provided by the invention have no obvious difference in 2 cell rate, 4 cell rate and blastula rate of the cloned embryo constructed by using the donor cells inserted into the report system, which indicates that the conventional development of the pig cloned embryo is not influenced by using the cell.

2. The invention provides a vector and a cell for indicating the activation degree of a cloned embryo genome of a pig somatic cell according to the fluorescence intensity of an embryo, which are based on the luminous intensity of embryo red fluorescent protein mCherry to reflect the expression level of an embryo PRD-Like homologous domain transcription factor so as to distinguish the activation degree of the embryo genome.

3. The carrier and the cells for indicating the activation degree of the clone embryo genome of the pig somatic cell according to the fluorescence intensity of the embryo provided by the invention are used for sorting and subsequent culturing the embryo according to the fluorescence intensity of the embryo 72 hours after the clone embryo of the pig somatic cell is constructed, and the result shows that the proportion of the embryo with the fluorescence intensity to the blastula is obviously higher than that of the embryo with the fluorescence intensity, thus the purpose of screening the high-quality clone embryo in the stage before implantation can be realized by using the donor cells.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required to be used in the embodiments or the description of the prior art will be briefly described below, and it is obvious that the drawings in the following description are only embodiments of the present invention, and that other drawings can be obtained according to the provided drawings without inventive effort for a person skilled in the art.

FIG. 1 is a diagram of a reporter system targeting vector indicating the degree of activation of porcine embryo genomes;

FIG. 2 is a microscopic view of positive cells (reporter cells) obtained after screening host pig ear fibroblasts (control cells) with 800 μg/mL G418 drug, showing no difference in cell morphology between the two;

FIG. 3 shows gel electrophoresis identification results of 3'-junction PCR, 5' -junction PCR and cross-insert site Full length (Full-length) PCR of cell clones, showing that #4, #7, #9, #10, #20 and #21 cells are positive cells with a reporter system inserted intact into the Rosa26 site of pig genome;

FIG. 4 is a microscopic view of 2 cell rate, 4 cell rate, blastocyst rate, and blastocyst stage after cell cloning of embryos using positive cells and host control cell constructs, showing that the use of positive cells does not affect the routine development of porcine cloned embryos;

the left column of fluorescence intensity classification group of fig. 5 is a microscopic view of embryos sorted according to fluorescence intensity 72 hours after cloning embryos with positive cell constructs; the middle fluorescent luminous intensity group and the right fluorescent luminous intensity group are blastocyst microscopic images after 7 days of culture;

FIG. 6 shows that the development rate of blastocysts after 7 days of culture of cloned embryos was significantly higher for red-fluorescent embryos than for red-fluorescent embryos.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

Experimental materials sources and preparation: HEPES-free M199 basal medium, DMEM cell culture medium, opti-MEM serum-free medium, PBS cell washing solution, cell digestion solution and fetal bovine serum are the Simer Feier products. Competent cell Trans110 is a full gold product, nucleic acid ligase Solution I is a Bao Ri Yi product, the gel recovery and plasmid extraction kit is a Nuo Wei Zan product, the nucleic acid sequence is Jin Kairui synthesis, the restriction endonuclease is a New England biological laboratory product, and the pig genome Rosa26 site targeting vector and the Cas9/sgRNA expression vector are reserved for the laboratory. Other reagents not shown are all products of sigma aldrich.

a. Pig follicular fluid

Fresh ovary tissue of pig is obtained from Hubei Wuhan Shuanghui food Co., ltd (collection time: 2022, 7 months to 2022, 10 months), put in a physiological saline thermos bottle at 38 ℃ and transported to laboratory within 4 hours. Then, the follicular fluid of the ovarian follicle with the surface of 2-8 mm is sucked by a syringe with a 12G needle, and the follicular fluid is pumped into a 50mL centrifuge tube, placed into a 38 ℃ incubator and kept stand for 30min. Centrifuging the upper follicular fluid at 3000rpm for 30min, and filtering the supernatant with 0.22 μm filter to obtain sterile pig follicular fluid.

b. In vitro maturation culture solution for porcine oocytes

10% porcine follicular fluid, 1mg/mL L-cysteine, 0.44mg/mL sodium pyruvate, 10ng/mL epidermal growth factor, 50ng/mL insulin, 5IU/mL gonadotropin, 5IU/mL chorionic gonadotropin, and 11.3ng/mL kanamycin were added to HEPES-free M199 basal broth.

PZM3 embryo culture solution

3.156g of sodium chloride, 1.053g of sodium bicarbonate, 0.373g of potassium chloride, 0.024g of monopotassium phosphate, 0.049g of magnesium sulfate heptahydrate, 0.308g of calcium lactate, 0.011g of sodium pyruvate, 0.073g of L-glutamine, 0.273g of hypotaurine, 10mL of BME amino acid solution, 5mL of MEM non-essential amino acid solution, 0.025g of gentamicin, 0.033g of penicillin, 0.025g of streptomycin and 1.500g of bovine serum albumin are dissolved in 500mL of ultrapure water, the pH is adjusted to 7.2-7.4, and the osmotic pressure is adjusted to 295-300 mOsm.

NCSU23 solution

6.354g of sodium chloride, 0.656g of potassium chloride, 0.161g of sodium dihydrogen phosphate, 0.586g of magnesium sulfate heptahydrate, 0.075g of kanamycin and 0.015g of phenol red are dissolved in 100mL of ultrapure water.

e. Embryo operation liquid

10mL of NCSU23 solution, 0.004g of sodium chloride, 0.100g of glucose, 0.007g of cysteine, 0.015g of L-glutamine, 0.088g of taurine and 0.055g of hypotaurine are dissolved in 100mL of ultrapure water, the pH is adjusted to 7.2-7.4, and the osmotic pressure is adjusted to 295-300 mOsm.

PVA TL HEPES solution

6.663g of sodium chloride, 0.237g of potassium chloride, 0.168g of sodium bicarbonate, 0.041g of sodium dihydrogen phosphate, 1.868mL of sodium lactate, 0.102g of magnesium chloride hexahydrate, 0.294g of calcium chloride dihydrate, 2.383g of HEPES, 0.022g of sodium pyruvate, 0.025g of gentamicin, 0.065g of penicillin, 0.100g of polyvinyl alcohol, 2.186g of sorbitol and 0.010g of phenol red are dissolved in 1L of ultrapure water, the pH is adjusted to 7.2-7.4, and the osmotic pressure is adjusted to 295-300 mOsm.

g. Electrofusion solution

The electrofusion solution comprises mannitol of 0.3mol/L, calcium chloride dihydrate of 1mmol/L, magnesium chloride hexahydrate of 0.1mmol/L and HEPES of 0.5mmol/L, and the pH is adjusted to 7.2-7.4.

By analyzing the gene expression data of fertilized embryos of each development stage before pig implantation, the gene expression quantity of the 4-cell embryos is found to be obviously increased compared with that of the 2-cell embryos of the previous stage, which indicates that the genes have the expression characteristics of embryo genome activation. The transcription factor DNA binding motif analysis can be performed by extracting the promoter region nucleic acid sequence of the above-mentioned expression increasing gene, thereby determining the common transcription factor simultaneously bound to the promoters of these genes. Finally, the DNA binding motif of PRD-Like homeodomain transcription factor, PRDL-motif, was analyzed, indicating that activation of part of the porcine embryo genome was regulated by this family of proteins. Meanwhile, this family of proteins has also been reported in mouse and human studies as common embryonic genome activation-related transcription factors. Thus, PRD-Like homeodomain transcription factors that can direct embryo self-expression are utilized to initiate expression of downstream fluorescent protein genes, so that the brightness of embryo fluorescence display can indirectly indicate the degree of embryo genome activation.

Example 1 reporter System targeting vector construction

a. Synthesis of reporter nucleic acid sequences

The DNA binding motif (PRDL-motif) of the pig PRD-Like homeodomain transcription factor is repeated 6 times, and the total 89bp is shown in SEQ ID No. 1:

gttaacctaa tcaatgctgg gattacaggc tctgattcaa tcagttgatt ggattagctg gttaattcaa tcatagctaatcccatcag；

the report system for indicating the activation of the porcine embryo genome is synthesized by Jin Kairui company, and comprises a SwaI restriction site, a porcine PRDL-motif repeated 6 times, a mini promoter, a red fluorescent protein mCherry coding frame, an SV40poly (A) signal and an XhoI restriction site from upstream to downstream elements, wherein the total nucleotide sequence is represented by SEQ ID No. 2:

atttaaatctagcgttaacctaatcaatgctgggattacaggctctgattcaatcagttgattggattagctggttaattcaatcatagctaatcccatcagaagcttagacactagagggtatataatggaagctcgacttccagcttggcaatccggtactgttggtaaagccaccatgtctatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaactgcagtctagagtcggggcggccggccgcttcgagcagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggctcgag；

b. construction of reporting System targeting vector

The framework of the report system targeting vector is a pig genome Rosa26 site targeting vector reserved in a laboratory, double enzyme digestion is carried out on the targeting vector by utilizing SwaI and XhoI nucleic acid restriction endonucleases, the double enzyme digestion and the recovery are carried out, the double enzyme digestion and the recovery are uniformly mixed with synthesized report system nucleic acid fragments, the two are spliced into a complete report system targeting vector by utilizing a nucleic acid ligase Solution I (figure 1), a connection product is transformed into Trans110 competent escherichia coli by heat shock, a plurality of monoclonal colonies are picked up, amplified and cultured, and then are sent to a Wuhan Jin Kairui company for sequencing, and the vector with correct sequencing is the report system targeting vector which is successfully constructed and indicates activation of pig embryo genomes.

Example 2 screening and identification of target positive cells by reporter System

a. Culture of porcine fetal fibroblasts

Taking 1 big white boar fetus adult within 5 generations from liquid nitrogen tankFibroblasts (12 months from China agricultural university pig measurement center in 2015), thawed in a water bath at 38 ℃, added with 1mL of DMEM cell culture solution, mixed well, centrifuged at 1000rpm for 5min, and the supernatant discarded. The cells were resuspended in 4mL of DMEM cell culture medium containing 10% fetal bovine serum and plated uniformly in 60mm dishes at 38.5℃with 5% CO ₂ Culturing in a saturated humidity incubator.

b. Cell transfection and screening of reporter system targeting vectors

The invention uses electroporation method to transfect the report system targeting vector and Cas9/sgRNA expression vector into pig fetal fibroblasts at the same time. The specific method comprises the following steps: the cell density is cultured to about 80% for transfection, fresh DMEM cell culture solution is replaced 4h before cell transfection, then the culture solution is sucked and removed, cells are digested by using cell digestion solution, after the cells become round and are no longer attached, the digestion is stopped by using 1mL of DMEM cell culture solution containing 10% fetal bovine serum, after cell counting, the supernatant is removed by centrifugation, and the number of cells required for one transfection is 1-2X 10-6. The cells after centrifugation and supernatant removal were resuspended in 100. Mu.L of Opti-MEM serum-free medium, 1. Mu.g of each of the two vector plasmids was added, the resuspended cells were gently blown, the mixed suspension of the cells and plasmids was transferred to a Lonza electrotransfection cup, and the cell electric shock transfection was performed by selecting the Lonza electrotransfection apparatus U-023 electroporation program, followed by resting for 10min. Finally, the mixed suspension of cells and plasmid is transferred to a 90mm dish at 38.5℃in 5% CO ₂ After culturing in a saturated humidity incubator for 8-12 hours, the DMEM cell screening culture solution containing 800 mug/mL G418 and 10% fetal bovine serum is replaced. After that, fresh cell selection medium was changed every 3 days, and after about 2 weeks, G418-resistant reporter cell clones were obtained, and after digestion, monoclonal cells were picked up for expansion culture in a morphology that was indistinguishable from that of untransfected host fibroblasts (fig. 2).

c. PCR identification of reporting system targeting positive cells

Taking part of the expanded monoclonal cells, centrifuging, removing supernatant, adding 5 μl of lysate (900 μl ddH2O,10 μl 10XPCRbuffer, 1 μl protease K), fully suspending, and placing in a metal bath at 56 ℃ for 30min and a metal bath at 95 ℃ for 10min. 1. Mu.L of cell lysate was used as a template for PCR identification of positive cells targeted by the three-round reporter system using the following identification primers.

5' -junction-F, as shown in SEQ. ID. NO. 3:

5'-CTTGAGGTGGTCTGACCGGTAG-3'

5' -junction-R as shown in SEQ. ID. NO. 4:

5'-CCATGTTATCCTCCTCGCCCTT-3'

3' -junction-F, as shown in SEQ. ID. NO. 5:

5'-CCCGTGATATTGCTGAAGAGCTT-3'

3' -junction-R as shown in SEQ. ID. NO. 6:

5'-CAGCCACAATGTACACAGTAGCA-3'

Full-length-F, as shown in SEQ. ID. NO. 7:

5'-TGATTGGCTGCTGAAGTCCTGGGAACGG-3'

Full-length-R, as shown in SEQ. ID. NO. 8:

5'-GCCAATGCTATGTCTGGGACTGGATGAG-3'

wherein, the 5'-junction upstream primer is matched with the genome sequence of the homologous arm at the left side of the 5' end, the downstream primer is matched with the reading frame sequence of the report system mCherry, and the size of the product is 1305bp; the 3'-junction upstream primer is matched with a Neo resistance gene sequence on the targeting vector, the downstream primer is matched with a genome sequence of a homology arm on the right side of the 3' end, and the size of the product is 2319bp; and (3) identifying that an upstream primer matches a left homology arm sequence and a downstream primer matches a right homology arm sequence through Full-length (Full-length) PCR of an insertion site, wherein the size of a product is 4063bp. The cells identified by the above three rounds of PCR (fig. 3) were positive cells with the reporter system inserted intact into the Rosa26 locus of the pig cell genome. As shown in the gel electrophoresis chart of the PCR products of FIG. 3, it was shown that #4, #7, #9, #10, #20 and #21 were positive cells reporting complete insertion of the system.

EXAMPLE 3 production of porcine somatic cloned embryos

a. In vitro maturation culture of porcine oocytes

Pig ovaries were obtained from the Hubei Wuhan Shuanghui food Co., ltd (collection time: 2021, 9 months to 2022, 10 months), placed in a 38℃physiological saline flask, and transported to the laboratory within 4 hours. Subsequently aspiration of the eggs with a syringe fitted with a 12G needleFollicular fluid of follicular follicle with the surface of 2-8 mm is put into a 50mL centrifuge tube, put into a 38 ℃ incubator and kept stand for 30min. After the cumulus granulosa cells-oocyte complex (COCs) are sunk at the bottom of the centrifuge tube, pouring out the follicular fluid at the upper layer, adding 50mL of PVA TL HEPES solution, reversely suspending the COCs, pouring the liquid into a 100mm culture dish, and selecting the COCs with good form under a stereoscopic microscope by using a glass needle with the caliber of 500 mu m. Washing COCs in vitro maturation culture solution of pig oocyte for three times, transferring into four-hole plate containing in vitro maturation culture solution, adding 50 COCs per 500 μl, and heating at 38.5deg.C and 5% CO ₂ Culturing in an incubator with saturated humidity for 40h. A0.5 mL centrifuge tube was taken, 400. Mu.L of HEPES M199-free basal medium containing 0.1% hyaluronidase was added, and then the cultured mature COCs were placed in the centrifuge tube, digested for 5min at 38.5℃and centrifuged at 1000rpm for 1min. The oocytes at the bottom of the centrifuge tube are sucked by a glass needle with the caliber of 200 mu m, washed for three times in PVA TL HEPES solution, and the cumulus granulosa cells on the zona pellucida of the oocytes are fully removed. And finally blowing and sucking the oocyte by using a glass needle under a stereoscopic microscope, and selecting and discharging the oocyte of the first polar body, namely the mature MII-stage oocyte.

b. Construction of pig somatic cell clone embryos Using control and reporter cells, respectively

Mature oocytes are selected and placed into embryo operation liquid drops containing 7.5 mug/mL cytochalasin B, and then the enucleation operation is carried out on the oocytes by adopting a blind suction method under a micromanipulator, namely, a glass needle with the inner diameter of 25-30 mu m is used for sucking the first polar body and the surrounding oocytoplasm. Control and reporter cells with diameters of 20-25 μm were selected and injected under the zona pellucida of the enucleated oocytes, respectively. The somatic cell cloned reconstructed embryo after nuclear injection needs to be kept stand for 20min in a preheated PZM embryo culture solution, and then the electrofusion and activation operation of donor cells and egg cytoplasm are carried out. The reconstructed embryo is washed three times in the preheated electrofusion solution, and then placed in a 1mm wide electrofusion tank containing the electrofusion solution, and the contact surface of the donor cell and the enucleated oocyte membrane is arranged in line with the two electrodes. The fusion parameter is voltage 1.2kV/cm, the direct current electric shock is carried out for 2 times, and the pulse time is 30 mu s. The ratio of control and reporter cell cloned embryos developed to 2 cell stage, 4 cell stage and blasts was observed on

days

2, 3 and 7, respectively (fig. 4), showing that the rate of development of cloned embryos obtained using reporter cells as donor cells was not significantly different from the control, indicating that the use of the cells did not affect the routine development of porcine cloned embryos.

c. Sorting according to embryo fluorescence signal intensity

Pig somatic cell clone embryos are constructed by positive cells and then cultured for 72 hours, embryos are sorted according to fluorescence intensity (left column of fig. 5, fluorescence intensity classification group), and embryos with strong luminescence signals and embryos with weak luminescence signals are separately cultured. The ratio of embryo with strong luminous signals to embryo with weak luminous signals to blastula is observed on the 7 th day, the development rate of the embryo with strong fluorescence is obviously higher than that of the embryo with weak fluorescence (the group with strong fluorescence is shown in the figure 5, the group with weak fluorescence is shown in the right row, and the group with weak fluorescence is shown in the figure 6, which shows that the embryo with strong luminous signals has higher activation degree of genome and has larger capability of developing into blastula, and also shows that the carrier and the cells for indicating the activation degree of genome of the cloned embryo of the pig somatic cell provided by the invention can be used for achieving the purpose of sorting the cloned embryo of the high-quality pig somatic cell in the development stage before implantation.

The invention provides a vector and a cell for indicating the activation degree of a clone embryo genome of a pig somatic cell according to the fluorescence intensity of the embryo, which are obtained by serially connecting a pig PRDL-motif, a mini promoter, a red fluorescent protein mCherry coding frame and an SV40poly (A) signal element which are repeated 6 times to form a report system targeting vector, and screening and identifying positive cells of which the report system is completely inserted into the genome after the cells are transfected and integrated on a Rosa26 site of a donor fibroblast genome. The positive cells are used for constructing pig somatic cell clone embryos, PRD-Like homeodomain transcription factors expressed by the embryos can be guided to be combined with PRDL-motif in a report system, and protein expression of downstream mCherry is started. The brighter the red fluorescence of the cloned embryos cultured for 72h under excitation light with a wavelength of 587nm, indicating a higher degree of activation of the embryo genome. It was also finally found that embryos with red fluorescence developed significantly higher than embryos with weak red fluorescence in the subsequent blastocyst, indicating that the use of the donor cells can achieve the objective of screening for high quality cloned embryos at the pre-implantation stage.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A vector for indicating the degree of activation of a porcine somatic cloned embryo genome, wherein the vector is inserted into a system comprising a reporter system for indicating the degree of activation of a porcine embryo genome;

the report system contains a DNA binding motif PRDL-motif of a pig PRD-Like homologous domain transcription factor which is repeated 6 times, and the total of 89bp, and the nucleotide sequence is shown as SEQ.ID.NO. 1.

2. The vector for indicating the activation degree of porcine somatic cloned embryo genome according to claim 1, wherein the report system is further added with a mini promoter, red fluorescent protein mCherry coding frame, SV40poly (A) signal and XhoI cleavage site at the downstream of PRDL-motif, swaI cleavage site at the upstream of SwaI cleavage site, wherein total 1111bp is added, and the whole nucleotide sequence is shown as SEQ.ID.NO. 2.

3. A cell indicative of the degree of activation of the genome of a porcine somatic cloned embryo, wherein the genomic Rosa26 site of the cell is inserted with a reporter system indicative of the degree of activation of the porcine embryo genome.

4. A cell indicating activation degree of genome of porcine somatic cloned embryo according to claim 3, wherein the cell is used as donor cell for constructing porcine somatic cloned embryo, and the obtained cloned embryo emits red fluorescence under the excitation light with the wavelength of 587nm after culturing for 72 hours, and the higher the fluorescence intensity, the higher the activation degree of genome of porcine somatic cloned embryo is, and the higher the ability of the porcine somatic cloned embryo to develop to blastula stage is.