CN108707600A - The one unicellular fusion method of boar mouse cell - Google Patents
The one unicellular fusion method of boar mouse cell Download PDFInfo
- Publication number
- CN108707600A CN108707600A CN201810553064.2A CN201810553064A CN108707600A CN 108707600 A CN108707600 A CN 108707600A CN 201810553064 A CN201810553064 A CN 201810553064A CN 108707600 A CN108707600 A CN 108707600A
- Authority
- CN
- China
- Prior art keywords
- cell
- culture
- pig
- unicellular
- mouse
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/02—Preparation of hybrid cells by fusion of two or more cells, e.g. protoplast fusion
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The one unicellular fusion method of boar mouse cell, belongs to cell engineering field.The present invention is for the low problem of current heterogenous cell fusion efficiencies, provide a kind of unicellular fusion method, using mouse embryo stem cell and pig multipotent stem cells or pig fibroblast as cell fusion partner, with the digestive juice for the pancreatin for being 0.25% containing mass fraction by pig, mouse cell dissociation at unicellular, after culture, it is one-to-one unicellular right to be built using cell agglutinin, 1min is cultivated in the polyethylene glycol for being 50% containing mass fraction, cell is then continued into culture 7 days, obtains the single celled fused cell of pig mouse.The present invention is suitable for study on animal breeding or the production of monoclonal antibody.
Description
Technical field
The invention belongs to cell engineering fields, and in particular to a unicellular fusion method of boar mouse cell.
Background technology
Cell fusion experiment starts from 1969, most important for basic research, also has important application value, so far
Until the present there are mainly three types of cell fusion methods, sendai virus, electro' asion and polyethylene glycol (PEG).But main utilization at present
Polyethylene glycol mediated cell merges, and Cowan utilizes 5 × 107Personal embryonic stem cell and 5 × 107Individual cells merge, fusion
Efficiency is only 0.000004%, obtains 2 clones.Yu passes through 1.3 × 107Personal stem cell and 4.7 × 107A bone marrow precursors
Cell fusion, efficiency also only have 0.00067%, and fusion efficiencies are increased to 0.005% by merging people by Hasegawa in 2010
When carrying out control fusion, fusion efficiencies are improved, by 0.5 × 10 by fibroblast and people ES, Sumer6A mouse
ES cells and 1 × 106A mouse fetal fibroblast fusion efficiencies are up to 0.77%, and 0.5 × 106A mouse induces stem cell
(mips) and 1x106A mouse fetal fibroblast fusion efficiencies are 1.74%, and lower fusion efficiencies are always a problem,
Especially heterogenous cell fusion efficiencies are lower.
Invention content
For the low problem of current heterogenous cell fusion efficiencies, the present invention provides a unicellular fusion sides of boar mouse cell
Method, be by mouse embryo stem cell and pig cell respectively through pancreatin be digested to it is unicellular after, be built into one using cell agglutinin
To one it is unicellular right, it is described it is unicellular under the action of polyethylene glycol fused culture obtain fused cell, the pig is thin
Born of the same parents are pig multipotent stem cells or Pig embryos fibroblast.
The fusion method specifically comprises the following steps:
1) cell culture:Mouse embryo stem cell is cultivated in ES culture solutions respectively, it is thin to obtain mouse embryonic stem
Born of the same parents' cell clone;By Pig embryos fibroblast in the cell culture fluid containing 15% mass content fetal calf serum, through culture
Obtain Pig embryos fibroblast;Or pig multipotent stem cells are seeded to the mouse fetal of mitomycin C processing into fibre
It on the feeder cells for tieing up cell, is cultivated in pig multipotent stem cells culture solution, obtains pig multipotent stem cells cell
Clone;
2) unicellular fusion:By mouse embryo stem cell cell clone and the pig cell after culture respectively after pancreatin digests
Obtain unicellular, the ES culture solutions of serum-free and cell agglutinin are prepared into droplet, and the end of cell agglutinin is dense in the droplet
Degree is 100 μ g/mL;Unicellular be bonded in each droplet of the unicellular and pig cell of mouse embryo stem cell is built into one
To one it is unicellular right, then fused culture obtains fused cell under the action of polyethylene glycol.
Preferably, step 1) the pig multipotent stem cells culture solution adds the ROCK1 inhibition of final concentration of 10 μm of ol/L
Agent.
Preferably, the basal medium of step 1) the ES culture solutions is DMEM, also contains quality in the ES culture solutions
The fetal calf serum of score 15%, 2mM glutamine, 0.1mM beta -mercaptoethanols, 1000U/mL leukocyte inhibitory factors, quality point
Several 1% nonessential amino acid and mass fraction 1% are dual anti-, each adding ingredient it is a concentration of its ES cultivate liquid culture medium in
Final concentration, it is described it is dual anti-refer to reagent simultaneously containing two kinds of antibiotic of penicillin and streptomysin;The mouse embryonic stem is thin
Born of the same parents' condition of culture is:Saturated humidity, 37 DEG C, the CO of volume fraction 5%2, volume fraction 21% O2。
Preferably, the fibroblastic culture solution of the step 1) Pig embryos is the cell culture fluid of 15% fetal calf serum,
Be be 82% by mass fraction DMEM culture mediums, mass fraction be 15% fetal calf serum, mass fraction be 1% it is nonessential
The dual anti-composition of amino acid, the L-Glutamine and mass fraction 1% that mass fraction is 1%, the concentration of each adding ingredient
The final concentration for being it in cell culture fluid, it is described it is dual anti-refer to examination simultaneously containing two kinds of antibiotic of penicillin and streptomysin
Agent, the Pig embryos Fibroblast cell-culture condition:39 DEG C, the CO of volume fraction 5%2, volume fraction 21% O2;
The basal medium of the pig multipotent stem cells culture solution is KnockOut DMEM culture solutions, also contains quality
Score 0.5%N2 cell culture additive, the B27 additives of mass fraction 1%, 0.25mg/ml bovine serum albumin(BSA)s, quality point
Number 1%L- glutamine, 1% nonessential amino acid of mass fraction, 0.2mM beta -mercaptoethanols, 40 μ g/ml vitamin Cs, 5ng/ml
Human leukocyte inhibiting factor, 16ng/ml basic fibroblast growth factors and mass fraction 1% are dual anti-, each ingredient
Its a concentration of final concentration in KnockOut DMEM culture solutions, it is described it is dual anti-refer to simultaneously contain penicillin and streptomysin
The reagent of two kinds of antibiotic, the pig multipotent stem cells condition of culture are:The CO of 39 DEG C of temperature, volume fraction 5%2, volume
The O of score 5%2。
Preferably, the basal medium of the ES culture solutions of the step 2) serum-free is DMEM, and the ES of the serum-free is trained
In nutrient solution also contain 2mM glutamine, 0.1mM β mercaptoethanols, 1000U/mL leukocyte inhibitory factors, mass fraction 1% is non-must
Need that amino acid, mass fraction 1% is dual anti-, 3 μM of CHIR99021 and 1 μM of PD0325901, the constituent concentration respectively added is
Its final concentration in the ES culture solutions of serum-free, it is described it is dual anti-refer to simultaneously containing two kinds of antibiotic of penicillin and streptomysin
Reagent.
Preferably, step 2) the pancreatin digestion refers to that each mouse embryo stem cell cell clone and pig cell are sharp respectively
The pancreatin digestive juice for being 0.25% with 20 μ L pancreatin mass fractions digests 1min at 37 DEG C, is then respectively adding mouse embryonic stem
Used culture solution stops digesting when cell is with pig cell culture.
Preferably, before step 2) the fusion culture, 1 μ L polyethylene glycol volume fractions are added to each pair of unicellular centering
For 50% polyethylene glycol 1500 aqueous solution, stands to be transferred in fusion culture solution after 1min and cultivate, the fusion culture solution is ES
Culture solution.
Preferably, step 2) the fusion culture refers to culture item of the cell after merging according to mouse embryo stem cell
Part is cultivated in ES culture solutions, and fusion incubation time is that the pancreatin for being 0.25% with pancreatin mass fraction after 7 days, 7 days disappears
Change the cell mass after liquid cultivates fusion to digest, the ES culture solutions with pancreatin digestive juice equivalent are used in combination in 37 DEG C of digestion 3min
Enter secondary culture after termination.
Preferably, the step 2) pancreatin is TrypLE Express enzymes.
Advantageous effect
2 × 10 are needed in traditional fusion experiment6A cell, significant difference obtains clone 39 ± 6.3, and (cell is given birth in agglomerate
Grow and be projecting shape, both expressed red fluorescence or expressed green fluorescence), the present invention provides a kind of raising cell fusion efficiencies
Method, establish unicellular fusion method, it is only necessary to operate 80 cells, you can obtain clone 40 ± 4.9, pig mouse cell is melted
It closes cloning efficiency and has been increased to 50.00%.
The fused cell that the method for the present invention obtains is positive in AP, has both expressed the kind specific gene of pig, also expresses mouse
Kind specific gene, and with the ability broken up to triploblastica.
The present invention can be used for studying the nucleocytoplasmic relation of cell, disclose the pathogenetic mechanism of disease, animal breeding or production list gram
Grand antibody etc..
Description of the drawings
Fig. 1 versatility of mouse embryo stem cell detects, and wherein A detects for AP;B detects for caryogram;C be Oct4, Sox2,
Nanog Immunofluorescence tests, Hoechst are nuclear targeting blue-fluorescence;Alex488 represents gene dyeing green fluorescence;D is
Real-Time analyzes the expression of Oct4, Sox2, Nanog, Rex1, and abscissa is target gene to be detected, and ordinate is gene phase
To expression quantity.
It is mouse embryo stem cell R1 cell lines that Fig. 2, which marks cell line fluorescent marker schematic diagram, wherein A,;B is mice embryonic
Stem cell R1-FD cell lines;C:Pig embryos fibroblast PEF;D:Pig embryos fibroblast PEF-FE cell lines.
Fig. 3 pig mouse heterogenous cells merge, and wherein A is the ideograph of conventional method cell fusion experiment;B is of the present invention
Unicellular fusion ideograph;C is the hybrid cells obtained under conventional method fusion system;D is list of the present invention
The hybrid cells obtained under cell fusion system, wherein R1/PEF are mouse embryo stem cell R1 systems and Pig embryos into fiber finer
The newly formed fused cell state (not yet amplification cultivation) of born of the same parents, hybrid are mouse embryo stem cell R1 systems and Pig embryos into fiber
The fused cell (fused cell after culture a period of time) of cell, bright field are microscope white light field, and dsRed is red
Color fluorescent marker, GFP are green fluorescent label.
Fig. 4 pig mouse fused cells, wherein P3 represented for the 3rd generation, and P10 represented for the 10th generation, and P20 represented for the 20th generation.
Fig. 5 xenogenesis fused cell specificity analysis, wherein A detects for species specificity, and B detects for AP;C is Real-Time
The Oct4 of xenogenesis fused cell, the expression of Sox2, Nanog are analyzed, abscissa is target gene to be detected, and ordinate is gene phase
To expression quantity.
Fig. 6 xenogenesis fused cell differentiation capabilities detect, and wherein A is the formation of fused cell embryoid body EB, and B is fused cell
Differentiation capability detects, and Gapdh is reference gene, MyoD, Tagln are mesoderm gene, Sox7 is entoderm gene, Ncam is outer
Endoderm gene, R1-PEF are mouse embryo stem cell R1 systems and the fibroblastic fused cell of pig, and R1-KO is mouse embryonic stem
The fused cell of cell R1 systems and pig multipotent stem cells, F1-PEF are that mouse embryo stem cell F1 systems and pig are fibroblastic
Fused cell, F1-KO are the fused cell of mouse embryo stem cell F1 systems and pig multipotent stem cells.
Specific implementation mode
Mice embryonic stem cell system R1 or F1 systems are provided by Zu Pei teaching and research rooms of Harbin Medical University, also can be through commercialization
Approach purchase obtains;Pig multipotent stem cells and animal embryo engineering teaching and research room of Pig embryos fibroblast Northeast Agricultural University
It provides, it also can be through being commercialized approach purchase.
DMEM culture solutions (Dulbecco'S Modified Eagle Medium) it buys from Gibco, article No.:12100-
046;
Pig embryos are primary, mouse fetal primary cell digestive ferment:Basal medium DMEM+15%FBS+1.6mg/ml collagens
IV+Dnase of enzyme, I (250unitz/ml)+1% is dual anti-, and each component content is mass content, refers in DMEM culture solutions
Final concentration.
KnockOutTMDMEM culture solutions (KO-DMEM) are bought from Gibco, article No.:10829-018;
FBS fetal calf serums (Fetal Bovine Serum) are bought from BIOIND, article No.:04-001-1A;
0.25% trypsase (Trypsin-EDTA) is bought from Gibco, article No.:25200;
DPBS(Dulbecco'S Phosphate Buffered Saline), DPBS:1L deionized water dissolving DPBS powder
End saves backup for 4 DEG C to final concentration of 0.01M/L after filtering.It buys from Gibco, article No.:21600-010;
Clostridiopetidase A IV (Collagenase IV), IV+DMEM+ mass fractions of final concentration 1mg/ml clostridiopetidase As are 1% dual anti-,
The concentration is the final concentration in KO-DMEM, is bought from Sigma, article No.:C-5138;
I enzymes of Dnase are bought from GIGMA, article No.:D-426;
Nonessential amino acid (NEAA) is bought from Invitrogen, article No.:11140-050;
Glutamine (L-Glutamine) is bought from Sigma, article No.:G8540-100G;
Y27632 (EMD4) is bought from Biosciences, article No.:688000;
Human leukocyte inhibiting factor (human LIF) is bought from Millipore, article No.:LIF1010;
Leukocyte inhibitory factor (mouse LIF) is bought from Millipore, article No.:LIF1107;
Mitomycin C (Mitoycin C) is bought from Sigma, article No.:M4287-2MG;
Bovine serum albumin(BSA) (BSA) is bought from Sigma, article No.:A3311;
Beta -mercaptoethanol (β-mercaptoethanol) is bought from Gibco, article No.:21985-023;
B27 additives are bought from Gibco, article No.:17504-044;
N2 cell culture additives are bought from Gibco, article No.:17502-048;
Basic fibroblast growth factor (bFGF) is bought from RD, article No.:233-FB;
Vitamin C (Vitamin C) is bought from Sigma, article No.:A5960;
BCIP/NBT alkaline phosphatase colour reagent boxes are bought from the green skies, article No.:C3206;
Real-Time kits (SYBR Green Realtime PCR Master Mix-Plus), purchase is certainly
Takara, article No.:DRR066A;
Reverse transcription reagent box (High Capacity cDNAReverse Transcription Kit) is bought from ABI,
Article No.:4368814;
RNA extracts kits (PureLink RNA mini kit) are bought from Llie, article No.:12183018A;
DMEM:1L deionized water dissolving DMEM powder+3.7g NaHCO3, pH to 7.2 is adjusted, 4 DEG C of preservations are standby after filtering
With.
15% fetal calf serum (FBS) cell culture fluid (is suitable for feeder cells, fibroblast, EB cells):15%
Dual anti-+ the 82%DMEM of FBS+1%NEAA+1%L-glutamine+1%, each component content are mass content, refer to thin
Final concentration in born of the same parents' culture solution.
2% fetal calf serum (FBS) cell culture:Mass fraction 2%FBS+ mass fractions 98%DMEM;
20% fetal calf serum (FBS) cell culture:Mass fraction 20%FBS+ mass fractions 80%DMEM;
KO culture solutions (pig multipotent stem cells culture solution):KO-DMEM+0.5%N2 cell culture additives+1%B27 adds
Add agent+0.25mg/ml BSA+1%L-glutamine+1%NEAA+0.2mM β-mercaptoethanol+40 μ g/ml
VitaminC+5ng/ml human LIF+16ng/ml bFGF+1% are dual anti-, and each component content is mass content, refers to
Final concentration in KO-DMEM.
MES culture solutions (Mouse Embryonic Stem Cell Culture liquid):15%FBS+1%NEAA+1%L-glutamine+1% is bis-
Anti-+1000U/mLmLIF+0.1mM β-mercaptoethanol+80.9%DMEM, each component content are mass content, are
Refer to the final concentration in mES culture solutions.
The mES culture solutions of serum-free:Dual anti-+ 1000U/mL the mLIF+ of DMEM+1%NEAA+1%L-glutamine+1%
- mercaptoethanol+3 μm of CHIR99021+1 μm of PD0325901 of 0.1m β, each component content are mass content, are
Refer to the final concentration in the mES culture solutions of serum-free.
Dual anti-refers to the reagent simultaneously containing two kinds of antibiotic of penicillin and streptomysin, is bought from Hyclone, article No.:30-
002-CI;
CHIR99021 is bought from Stemgent, article No.:04-0004;
PD0325901 is bought from Stemgent, article No.:04-0006;
Cell agglutinin is bought from Sigma, article No.:L1668;
Pancreatin is the pancreatin of animal origin unless otherwise specified, is bought from article No.:25200;
It carries out digesting pancreatin used being recombinant type pancreatin TrypLE after obtaining fused cellTMExpress enzymes, purchase is certainly
Gibco, article No.:12605-10;
FUW-Egfp viral vectors is provided by animal embryo engineering teaching and research room of Northeast Agricultural University, also can be through commercialization way
Diameter is bought;
FUW-Dsred viral vectors is provided by animal embryo engineering teaching and research room of Northeast Agricultural University, also can be through commercialization way
Diameter is bought;
Plasmid extraction kit is TIANprep Mini Plasmid Kit, and purchase has from Tiangeng biochemical technology (Beijing)
Limit company, article No.:DP103;
Virus transfection is Lipofectamine LTX and Plus with kit, is bought from Invitrogen, article No.:
15338-100;
293T cells are provided by Histology and Embryology teaching and research room of Harbin Medical University, also commercially viable purchase;
The B6 mouse of feeder cells are used to prepare, are bought in Beijing Vital River Experimental Animals Technology Co., Ltd.;
Paraffin oil is bought from Fisher chemical, model NF/FCC;
Viral concentration column is bought from Millipore, article No.:UFC910096;
DyeCycleTMGreen stain are bought from invitrogen, article No.:V35004;
Cell sorter is bought from BD, model:BD FACSMelodyTM;
BCIP/NBT alkaline phosphatase colour reagent boxes are bought from the green skies, article No.:C3206;
Other reagents and instrument and equipment used, consumptive material, such as centrifuge, fluorescence microscope, glass tube, mouth suction pipe, training
Supporting ware, the 6 orifice plates for cell culture, 96 orifice plates etc. can be obtained by being commercialized approach purchase.
The 1. unicellular fusion method of pig mouse cell of embodiment.
1. cell culture
1) culture of mouse embryo stem cell:
To ensure that fused cell biological characteristic research is comparable, the mouse embryo stem cell that fusion experiment is used
It is that R1 carries out versatility identification first.
1. alkaline phosphatase activities detect
The fused cell of acquisition cleans 3 times through DPBS, and the paraformaldehyde that mass fraction is 4% fixes clone 90s, discards more
Polyformaldehyde, DPBS are washed 3 times, are detected according to BCIP/NBT alkaline phosphatase colour reagent boxes, and clone's colour developing is in purple
State can stop developing the color.Dyeing liquor is removed, DPBS is cleaned 3 times, is taken a picture under the microscope.
2. embryoid body formational situation detects
Digestion 3min rolled into a ball to fused cell using Tryple, cell is separated into after small agglomerate that be seeded in no matrix coated
In plate, 7-10d is cultivated in 15%FBS cell culture fluids.
3. RNA is extracted, reverse transcription, Real-time PCR
The RNA of fused cell is extracted using RNA purification kits (PureLink RNA mini kit, Life).
Using reverse transcription High Capacity cDNA reverse transcription kits (ABI) kits into
Row reverse transcription.
Real-time PCR carry out gene quantification detection using SYBR Premix Ex Taq (TaKaRa), described quantitative
The primer sequence of detection is as shown in table 1 below:
1 primer sequence statistical form of table
The result shows that:
Mouse embryo stem cell R1 is positive (in Fig. 1 shown in A) in alkaline phosphatase (AP);With 40 chromosomes, caryogram
Normally (in Fig. 1 shown in B);The pluripotency marker of R1 cells is detected using immunofluorescence, as a result shows that the cell line exists
Protein expression versatility gene Oct4, Sox2 and Nanog (in Fig. 1 shown in C);Real-Time results show that R1 cells exist
MRNA level in-site expresses versatility gene Oct4, Sox2, Nanog and Rex1 (in Fig. 1 shown in D).
Then, mice embryonic stem cell system R1 is seeded in the culture plate containing feeder cells (cell that often pipe freezes can
It is seeded in 16 orifice plates), culture solution is ES culture solutions, is basic culture medium with DMEM, contains quality in the ES culture solutions
It is 15% fetal calf serum of score, 2mM glutamine, 0.1mM β mercaptoethanols, 1000U/mL leukocyte inhibitory factors, 1% nonessential
Amino acid and mass fraction 1% it is dual anti-, the working concentration of penicillin therein is 100U/ml, and the working concentration of streptomysin is
0.1mg/ml;The constituent concentration respectively added is its final concentration in ES culture solutions, and condition of culture is saturated humidity, 37
DEG C, 5%CO2(volume fraction), 21%O2(volume fraction).Liquid is changed daily, and every 2 days are 0.25% with 500 μ L pancreatin mass fractions
The digestion of pancreatin digestive juice after, passage is primary.
2) pig cell culture:
First, Primary Murine Embryos Fibroblast Feeder Layer cell is prepared, the Mouse feeder confluent monolayer cells are used for cultivating pig more
Energy stem cell, the fibroblastic culture of pig does not need feeder cells.
The specific method is as follows:
A. the fibroblastic original cuiture of mouse fetal:
By 13.5 days of natural mating pregnant mouse (B6 mouse), the neck that breaks was put to death, 75% chronic ethanol treated mice fur and tester
Tool sterilizes, and is open in abdomen and removes uterus, and the uterus of acquisition is placed in containing in dual anti-physiological saline, and physiology salt is used in big ware
After water rinses repeatedly, while the big ware containing dual anti-physiological saline is replaced in time, until not containing blood in flushing liquor, tweezers are by uterus
Wall, which peels off, takes out the completely tire mouse containing placenta and fetal membrane, and by it with containing dual anti-salt water washing, until colourless, tweezers are gone
Except placenta and fetal membrane, in fetus stripping to the big ware for filling dual anti-brine, with tweezers stripping head, tail, four limbs, internal organ, back is stayed
Ridge is placed in the small plate of import and shreds by the part in portion, salt water washing ridge 2-3 times, until tissue block is 1 cube
Millimeter digests 5min with the 2ml clostridiopetidase A IV for containing DnaseI, and carrying out termination with the culture solution of the 20%FBS of 2 times of volumes of enzyme disappears
Change.1000 μ l pipette tips of decaptitating are blown and beaten repeatedly, finally move into suspension in centrifuge tube, and 1200rpm/min centrifuges 3min, after centrifugation
Cell and tissue block is resuspended with 20%FBS culture solutions, is inoculated into the big ware of import, changes liquid every other day, one to density two days later reaches
After 90% or more, passed on.Condition of culture is saturated humidity, 37 DEG C, 5% (volume fraction) CO2, 21% (volume fraction) O2。
B. prepared by feeder cells:
Density is reached into 90% 3-4 for mouse fetal fibroblast, mitomycin C is added in 20%FBS culture solutions
Make its final concentration of 10 μ g/ml, carry out processing 2-3 hours, removes the culture solution containing mitomycin C.DPBS washes cell three times,
0.25% 37 DEG C of pancreatin digests 1min, and when cell largely falls off from ware bottom, the culture solution that twice of addition enzyme amount is terminated,
Piping and druming ware bottom makes 95% or more cell be split away off from culture dish, and cell suspension is collected into 15ml centrifuge tubes,
1200rpm/min centrifuges 3min, abandons supernatant, and the frozen stock solution that appropriate 4 DEG C of precoolings are added is frozen.Cryopreservation tube is put into freezing storing box
In, freezing storing box is put into minus 80 refrigerator (if being frozen using program without freezing storing box in experiment at the end of experiment:4 DEG C of cryopreservation tube
20min, minus 20 DEG C of 2h), cryopreservation tube was transferred in liquid nitrogen in second day and is preserved.
Pig embryos Fibroblast cell-culture
The fibroblastic original cuiture of a Pig embryos
Uterus is surveyed along one and is cut off, the fetus of the 33.5d with amnion is taken out, is placed in containing in dual anti-physiological saline.
It is cleaned with containing dual anti-physiological saline, moves into another big ware containing physiological saline, repeats this step to life
It manages brine and no longer carries color.Fetus is suspended in above the big ware containing DPBS by tweezers, with tweezers isolating fetal and placenta, fetus
It falls into DPBS, abandons embryo outside organization, with tweezers stripping head, tail, four limbs, internal organ, stay the part at back, shredded as possible, be in
Paste.10min is digested with the 5-7ml clostridiopetidase A IV for containing DnaseI.Digestion is terminated with the 20%FBS culture solutions of 2 times of volumes of enzyme,
1000 μ l pipette tips of decaptitating are blown and beaten repeatedly, until without big tissue block, suspension moves into centrifuge tube, and 1200g centrifuges 3min, fresh
The cell of suspension and tissue block resuspension are inoculated into import 90mm wares by 20%FBS culture solutions, and a fetus is inoculated into one big
In ware.One to after density reaches 90% or more two days later, is passed on.Condition of culture is saturated humidity, 39 DEG C, 5% (volume point
Number) CO2, 21% (volume fraction) O2。
B Pig embryos Fibroblast cell-cultures
Pig fibroblast adherent growth, will not form clone, and need to only digest can become unicellular.
The Pig embryos fibroblast is in 15%FBS cell culture fluids, and per 2-3 days, passage was primary, and density reaches
90% passage, culture solution is discarded, and DPBS is cleaned 1 time, the pancreatin digestive juice that pancreatin mass fraction is 0.25% is added, 37 DEG C disappear
Change 1-2min, the 15%FBS cell culture fluids being added with pancreatin digestive juice equivalent terminate, and 1200g centrifuges 3min, according to 1:3
In ratio passage to tissue culture plate, condition of culture:39 DEG C, the CO of volume fraction 5%2, volume fraction 21% O2;Described 1:3
Ratio refer to cell that 1 culture hole digests out, 3 holes are passed in secondary culture and are cultivated.
2. unicellular fusion
Fused cell is obtained for convenience of observation, we have carried out fluorescence egg to R1 cell lines and Pig embryos fibroblast
White marker.The specific method is as follows:
Mouse embryo stem cell carries out red fluorescence label:
By the e. coli jm109 containing FUW-Dsred plasmid vectors, utilizeHiPure Plasmid
Maxiprep Kit carry out a large amount of extractions of plasmid, utilize Lipofectamine LTX and Plus transfection reagent boxes, transfection
293T cells replace 15ml mass fractions as 2% fetal calf serum FBS culture solutions after transfecting 12h, continue to cultivate after changing liquid, for 24 hours
Virus is collected respectively with 48h.After collection virus concentrated with the viral concentration column of 100.000NMWL, be stored in -80 DEG C it is standby
With.After each concentrating virus, viral efficiency of infection is different, needs relatively to filter out optimal use dosage with control group.
Secondary culture will be carried out in mice embryonic stem cell system R1 cell inoculations to 24 orifice plates, the FUW-Dsred that will be frozen
Virus is added separately in 24 orifice plates, and after 48 hrs, clone R1-FD of the picking with red fluorescence is carried out under fluorescence microscope
Passage, finally obtains R1-FD cell lines (as shown in A, B in Fig. 2).
Pig embryos fibroblast (PEF) carries out green fluorescent label:
By the e. coli jm109 containing FUW-Egfp plasmid vectors, utilizeHiPure Plasmid
Maxiprep Kit carry out a large amount of extractions of plasmid, utilize Lipofectamine LTX and Plus transfection reagent boxes, transfection
293T cells replace 15ml 2%FBS culture solutions after transfecting 12h, continue to cultivate after changing liquid, disease is collected respectively with 48h for 24 hours
Poison.Virus after collection is concentrated with the viral concentration column of 100.000NMWL, is stored in -80 DEG C of spare, each concentrating virus
Afterwards, viral efficiency of infection is different, needs relatively to filter out optimal use dosage with control group.
Pig embryos fibroblast (PEF) is inoculated into 24 orifice plates and carries out secondary culture, by the FUW-Egfp frozen diseases
Poison is added separately in 24 orifice plates, and after 48 hrs, clone PEF-FE of the picking with green fluorescence is carried out under fluorescence microscope
Passage, finally obtains PEF-FE cell lines (as shown in C, D in Fig. 2).
For unicellular fusion flow as shown in B in Fig. 3, it is described that the specific method is as follows:
Glass tube (firing is pointed) picking R1-FD clones 3 and is transferred to the pancreas for being 0.25% containing mass fraction with mouth suction pipe
In the pancreatin digestive juice of 20 μ L of enzyme (being preheated through 37 DEG C), 37 DEG C of 1min, then plus the ES culture solutions of 20 μ L terminate digestion, pig
Fibroblast adherent growth will not form clone, it is possible to directly be digested in 24 orifice plates, add 50 μ L pancreatin quality
The pancreatin digestive juice that score is 0.25% (preheats) digestion 1min through 37 DEG C, you can becomes unicellular, then adds 20 μ L15% tires
The cell culture fluid of cow's serum terminates digestion, and mouse embryo stem cell and Pig embryos fibroblast are digested slender respectively
Born of the same parents, using the ES culture solutions of serum-free, the basal medium of the ES culture solutions of the serum-free is DMEM, the ES of the serum-free
It is also white for 15% fetal calf serum, 2mM glutamine, 0.1mM β mercaptoethanols, 1000U/mL containing mass fraction in culture solution
Cytostatic factor, 1% nonessential amino acid of mass fraction, mass fraction 1% are dual anti-, and the working concentration of wherein penicillin is
The working concentration of 100U/ml, streptomysin are 0.1mg/ml;3 μM of CHIR99021 and 1 μM of PD0325901, it is described respectively to add
Constituent concentration is its final concentration in the ES culture solutions of serum-free.Cell agglutinin, the cell agglutinin final concentration is added
100 μ g/ml obtain the ES culture solutions of serum-free and the mixed liquor of cell agglutinin, and in 35mm culture dishes, 2 μ l droplets are made
It 30, is covered with paraffin oil, then R1-FD individual cells is added in 1 droplet, then PEF-FE individual cells are bonded R1-
FD cells, it is one-to-one unicellular right to be built into, and after 20min, the cell that 2 are attached onto is sucked into glass tube, then
It is that 50% polyethylene glycol PEG, 1500 aqueous solutions will be in glass tube after standing 1min to suck 1 μ l polyethylene glycol volume fractions again
Unicellular pair and polyethylene glycol PEG1500 aqueous solutions add in 96 orifice plates, according to mouse embryo stem cell condition of culture into
Row fusion culture, that is, saturated humidity, 37 DEG C, 5% (volume fraction) CO2, 21% (volume fraction) O2.Remaining each droplet, R1-FD
Individual cells, PEF-FE individual cells repeat above-mentioned fusion treatment process.
The fused cell R1-PEF obtained through culture, as shown in D in Fig. 3, cell had both expressed red fluorescence or had expressed green
Fluorescence, the visible fused cell form in the two row leftmost sides is not the crowned of mES, and tends to be flat;Intermediate and right diagram point
It Wei not detect fused cell Green fluorescence and red fluorescence under fluorescence microscope, show mouse stem cells with Pig embryos at fibre
Cell is unicellular merges successfully for dimension.
Fused cell culture can carry out secondary culture after 7 days, the secondary culture according to mouse embryo stem cell culture
Condition carries out, and uses TrypLETM37 DEG C of digestion 3min of Express enzymes, specific dosage are trained with reference to specification with the ES of enzyme equivalent
Nutrient solution terminates digestion, and culture solution is ES culture solutions used in the fused cell culture.
The 2. unicellular fusion method of pig mouse cell of embodiment, repeat embodiment 1, the present embodiment it is different from embodiment 1
In pig mouse cell is selected as in the present embodiment:Mouse embryo stem cell is R1 systems cell, and pig cell is pig multipotent stem cells
The cultural method of KO, the pig multipotential cell KO is:By pig multipotent stem cells KO, carried out in KO-DMEM culture solutions
Culture discards culture solution in passage, and DPBS is cleaned 1 time, and final concentration of 1mg/ml clostridiopetidase As IV is added in 39 DEG C of incubators
4min is digested, clostridiopetidase A is discarded, DPBS is washed 1 time, removes DPBS solution, uses ES culture solutions that precipitation is resuspended again, and clone is blown and beaten
After uniform small agglomerate, 1:2 are passaged on the culture plate of the feeder cells of inoculation mitomycin C processing, and described 1:2
Refer to the cell that 1 culture hole digests out, 2 holes are passed in secondary culture and are cultivated.In KO-DMEM culture solution cultures
The final concentration of 10 μm of ol/L of inhibitor Y27632, the inhibitor Y27632 in KO-DMEM culture solutions are added in liquid.Culture
Condition:Saturated humidity, 39 DEG C, 5% (volume fraction) CO2, 5% (volume fraction) O2,。
Method with reference to described in embodiment 1 is that R1 systems cell carries out red fluorescence label to mouse embryo stem cell, is obtained
R1-FD cell lines are obtained, pig multipotent stem cells KO carries out green fluorescent label and obtains KO-FE cell lines.
Wherein pig multipotent stem cells can form clone through culture, with glass tube respectively (firing is pointed) picking after culture
R1-FD clones 3 and KO-FE and clones 3, and the pancreatin (being preheated through 37 DEG C) for being 0.25% containing mass fraction is transferred to mouth suction pipe
20 μ L pancreatin digestive juice in, 37 DEG C of 1min, R1-FD clone plus 20 μ L ES culture solutions terminate digestion, KO-FE clone plus
20ulKO-DMEM culture solutions terminate digestion, mouse embryo stem cell and pig multipotent stem cells be digested respectively it is unicellular,
Follow-up unicellular fusion method is with reference to described in embodiment 1.
The fused cell R1-KO obtained through culture in the present embodiment, cell had both expressed red fluorescence or had expressed green fluorescence,
Show mouse stem cells and pig multipotent stem cells are unicellular merges successfully.Fused cell form is not the crowned of mES, and becomes
In flat.
The 3. unicellular fusion method of pig mouse cell of embodiment, repeat embodiment 1, the present embodiment it is different from embodiment 1
In pig mouse cell is selected as in the present embodiment:Mouse embryo stem cell is F1 systems cell, and pig cell is Pig embryos into fiber finer
Born of the same parents PEF, cell culture condition is with fusion method with reference to embodiment 1.
The fused cell F1-PEF obtained through culture, cell had both expressed red fluorescence or had expressed green fluorescence, showed mouse
Stem cell with Pig embryos fibroblast is unicellular merges successfully.Fused cell form is not the crowned of mES, and tends to be flat
Shape.
The 4. unicellular fusion method of pig mouse cell of embodiment, repeat embodiment 2, the present embodiment it is different from embodiment 2
In pig mouse cell is selected as in the present embodiment:Mouse embryo stem cell is F1 systems cell, and pig cell is pig multipotential cell
KO,
Unicellular fusion method is with reference to embodiment 2.
The fused cell F1-KO obtained through culture, cell had both expressed red fluorescence or had expressed green fluorescence, showed that mouse is dry
Cell with pig multipotent stem cells are unicellular merges successfully.Fused cell form is not the crowned of mES, and tends to be flat.
1. conventional cell fusion method of comparative example.
As a contrast, fusion experiment is carried out to non-blooming R1 cells and PEF cells using traditional cell fusion method,
In technology path such as Fig. 3 shown in A.WithDyeCycleTMDyestuff dyes the cell of fusion, is carried out after 6 hours
Streaming is screened.The fused cell of acquisition obtains cell clone through culture, as shown in C in Fig. 3.The specific method is as follows:
The specific method is as follows:The pancreatin digestive juice for being 0.25% by 37 DEG C of preheating pancreatin mass fractions, 1min digest mouse
Embryonic stem cell adds the ES culture solutions of same pancreatin digestive juice equivalent to terminate, and 1200g centrifugations 3min abandons liquid, then with 500 μ LES trainings
Nutrient solution is resuspended, and cell inoculation adds 2mLES culture solutions to being covered in the 6 orifice plates of gelatin in advance, and culture cell is thin to feeder layer
Born of the same parents are fully erased, collect suspension, and 1200g centrifuges 3min, mixing 1 × 108A R1-FD (has infected FUW-Dsred viruses, expression
Red fluorescence) cell and 1 × 108A PEF-FE (having infected FUW-Egfp viruses, express green fluorescence) cell, 1200g centrifugations
3min, DPBS are washed once, and 1200g centrifuges 3min, abandon liquid and 1 × SDS is added, 37 DEG C of incubation 3min, 1200g centrifugation 3min abandon liquid
Add 1500, the 37 DEG C of incubation 1min of 1ml 50%PEG incubated in advance, 10ml DMEM is added dropwise, 1200g centrifuges 3min, and cell connects
Kind arrives the 6 orifice plates culture containing matrigel 6 hours.Suspension is collected, 1200g centrifuges 3min, and phosphate buffer DPBS is washed three times, carefully
Born of the same parents count 1 × 10 per 1ml6A cell adds 2 μ l'sDyeCycleTMGreen stain, 37 DEG C of incubation 30min,
Utilize BD FACSMelodyTMStreaming screening is carried out, then by cell culture in 24 orifice plates containing feeder cells, culture
After obtain fused cell, passed on after 7 days, use TrypLETM37 DEG C of digestion 3min of Express enzymes, with the ES culture solutions with enzyme equivalent
It terminates, the culture solution of fused cell is ES culture solutions.
The streaming screening sequence is as follows:
(1) prepare before loading:The ethyl alcohol that volume fraction is 75%, sterile water, DPBS;(2) 3L bodies are added in sheath fluid bucket
Fraction is 75% ethyl alcohol, after covering lid, rocks sheath fluid bucket;(3) machine is connected;(4) software is opened, new experiment is established,
Loading analyzes cell and screening door is arranged;(5) 2 BD collecting pipes are installed and 500 μ l DPBS is wherein added;(6) cell is screened;
(7) sheath fluid bucket is disconnected, 3ml sterile waters are added, are cleaned;(8) cleaning solution is finally used, is cleaned;(10) it shuts down.
The acquisition of xenogenesis fused cell and efficiency compare
2 × 10 are needed in traditional fusion experiment6A cell, significant difference obtains clone 39 ± 6.3, and (cell is given birth in agglomerate
It is long and be projecting shape, both expressed red fluorescence or expressed green fluorescence), unicellular fusion only needs 80 cells of operation, obtains
Clone 40 ± 4.9.It is for statistical analysis to traditional fusion method and unicellular fusion method cloning efficiency of the present invention,
0.01 differences of p value < are extremely notable.Detailed results such as table 2.For the feasibility of the method for the unicellular fusion of verification, the present invention is using separately
One mice embryonic stem cell system F1 can equally obtain above-mentioned as a result, two kinds of method comparison results are as shown in table 3.
2 xenogenesis R1 and PEF fused data statistical form of table
Every group is repeated 3 times, and b subscripts represent difference extremely significantly (P<0.01), a subscripts represent difference not significantly (P > 0.05)
3 xenogenesis F1 and PEF fused data statistical form of table
Every group is repeated 3 times, and b subscripts represent difference extremely significantly (P<0.01), a subscripts represent difference not significantly (P > 0.05)
Xenogenesis fused cell biological characteristics:
Fused cell Morphology observation:
In the case where just setting microscope detect cellular morphology after the fused cell secondary culture that embodiment 1-4 is obtained as shown in figure 4,
It can be seen that fused cell form is not the crowned of mES, and tend to be flat.
To prove the species specificity of xenogenesis fused cell, screens mouse specific gene Wdr59 and Akt1 and pig is special
Gene Stat3, detailed results are shown in Fig. 5 shown in A that 4 kinds of xenogenesis fused cells had both expressed the kind specific gene of pig, also expressed small
The kind specific gene of mouse.4 kinds of xenogenesis fused cell AP are positive, and as shown in B in Fig. 5, Real-Time is analysis shows fused cell
Middle versatility gene Sox2 is expressed relative to Pig embryos fibroblast height, and the expression quantity of Nanog is relatively low, and the expression of Oct4 does not have
It is detected, as shown in C in Fig. 5.
Xenogenesis fused cell differentiation capability detects:
To verify the versatility of xenogenesis fused cell, i.e., embryoid body is formed to the differentiation capability of xenogenesis fused cell in vitro
It is detected.Postdigestive xenogenesis fused cell is seeded in the culture dish of the coated 35mm of no matrix, can be formed after cultivating 7d
Embryoid body, as shown in A in Fig. 6, PCR detection embryoid bodies can be sent to triploblastica differentiation, PCR detections primer sequence used certainly
Row are as shown in table 1, and in Fig. 6 shown in B, Gapdh is that reference gene, MyoD and Tagln represent mesoderm, and Sox7 represents entoderm,
Ncam represents ectoderm.Detect the triploblastica Marker (pTagln, pSox7, pNcam) of pig and the triploblastica of mouse simultaneously
Marker(mMyoD,mSox7,mNcam).Xenogenesis fused cell has the ability broken up to triploblastica.
SEQUENCE LISTING
<110>Northeast Agricultural University
<120>The one unicellular fusion method of boar mouse cell
<130>
<160> 40
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213> pOct4-F
<400> 1
gaaggtgttc agccaaacga c 21
<210> 2
<211> 18
<212> DNA
<213> pOct4-R
<400> 2
cgatacttgt ccgctttc 18
<210> 3
<211> 21
<212> DNA
<213> pSox2-F
<400> 3
aaccagaaga acagcccaga c 21
<210> 4
<211> 21
<212> DNA
<213> pSox2-R
<400> 4
tccgacaaaa gtttccactc g 21
<210> 5
<211> 21
<212> DNA
<213> pNanog-F
<400> 5
cctccatgga tctgcttatt c 21
<210> 6
<211> 20
<212> DNA
<213> pNanog-R
<400> 6
catctgctgg aggctgaggt 20
<210> 7
<211> 24
<212> DNA
<213> pGapdh-F
<400> 7
gcaaagtgga cattgtcgcc atca 24
<210> 8
<211> 24
<212> DNA
<213> pGapdh-R
<400> 8
tcctggaaga tggtgatggc cttt 24
<210> 9
<211> 23
<212> DNA
<213> pNcam-F
<400> 9
tgaacctaat caagcaggac gac 23
<210> 10
<211> 24
<212> DNA
<213> pNcam-R
<400> 10
agagaaaagc aatgagacaa acgt 24
<210> 11
<211> 24
<212> DNA
<213> pTagln-F
<400> 11
ccataagagg gaattcacag agag 24
<210> 12
<211> 23
<212> DNA
<213> pTagln-R
<400> 12
ctgggatgag gagacagtag agc 23
<210> 13
<211> 20
<212> DNA
<213> pSox17-F
<400> 13
gacatgaaga tgaagggcga 20
<210> 14
<211> 22
<212> DNA
<213> pSox17-R
<400> 14
gtacttgtag ttggggtggt cc 22
<210> 15
<211> 23
<212> DNA
<213> pStat3-F
<400> 15
aactttatca gtaaggagag gga 23
<210> 16
<211> 21
<212> DNA
<213> pStat3-R
<400> 16
gacacaagga tgttggtagc a 21
<210> 17
<211> 20
<212> DNA
<213> mGapdh-F
<400> 17
cccactaaca tcaaatgggg 20
<210> 18
<211> 20
<212> DNA
<213> mGapdh-R
<400> 18
ccttccacaa tgccaaagtt 20
<210> 19
<211> 23
<212> DNA
<213> mOct4-F
<400> 19
tctttccacc aggcccccgg ctc 23
<210> 20
<211> 23
<212> DNA
<213> mOct4-R
<400> 20
tgcgggcgga catggggaga tcc 23
<210> 21
<211> 23
<212> DNA
<213> mSox2-F
<400> 21
tagagctaga ctccgggcga tga 23
<210> 22
<211> 23
<212> DNA
<213> mSox2-R
<400> 22
ttgccttaaa caagaccacg aaa 23
<210> 23
<211> 20
<212> DNA
<213> mNanog-F
<400> 23
cacccaccca tgctagtctt 20
<210> 24
<211> 20
<212> DNA
<213> mNanog-R
<400> 24
accctcaaac tcctggtcct 20
<210> 25
<211> 24
<212> DNA
<213> mAfp-F
<400> 25
catcaccttt acccagtttg ttcc 24
<210> 26
<211> 24
<212> DNA
<213> mAfp-R
<400> 26
gacactgatg tctttccact ccac 24
<210> 27
<211> 24
<212> DNA
<213> mSm22-a-F
<400> 27
gctgaagaat ggtgtgattc tgag 24
<210> 28
<211> 24
<212> DNA
<213> mSm22-a-R
<400> 28
ccttcataga ggtcaacagt ctgg 24
<210> 29
<211> 24
<212> DNA
<213> mNcam-F
<400> 29
tgctcaa`gtc cctagactgg aacg 24
<210> 30
<211> 26
<212> DNA
<213> mNcam-R
<400> 30
cttctcgggc tctgtcagtg gtgtgg 26
<210> 31
<211> 19
<212> DNA
<213> mSox17-F
<400> 31
ggcacggaac ccaaccagc 19
<210> 32
<211> 25
<212> DNA
<213> mSox17-R
<400> 32
cagtcgtgtc cctggtaggg aagac 25
<210> 33
<211> 23
<212> DNA
<213> mMyoD-F
<400> 33
gctcaggaag attgctgtgt cca 23
<210> 34
<211> 24
<212> DNA
<213> mMyoD-R
<400> 34
CCGCAACACTCCATGCATATCTCC 24
<210> 35
<211> 24
<212> DNA
<213> mRex1-F
<400> 35
acgagtggca gtttcttctt ggga 24
<210> 36
<211> 24
<212> DNA
<213> mRex1-R
<400> 36
tatgactcac ttccaggggg cact 24
<210> 37
<211> 18
<212> DNA
<213> mWdr59-F
<400> 37
ctgggaacct gcgtctgt 18
<210> 38
<211> 19
<212> DNA
<213> mWdr59-R
<400> 38
cggagttggc aatagtgag 19
<210> 39
<211> 20
<212> DNA
<213> mAkt1-F
<400> 39
gcacaagcga ggggagtaca 20
<210> 40
<211> 19
<212> DNA
<213> mAkt1-R
<400> 40
caggcagcgg atgatgaag 19
Claims (10)
1. a unicellular fusion method of boar mouse cell, which is characterized in that be to pass through mouse embryo stem cell respectively with pig cell
Pancreatin be digested to it is unicellular after, it is one-to-one unicellular right to be built into using cell agglutinin, described unicellular in poly- second two
Fused culture obtains fused cell under the action of alcohol, and the pig cell is pig multipotent stem cells or Pig embryos into fiber finer
Born of the same parents.
2. the unicellular fusion method of boar mouse cell according to claim 1, which is characterized in that the fusion method tool
Body includes the following steps:
1) cell culture:Mouse embryo stem cell is cultivated in ES culture solutions respectively, it is thin to obtain mouse embryo stem cell
Born of the same parents clone;By Pig embryos fibroblast in the cell culture fluid containing 15% mass content fetal calf serum, obtained through culture
Pig embryos fibroblast;Or pig multipotent stem cells are seeded to the mouse fetal of mitomycin C processing into fiber finer
It on the feeder cells of born of the same parents, is cultivated in pig multipotent stem cells culture solution, obtains pig multipotent stem cells cell clone;
2) unicellular fusion:Mouse embryo stem cell cell clone after culture is obtained after pancreatin digests respectively with pig cell
Unicellular, the ES culture solutions of serum-free and cell agglutinin are prepared into droplet, and cell agglutinin is final concentration of in the droplet
100μg/mL;By the unicellular and pig cell of mouse embryo stem cell it is unicellular be bonded in each droplet be built into it is one-to-one
It is unicellular right, then fused culture obtains fused cell under the action of polyethylene glycol.
3. the unicellular fusion method of boar mouse cell according to claim 2, which is characterized in that the step 1) pig is more
Energy property stem cell medium adds the ROCK1 inhibitor of final concentration of 10 μm of ol/L.
4. the unicellular fusion method of boar mouse cell according to claim 2, which is characterized in that step 1) the ES trainings
The basal medium of nutrient solution is DMEM, fetal calf serum, 2mM glutamy in the ES culture solutions also containing mass fraction 15%
Amine, 0.1mM beta -mercaptoethanols, 1000U/mL leukocyte inhibitory factors, 1% nonessential amino acid of mass fraction and mass fraction
1% is dual anti-, each adding ingredient it is a concentration of its ES cultivate liquid culture medium in final concentration, it is described it is dual anti-refer to containing simultaneously
There is the reagent of two kinds of antibiotic of penicillin and streptomysin;The Mouse Embryonic Stem Cell Culture condition is:Saturated humidity, 37 DEG C,
The CO of volume fraction 5%2, volume fraction 21% O2。
5. the unicellular fusion method of boar mouse cell according to claim 2, which is characterized in that step 1) the pig embryo
The fibroblastic culture solution of tire is the cell culture fluid of 15% fetal calf serum, is that the DMEM for being 82% by mass fraction is cultivated
The L- paddy ammonia that nonessential amino acid that fetal calf serum that base, mass fraction are 15%, mass fraction are 1%, mass fraction are 1%
The dual anti-composition of amide and mass fraction 1%, its a concentration of final concentration in cell culture fluid of each adding ingredient, institute
It refers to reagent simultaneously containing two kinds of antibiotic of penicillin and streptomysin, the Pig embryos Fibroblast cell-culture item to state dual anti-
Part:39 DEG C, the CO of volume fraction 5%2, volume fraction 21% O2;
The basal medium of the pig multipotent stem cells culture solution is KnockOut DMEM culture solutions, also contains mass fraction
0.5%N2 cell culture additive, the B27 additives of mass fraction 1%, 0.25mg/ml bovine serum albumin(BSA)s, mass fraction
1%L- glutamine, 1% nonessential amino acid of mass fraction, 0.2mM beta -mercaptoethanols, 40 μ g/ml vitamin Cs, 5ng/ml people
Source leukocyte inhibitory factor, 16ng/ml basic fibroblast growth factors and mass fraction 1% are dual anti-, each ingredient
Its a concentration of final concentration in KnockOut DMEM culture solutions, it is described it is dual anti-refer to simultaneously contain penicillin and streptomysin two
The reagent of kind antibiotic, the pig multipotent stem cells condition of culture are:The CO of 39 DEG C of temperature, volume fraction 5%2, volume point
The O of number 5%2。
6. the unicellular fusion method of boar mouse cell according to claim 2, which is characterized in that step 2) the no blood
The basal medium of clear ES culture solutions is DMEM, also contains 2mM glutamine, 0.1mM β in the ES culture solutions of the serum-free
Mercaptoethanol, 1000U/mL leukocyte inhibitory factors, 1% nonessential amino acid of mass fraction, mass fraction 1% be dual anti-, 3 μM
CHIR99021 and 1 μM of PD0325901, the constituent concentration respectively added are it in the ES of serum-free cultivates liquid culture medium
Final concentration, it is described it is dual anti-refer to reagent simultaneously containing two kinds of antibiotic of penicillin and streptomysin.
7. the unicellular fusion method of boar mouse cell according to claim 2, which is characterized in that the step 2) pancreatin
Digestion refers to each mouse embryo stem cell cell clone, and to be utilized respectively 20 μ L pancreatin mass fractions with pig cell be 0.25%
Pancreatin digestive juice digests 1min at 37 DEG C, used training when being then respectively adding mouse embryo stem cell with pig cell culture
Nutrient solution stops digestion.
8. the unicellular fusion method of boar mouse cell according to claim 4, which is characterized in that the step 2) fusion
Before culture, the polyethylene glycol 1500 aqueous solution that 1 μ L polyethylene glycol volume fractions are 50% is added to each pair of unicellular centering, it is quiet
It sets to be transferred to after 1min in fusion culture solution and cultivate, the fusion culture solution is ES culture solutions.
9. the unicellular fusion method of boar mouse cell according to claim 4, which is characterized in that the step 2) fusion
Culture refers to cultivating the cell after fusion in ES culture solutions according to the condition of culture of mouse embryo stem cell, fusion training
It is that the cell mass after the pancreatin digestive juice for being 0.25% with pancreatin mass fraction after 7 days, 7 days cultivates fusion disappears to support the time
Change, 37 DEG C of digestion 3min are used in combination after being terminated with the ES culture solutions of pancreatin digestive juice equivalent and enter secondary culture.
10. the unicellular fusion method of boar mouse cell according to claim 9, which is characterized in that the step 2) pancreas
Enzyme is TrypLE Express enzymes.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810553064.2A CN108707600A (en) | 2018-05-31 | 2018-05-31 | The one unicellular fusion method of boar mouse cell |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810553064.2A CN108707600A (en) | 2018-05-31 | 2018-05-31 | The one unicellular fusion method of boar mouse cell |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108707600A true CN108707600A (en) | 2018-10-26 |
Family
ID=63870081
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810553064.2A Pending CN108707600A (en) | 2018-05-31 | 2018-05-31 | The one unicellular fusion method of boar mouse cell |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108707600A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114423778A (en) * | 2019-09-20 | 2022-04-29 | 甲贺美智子 | Peptides, cell fusion agents comprising the same, and pharmaceutical compositions for cancer treatment |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN87104270A (en) * | 1986-06-24 | 1988-01-27 | 默里尔多药物公司 | Improved fusion method |
CN1865435A (en) * | 2005-05-20 | 2006-11-22 | 中国科学院上海生命科学研究院 | Human embryo stem cell and its culture method |
-
2018
- 2018-05-31 CN CN201810553064.2A patent/CN108707600A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN87104270A (en) * | 1986-06-24 | 1988-01-27 | 默里尔多药物公司 | Improved fusion method |
CN1865435A (en) * | 2005-05-20 | 2006-11-22 | 中国科学院上海生命科学研究院 | Human embryo stem cell and its culture method |
Non-Patent Citations (3)
Title |
---|
M-F HE等: "Modeling cell-in-cell structure into its biological significance", 《CELL DEATH AND DISEASE》 * |
MONIKA NOWAK-INIALEK等: "Preferential Loss of Porcine Chromosomes in Reprogrammed Interspecies Cell Hybrids", 《CELLULAR REPROGRAMMING》 * |
赵志强: "《细胞电融合技术》", 31 July 2008, 重庆大学出版社 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114423778A (en) * | 2019-09-20 | 2022-04-29 | 甲贺美智子 | Peptides, cell fusion agents comprising the same, and pharmaceutical compositions for cancer treatment |
CN114423778B (en) * | 2019-09-20 | 2024-05-24 | 甲贺美智子 | Peptide, cell fusion agent comprising same, and pharmaceutical composition for cancer treatment |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1934245B (en) | Method of proliferating pluripotent stem cell | |
JP2008017840A (en) | Growth of embryonic stem cell | |
EP1384775A1 (en) | Somatic pluripotent cells | |
CN103237886A (en) | Non-static suspension culture of cell aggregates | |
CN101402943B (en) | Method for in vitro induction and cultivation of multi-potentiality stem cell | |
CN109385404B (en) | Method for inducing stem cells to differentiate into neurons, neurons and application | |
CN108795850B (en) | Long-term culture method for spermatogonial stem cells without feed layer in vitro | |
CN104774808A (en) | Method for inducible differentiation of umbilical cord mesenchymal stem cells into gamma-aminobutyric acid-ergic neuron | |
CN115975914A (en) | Method for inducing pluripotent stem cells by reprogramming of chemical small molecule drugs | |
CN106754729A (en) | The method for preparing inductive pluripotent stem cells using Xist Tale inhibition transcription factors | |
CN104946581B (en) | A kind of special culture media and method for cultivating pig cytotrophoblast stem cells | |
CN100540659C (en) | A kind of method and special culture media thereof of cultivating mouse embryo stem cell | |
CN108707600A (en) | The one unicellular fusion method of boar mouse cell | |
CN105441386A (en) | Culture and identification method for very small porcine embryonic-like stem cells | |
Van Vranken et al. | The differentiation of distal lung epithelium from embryonic stem cells | |
García-López et al. | Human amniotic epithelium (HAE) as a possible source of stem cells (SC) | |
CN114276984B (en) | Method for transdifferentiating female germ stem cells into functional sperm and application | |
CN103305459A (en) | Method for conversion of porcine spermatogonia stem cell into embryonic stem cell-like cell by small molecule induction | |
CN113046311B (en) | Method for inducing pluripotent stem cells to directionally differentiate into lymphoid tissue inducing cells | |
CN107723273A (en) | A kind of preparation method of the induction goat multipotential stem cell of micromolecular compound completely | |
CN106085951A (en) | A kind of method setting up the sustainable tree stem spermatogonium cell line passed on | |
WO2016052759A1 (en) | Method for reestablishing pluripotent stem cells | |
CN107245474A (en) | A kind of mankind's inductive pluripotent stem cells isolated culture method without feeder layer serum-free | |
US9976118B2 (en) | Method for inducing tailored pluripotent stem cells using extract of plant stem cells or plant dedifferentiated stem cells, and pluripotent stem cells produced by means of the method | |
CN106282097A (en) | Induced multi-potent stem cell, the method preparing induced multi-potent stem cell |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |