CN108707600A - The one unicellular fusion method of boar mouse cell - Google Patents

Abstract

The one unicellular fusion method of boar mouse cell, belongs to cell engineering field.The present invention is for the low problem of current heterogenous cell fusion efficiencies, provide a kind of unicellular fusion method, using mouse embryo stem cell and pig multipotent stem cells or pig fibroblast as cell fusion partner, with the digestive juice for the pancreatin for being 0.25% containing mass fraction by pig, mouse cell dissociation at unicellular, after culture, it is one-to-one unicellular right to be built using cell agglutinin, 1min is cultivated in the polyethylene glycol for being 50% containing mass fraction, cell is then continued into culture 7 days, obtains the single celled fused cell of pig mouse.The present invention is suitable for study on animal breeding or the production of monoclonal antibody.

Description

The one unicellular fusion method of boar mouse cell

Technical field

The invention belongs to cell engineering fields, and in particular to a unicellular fusion method of boar mouse cell.

Background technology

Cell fusion experiment starts from 1969, most important for basic research, also has important application value, so far Until the present there are mainly three types of cell fusion methods, sendai virus, electro' asion and polyethylene glycol (PEG).But main utilization at present Polyethylene glycol mediated cell merges, and Cowan utilizes 5 × 10⁷Personal embryonic stem cell and 5 × 10⁷Individual cells merge, fusion Efficiency is only 0.000004%, obtains 2 clones.Yu passes through 1.3 × 10⁷Personal stem cell and 4.7 × 10⁷A bone marrow precursors Cell fusion, efficiency also only have 0.00067%, and fusion efficiencies are increased to 0.005% by merging people by Hasegawa in 2010 When carrying out control fusion, fusion efficiencies are improved, by 0.5 × 10 by fibroblast and people ES, Sumer⁶A mouse ES cells and 1 × 10⁶A mouse fetal fibroblast fusion efficiencies are up to 0.77%, and 0.5 × 10⁶A mouse induces stem cell (mips) and 1x10⁶A mouse fetal fibroblast fusion efficiencies are 1.74%, and lower fusion efficiencies are always a problem, Especially heterogenous cell fusion efficiencies are lower.

Invention content

For the low problem of current heterogenous cell fusion efficiencies, the present invention provides a unicellular fusion sides of boar mouse cell Method, be by mouse embryo stem cell and pig cell respectively through pancreatin be digested to it is unicellular after, be built into one using cell agglutinin To one it is unicellular right, it is described it is unicellular under the action of polyethylene glycol fused culture obtain fused cell, the pig is thin Born of the same parents are pig multipotent stem cells or Pig embryos fibroblast.

The fusion method specifically comprises the following steps：

1) cell culture：Mouse embryo stem cell is cultivated in ES culture solutions respectively, it is thin to obtain mouse embryonic stem Born of the same parents' cell clone；By Pig embryos fibroblast in the cell culture fluid containing 15% mass content fetal calf serum, through culture Obtain Pig embryos fibroblast；Or pig multipotent stem cells are seeded to the mouse fetal of mitomycin C processing into fibre It on the feeder cells for tieing up cell, is cultivated in pig multipotent stem cells culture solution, obtains pig multipotent stem cells cell Clone；

2) unicellular fusion：By mouse embryo stem cell cell clone and the pig cell after culture respectively after pancreatin digests Obtain unicellular, the ES culture solutions of serum-free and cell agglutinin are prepared into droplet, and the end of cell agglutinin is dense in the droplet Degree is 100 μ g/mL；Unicellular be bonded in each droplet of the unicellular and pig cell of mouse embryo stem cell is built into one To one it is unicellular right, then fused culture obtains fused cell under the action of polyethylene glycol.

Preferably, step 1) the pig multipotent stem cells culture solution adds the ROCK1 inhibition of final concentration of 10 μm of ol/L Agent.

Preferably, the basal medium of step 1) the ES culture solutions is DMEM, also contains quality in the ES culture solutions The fetal calf serum of score 15%, 2mM glutamine, 0.1mM beta -mercaptoethanols, 1000U/mL leukocyte inhibitory factors, quality point Several 1% nonessential amino acid and mass fraction 1% are dual anti-, each adding ingredient it is a concentration of its ES cultivate liquid culture medium in Final concentration, it is described it is dual anti-refer to reagent simultaneously containing two kinds of antibiotic of penicillin and streptomysin；The mouse embryonic stem is thin Born of the same parents' condition of culture is：Saturated humidity, 37 DEG C, the CO of volume fraction 5%₂, volume fraction 21% O₂。

Preferably, the fibroblastic culture solution of the step 1) Pig embryos is the cell culture fluid of 15% fetal calf serum, Be be 82% by mass fraction DMEM culture mediums, mass fraction be 15% fetal calf serum, mass fraction be 1% it is nonessential The dual anti-composition of amino acid, the L-Glutamine and mass fraction 1% that mass fraction is 1%, the concentration of each adding ingredient The final concentration for being it in cell culture fluid, it is described it is dual anti-refer to examination simultaneously containing two kinds of antibiotic of penicillin and streptomysin Agent, the Pig embryos Fibroblast cell-culture condition：39 DEG C, the CO of volume fraction 5%₂, volume fraction 21% O₂；

The basal medium of the pig multipotent stem cells culture solution is KnockOut DMEM culture solutions, also contains quality Score 0.5%N2 cell culture additive, the B27 additives of mass fraction 1%, 0.25mg/ml bovine serum albumin(BSA)s, quality point Number 1%L- glutamine, 1% nonessential amino acid of mass fraction, 0.2mM beta -mercaptoethanols, 40 μ g/ml vitamin Cs, 5ng/ml Human leukocyte inhibiting factor, 16ng/ml basic fibroblast growth factors and mass fraction 1% are dual anti-, each ingredient Its a concentration of final concentration in KnockOut DMEM culture solutions, it is described it is dual anti-refer to simultaneously contain penicillin and streptomysin The reagent of two kinds of antibiotic, the pig multipotent stem cells condition of culture are：The CO of 39 DEG C of temperature, volume fraction 5%₂, volume The O of score 5%₂。

Preferably, the basal medium of the ES culture solutions of the step 2) serum-free is DMEM, and the ES of the serum-free is trained In nutrient solution also contain 2mM glutamine, 0.1mM β mercaptoethanols, 1000U/mL leukocyte inhibitory factors, mass fraction 1% is non-must Need that amino acid, mass fraction 1% is dual anti-, 3 μM of CHIR99021 and 1 μM of PD0325901, the constituent concentration respectively added is Its final concentration in the ES culture solutions of serum-free, it is described it is dual anti-refer to simultaneously containing two kinds of antibiotic of penicillin and streptomysin Reagent.

Preferably, step 2) the pancreatin digestion refers to that each mouse embryo stem cell cell clone and pig cell are sharp respectively The pancreatin digestive juice for being 0.25% with 20 μ L pancreatin mass fractions digests 1min at 37 DEG C, is then respectively adding mouse embryonic stem Used culture solution stops digesting when cell is with pig cell culture.

Preferably, before step 2) the fusion culture, 1 μ L polyethylene glycol volume fractions are added to each pair of unicellular centering For 50% polyethylene glycol 1500 aqueous solution, stands to be transferred in fusion culture solution after 1min and cultivate, the fusion culture solution is ES Culture solution.

Preferably, step 2) the fusion culture refers to culture item of the cell after merging according to mouse embryo stem cell Part is cultivated in ES culture solutions, and fusion incubation time is that the pancreatin for being 0.25% with pancreatin mass fraction after 7 days, 7 days disappears Change the cell mass after liquid cultivates fusion to digest, the ES culture solutions with pancreatin digestive juice equivalent are used in combination in 37 DEG C of digestion 3min Enter secondary culture after termination.

Preferably, the step 2) pancreatin is TrypLE Express enzymes.

Advantageous effect

2 × 10 are needed in traditional fusion experiment⁶A cell, significant difference obtains clone 39 ± 6.3, and (cell is given birth in agglomerate Grow and be projecting shape, both expressed red fluorescence or expressed green fluorescence), the present invention provides a kind of raising cell fusion efficiencies Method, establish unicellular fusion method, it is only necessary to operate 80 cells, you can obtain clone 40 ± 4.9, pig mouse cell is melted It closes cloning efficiency and has been increased to 50.00%.

The fused cell that the method for the present invention obtains is positive in AP, has both expressed the kind specific gene of pig, also expresses mouse Kind specific gene, and with the ability broken up to triploblastica.

The present invention can be used for studying the nucleocytoplasmic relation of cell, disclose the pathogenetic mechanism of disease, animal breeding or production list gram Grand antibody etc..

Description of the drawings

Fig. 1 versatility of mouse embryo stem cell detects, and wherein A detects for AP；B detects for caryogram；C be Oct4, Sox2, Nanog Immunofluorescence tests, Hoechst are nuclear targeting blue-fluorescence；Alex488 represents gene dyeing green fluorescence；D is Real-Time analyzes the expression of Oct4, Sox2, Nanog, Rex1, and abscissa is target gene to be detected, and ordinate is gene phase To expression quantity.

It is mouse embryo stem cell R1 cell lines that Fig. 2, which marks cell line fluorescent marker schematic diagram, wherein A,；B is mice embryonic Stem cell R1-FD cell lines；C：Pig embryos fibroblast PEF；D:Pig embryos fibroblast PEF-FE cell lines.

Fig. 3 pig mouse heterogenous cells merge, and wherein A is the ideograph of conventional method cell fusion experiment；B is of the present invention Unicellular fusion ideograph；C is the hybrid cells obtained under conventional method fusion system；D is list of the present invention The hybrid cells obtained under cell fusion system, wherein R1/PEF are mouse embryo stem cell R1 systems and Pig embryos into fiber finer The newly formed fused cell state (not yet amplification cultivation) of born of the same parents, hybrid are mouse embryo stem cell R1 systems and Pig embryos into fiber The fused cell (fused cell after culture a period of time) of cell, bright field are microscope white light field, and dsRed is red Color fluorescent marker, GFP are green fluorescent label.

Fig. 4 pig mouse fused cells, wherein P3 represented for the 3rd generation, and P10 represented for the 10th generation, and P20 represented for the 20th generation.

Fig. 5 xenogenesis fused cell specificity analysis, wherein A detects for species specificity, and B detects for AP；C is Real-Time The Oct4 of xenogenesis fused cell, the expression of Sox2, Nanog are analyzed, abscissa is target gene to be detected, and ordinate is gene phase To expression quantity.

Fig. 6 xenogenesis fused cell differentiation capabilities detect, and wherein A is the formation of fused cell embryoid body EB, and B is fused cell Differentiation capability detects, and Gapdh is reference gene, MyoD, Tagln are mesoderm gene, Sox7 is entoderm gene, Ncam is outer Endoderm gene, R1-PEF are mouse embryo stem cell R1 systems and the fibroblastic fused cell of pig, and R1-KO is mouse embryonic stem The fused cell of cell R1 systems and pig multipotent stem cells, F1-PEF are that mouse embryo stem cell F1 systems and pig are fibroblastic Fused cell, F1-KO are the fused cell of mouse embryo stem cell F1 systems and pig multipotent stem cells.

Specific implementation mode

Mice embryonic stem cell system R1 or F1 systems are provided by Zu Pei teaching and research rooms of Harbin Medical University, also can be through commercialization Approach purchase obtains；Pig multipotent stem cells and animal embryo engineering teaching and research room of Pig embryos fibroblast Northeast Agricultural University It provides, it also can be through being commercialized approach purchase.

DMEM culture solutions (Dulbecco'S Modified Eagle Medium) it buys from Gibco, article No.：12100- 046；

Pig embryos are primary, mouse fetal primary cell digestive ferment：Basal medium DMEM+15%FBS+1.6mg/ml collagens IV+Dnase of enzyme, I (250unitz/ml)+1% is dual anti-, and each component content is mass content, refers in DMEM culture solutions Final concentration.

KnockOut^TMDMEM culture solutions (KO-DMEM) are bought from Gibco, article No.：10829-018；

FBS fetal calf serums (Fetal Bovine Serum) are bought from BIOIND, article No.：04-001-1A；

0.25% trypsase (Trypsin-EDTA) is bought from Gibco, article No.：25200；

DPBS(Dulbecco'S Phosphate Buffered Saline), DPBS：1L deionized water dissolving DPBS powder End saves backup for 4 DEG C to final concentration of 0.01M/L after filtering.It buys from Gibco, article No.：21600-010；

Clostridiopetidase A IV (Collagenase IV), IV+DMEM+ mass fractions of final concentration 1mg/ml clostridiopetidase As are 1% dual anti-, The concentration is the final concentration in KO-DMEM, is bought from Sigma, article No.：C-5138；

I enzymes of Dnase are bought from GIGMA, article No.：D-426；

Nonessential amino acid (NEAA) is bought from Invitrogen, article No.：11140-050；

Glutamine (L-Glutamine) is bought from Sigma, article No.：G8540-100G；

Y27632 (EMD4) is bought from Biosciences, article No.：688000；

Human leukocyte inhibiting factor (human LIF) is bought from Millipore, article No.：LIF1010；

Leukocyte inhibitory factor (mouse LIF) is bought from Millipore, article No.：LIF1107；

Mitomycin C (Mitoycin C) is bought from Sigma, article No.：M4287-2MG；

Bovine serum albumin(BSA) (BSA) is bought from Sigma, article No.：A3311；

Beta -mercaptoethanol (β-mercaptoethanol) is bought from Gibco, article No.：21985-023；

B27 additives are bought from Gibco, article No.：17504-044；

N2 cell culture additives are bought from Gibco, article No.：17502-048；

Basic fibroblast growth factor (bFGF) is bought from RD, article No.：233-FB；

Vitamin C (Vitamin C) is bought from Sigma, article No.：A5960；

BCIP/NBT alkaline phosphatase colour reagent boxes are bought from the green skies, article No.：C3206；

Real-Time kits (SYBR Green Realtime PCR Master Mix-Plus), purchase is certainly Takara, article No.：DRR066A；

Reverse transcription reagent box (High Capacity cDNAReverse Transcription Kit) is bought from ABI, Article No.：4368814；

RNA extracts kits (PureLink RNA mini kit) are bought from Llie, article No.：12183018A；

DMEM：1L deionized water dissolving DMEM powder+3.7g NaHCO₃, pH to 7.2 is adjusted, 4 DEG C of preservations are standby after filtering With.

15% fetal calf serum (FBS) cell culture fluid (is suitable for feeder cells, fibroblast, EB cells)：15% Dual anti-+ the 82%DMEM of FBS+1%NEAA+1%L-glutamine+1%, each component content are mass content, refer to thin Final concentration in born of the same parents' culture solution.

2% fetal calf serum (FBS) cell culture：Mass fraction 2%FBS+ mass fractions 98%DMEM；

20% fetal calf serum (FBS) cell culture：Mass fraction 20%FBS+ mass fractions 80%DMEM；

KO culture solutions (pig multipotent stem cells culture solution)：KO-DMEM+0.5%N2 cell culture additives+1%B27 adds Add agent+0.25mg/ml BSA+1%L-glutamine+1%NEAA+0.2mM β-mercaptoethanol+40 μ g/ml VitaminC+5ng/ml human LIF+16ng/ml bFGF+1% are dual anti-, and each component content is mass content, refers to Final concentration in KO-DMEM.

MES culture solutions (Mouse Embryonic Stem Cell Culture liquid)：15%FBS+1%NEAA+1%L-glutamine+1% is bis- Anti-+1000U/mLmLIF+0.1mM β-mercaptoethanol+80.9%DMEM, each component content are mass content, are Refer to the final concentration in mES culture solutions.

The mES culture solutions of serum-free：Dual anti-+ 1000U/mL the mLIF+ of DMEM+1%NEAA+1%L-glutamine+1% - mercaptoethanol+3 μm of CHIR99021+1 μm of PD0325901 of 0.1m β, each component content are mass content, are Refer to the final concentration in the mES culture solutions of serum-free.

Dual anti-refers to the reagent simultaneously containing two kinds of antibiotic of penicillin and streptomysin, is bought from Hyclone, article No.：30- 002-CI；

CHIR99021 is bought from Stemgent, article No.：04-0004；

PD0325901 is bought from Stemgent, article No.：04-0006；

Cell agglutinin is bought from Sigma, article No.：L1668；

Pancreatin is the pancreatin of animal origin unless otherwise specified, is bought from article No.：25200；

It carries out digesting pancreatin used being recombinant type pancreatin TrypLE after obtaining fused cell^TMExpress enzymes, purchase is certainly Gibco, article No.：12605-10；

FUW-Egfp viral vectors is provided by animal embryo engineering teaching and research room of Northeast Agricultural University, also can be through commercialization way Diameter is bought；

FUW-Dsred viral vectors is provided by animal embryo engineering teaching and research room of Northeast Agricultural University, also can be through commercialization way Diameter is bought；

Plasmid extraction kit is TIANprep Mini Plasmid Kit, and purchase has from Tiangeng biochemical technology (Beijing) Limit company, article No.：DP103；

Virus transfection is Lipofectamine LTX and Plus with kit, is bought from Invitrogen, article No.： 15338-100；

293T cells are provided by Histology and Embryology teaching and research room of Harbin Medical University, also commercially viable purchase；

The B6 mouse of feeder cells are used to prepare, are bought in Beijing Vital River Experimental Animals Technology Co., Ltd.；

Paraffin oil is bought from Fisher chemical, model NF/FCC；

Viral concentration column is bought from Millipore, article No.：UFC910096；

DyeCycle^TMGreen stain are bought from invitrogen, article No.：V35004；

Cell sorter is bought from BD, model：BD FACSMelody^TM；

BCIP/NBT alkaline phosphatase colour reagent boxes are bought from the green skies, article No.：C3206；

Other reagents and instrument and equipment used, consumptive material, such as centrifuge, fluorescence microscope, glass tube, mouth suction pipe, training Supporting ware, the 6 orifice plates for cell culture, 96 orifice plates etc. can be obtained by being commercialized approach purchase.

The 1. unicellular fusion method of pig mouse cell of embodiment.

1. cell culture

1) culture of mouse embryo stem cell：

To ensure that fused cell biological characteristic research is comparable, the mouse embryo stem cell that fusion experiment is used It is that R1 carries out versatility identification first.

1. alkaline phosphatase activities detect

The fused cell of acquisition cleans 3 times through DPBS, and the paraformaldehyde that mass fraction is 4% fixes clone 90s, discards more Polyformaldehyde, DPBS are washed 3 times, are detected according to BCIP/NBT alkaline phosphatase colour reagent boxes, and clone's colour developing is in purple State can stop developing the color.Dyeing liquor is removed, DPBS is cleaned 3 times, is taken a picture under the microscope.

2. embryoid body formational situation detects

Digestion 3min rolled into a ball to fused cell using Tryple, cell is separated into after small agglomerate that be seeded in no matrix coated In plate, 7-10d is cultivated in 15%FBS cell culture fluids.

3. RNA is extracted, reverse transcription, Real-time PCR

The RNA of fused cell is extracted using RNA purification kits (PureLink RNA mini kit, Life).

Using reverse transcription High Capacity cDNA reverse transcription kits (ABI) kits into Row reverse transcription.

Real-time PCR carry out gene quantification detection using SYBR Premix Ex Taq (TaKaRa), described quantitative The primer sequence of detection is as shown in table 1 below：

1 primer sequence statistical form of table

The result shows that：

Mouse embryo stem cell R1 is positive (in Fig. 1 shown in A) in alkaline phosphatase (AP)；With 40 chromosomes, caryogram Normally (in Fig. 1 shown in B)；The pluripotency marker of R1 cells is detected using immunofluorescence, as a result shows that the cell line exists Protein expression versatility gene Oct4, Sox2 and Nanog (in Fig. 1 shown in C)；Real-Time results show that R1 cells exist MRNA level in-site expresses versatility gene Oct4, Sox2, Nanog and Rex1 (in Fig. 1 shown in D).

Then, mice embryonic stem cell system R1 is seeded in the culture plate containing feeder cells (cell that often pipe freezes can It is seeded in 16 orifice plates), culture solution is ES culture solutions, is basic culture medium with DMEM, contains quality in the ES culture solutions It is 15% fetal calf serum of score, 2mM glutamine, 0.1mM β mercaptoethanols, 1000U/mL leukocyte inhibitory factors, 1% nonessential Amino acid and mass fraction 1% it is dual anti-, the working concentration of penicillin therein is 100U/ml, and the working concentration of streptomysin is 0.1mg/ml；The constituent concentration respectively added is its final concentration in ES culture solutions, and condition of culture is saturated humidity, 37 DEG C, 5%CO₂(volume fraction), 21%O₂(volume fraction).Liquid is changed daily, and every 2 days are 0.25% with 500 μ L pancreatin mass fractions The digestion of pancreatin digestive juice after, passage is primary.

2) pig cell culture：

First, Primary Murine Embryos Fibroblast Feeder Layer cell is prepared, the Mouse feeder confluent monolayer cells are used for cultivating pig more Energy stem cell, the fibroblastic culture of pig does not need feeder cells.

The specific method is as follows：

A. the fibroblastic original cuiture of mouse fetal：

By 13.5 days of natural mating pregnant mouse (B6 mouse), the neck that breaks was put to death, 75% chronic ethanol treated mice fur and tester Tool sterilizes, and is open in abdomen and removes uterus, and the uterus of acquisition is placed in containing in dual anti-physiological saline, and physiology salt is used in big ware After water rinses repeatedly, while the big ware containing dual anti-physiological saline is replaced in time, until not containing blood in flushing liquor, tweezers are by uterus Wall, which peels off, takes out the completely tire mouse containing placenta and fetal membrane, and by it with containing dual anti-salt water washing, until colourless, tweezers are gone Except placenta and fetal membrane, in fetus stripping to the big ware for filling dual anti-brine, with tweezers stripping head, tail, four limbs, internal organ, back is stayed Ridge is placed in the small plate of import and shreds by the part in portion, salt water washing ridge 2-3 times, until tissue block is 1 cube Millimeter digests 5min with the 2ml clostridiopetidase A IV for containing DnaseI, and carrying out termination with the culture solution of the 20%FBS of 2 times of volumes of enzyme disappears Change.1000 μ l pipette tips of decaptitating are blown and beaten repeatedly, finally move into suspension in centrifuge tube, and 1200rpm/min centrifuges 3min, after centrifugation Cell and tissue block is resuspended with 20%FBS culture solutions, is inoculated into the big ware of import, changes liquid every other day, one to density two days later reaches After 90% or more, passed on.Condition of culture is saturated humidity, 37 DEG C, 5% (volume fraction) CO₂, 21% (volume fraction) O₂。

B. prepared by feeder cells：

Density is reached into 90% 3-4 for mouse fetal fibroblast, mitomycin C is added in 20%FBS culture solutions Make its final concentration of 10 μ g/ml, carry out processing 2-3 hours, removes the culture solution containing mitomycin C.DPBS washes cell three times, 0.25% 37 DEG C of pancreatin digests 1min, and when cell largely falls off from ware bottom, the culture solution that twice of addition enzyme amount is terminated, Piping and druming ware bottom makes 95% or more cell be split away off from culture dish, and cell suspension is collected into 15ml centrifuge tubes, 1200rpm/min centrifuges 3min, abandons supernatant, and the frozen stock solution that appropriate 4 DEG C of precoolings are added is frozen.Cryopreservation tube is put into freezing storing box In, freezing storing box is put into minus 80 refrigerator (if being frozen using program without freezing storing box in experiment at the end of experiment：4 DEG C of cryopreservation tube 20min, minus 20 DEG C of 2h), cryopreservation tube was transferred in liquid nitrogen in second day and is preserved.

Pig embryos Fibroblast cell-culture

The fibroblastic original cuiture of a Pig embryos

Uterus is surveyed along one and is cut off, the fetus of the 33.5d with amnion is taken out, is placed in containing in dual anti-physiological saline. It is cleaned with containing dual anti-physiological saline, moves into another big ware containing physiological saline, repeats this step to life It manages brine and no longer carries color.Fetus is suspended in above the big ware containing DPBS by tweezers, with tweezers isolating fetal and placenta, fetus It falls into DPBS, abandons embryo outside organization, with tweezers stripping head, tail, four limbs, internal organ, stay the part at back, shredded as possible, be in Paste.10min is digested with the 5-7ml clostridiopetidase A IV for containing DnaseI.Digestion is terminated with the 20%FBS culture solutions of 2 times of volumes of enzyme, 1000 μ l pipette tips of decaptitating are blown and beaten repeatedly, until without big tissue block, suspension moves into centrifuge tube, and 1200g centrifuges 3min, fresh The cell of suspension and tissue block resuspension are inoculated into import 90mm wares by 20%FBS culture solutions, and a fetus is inoculated into one big In ware.One to after density reaches 90% or more two days later, is passed on.Condition of culture is saturated humidity, 39 DEG C, 5% (volume point Number) CO₂, 21% (volume fraction) O₂。

B Pig embryos Fibroblast cell-cultures

Pig fibroblast adherent growth, will not form clone, and need to only digest can become unicellular.

The Pig embryos fibroblast is in 15%FBS cell culture fluids, and per 2-3 days, passage was primary, and density reaches 90% passage, culture solution is discarded, and DPBS is cleaned 1 time, the pancreatin digestive juice that pancreatin mass fraction is 0.25% is added, 37 DEG C disappear Change 1-2min, the 15%FBS cell culture fluids being added with pancreatin digestive juice equivalent terminate, and 1200g centrifuges 3min, according to 1：3 In ratio passage to tissue culture plate, condition of culture：39 DEG C, the CO of volume fraction 5%₂, volume fraction 21% O₂；Described 1:3 Ratio refer to cell that 1 culture hole digests out, 3 holes are passed in secondary culture and are cultivated.

2. unicellular fusion

Fused cell is obtained for convenience of observation, we have carried out fluorescence egg to R1 cell lines and Pig embryos fibroblast White marker.The specific method is as follows：

Mouse embryo stem cell carries out red fluorescence label:

By the e. coli jm109 containing FUW-Dsred plasmid vectors, utilizeHiPure Plasmid Maxiprep Kit carry out a large amount of extractions of plasmid, utilize Lipofectamine LTX and Plus transfection reagent boxes, transfection 293T cells replace 15ml mass fractions as 2% fetal calf serum FBS culture solutions after transfecting 12h, continue to cultivate after changing liquid, for 24 hours Virus is collected respectively with 48h.After collection virus concentrated with the viral concentration column of 100.000NMWL, be stored in -80 DEG C it is standby With.After each concentrating virus, viral efficiency of infection is different, needs relatively to filter out optimal use dosage with control group.

Secondary culture will be carried out in mice embryonic stem cell system R1 cell inoculations to 24 orifice plates, the FUW-Dsred that will be frozen Virus is added separately in 24 orifice plates, and after 48 hrs, clone R1-FD of the picking with red fluorescence is carried out under fluorescence microscope Passage, finally obtains R1-FD cell lines (as shown in A, B in Fig. 2).

Pig embryos fibroblast (PEF) carries out green fluorescent label:

By the e. coli jm109 containing FUW-Egfp plasmid vectors, utilizeHiPure Plasmid Maxiprep Kit carry out a large amount of extractions of plasmid, utilize Lipofectamine LTX and Plus transfection reagent boxes, transfection 293T cells replace 15ml 2%FBS culture solutions after transfecting 12h, continue to cultivate after changing liquid, disease is collected respectively with 48h for 24 hours Poison.Virus after collection is concentrated with the viral concentration column of 100.000NMWL, is stored in -80 DEG C of spare, each concentrating virus Afterwards, viral efficiency of infection is different, needs relatively to filter out optimal use dosage with control group.

Pig embryos fibroblast (PEF) is inoculated into 24 orifice plates and carries out secondary culture, by the FUW-Egfp frozen diseases Poison is added separately in 24 orifice plates, and after 48 hrs, clone PEF-FE of the picking with green fluorescence is carried out under fluorescence microscope Passage, finally obtains PEF-FE cell lines (as shown in C, D in Fig. 2).

For unicellular fusion flow as shown in B in Fig. 3, it is described that the specific method is as follows：

Glass tube (firing is pointed) picking R1-FD clones 3 and is transferred to the pancreas for being 0.25% containing mass fraction with mouth suction pipe In the pancreatin digestive juice of 20 μ L of enzyme (being preheated through 37 DEG C), 37 DEG C of 1min, then plus the ES culture solutions of 20 μ L terminate digestion, pig Fibroblast adherent growth will not form clone, it is possible to directly be digested in 24 orifice plates, add 50 μ L pancreatin quality The pancreatin digestive juice that score is 0.25% (preheats) digestion 1min through 37 DEG C, you can becomes unicellular, then adds 20 μ L15% tires The cell culture fluid of cow's serum terminates digestion, and mouse embryo stem cell and Pig embryos fibroblast are digested slender respectively Born of the same parents, using the ES culture solutions of serum-free, the basal medium of the ES culture solutions of the serum-free is DMEM, the ES of the serum-free It is also white for 15% fetal calf serum, 2mM glutamine, 0.1mM β mercaptoethanols, 1000U/mL containing mass fraction in culture solution Cytostatic factor, 1% nonessential amino acid of mass fraction, mass fraction 1% are dual anti-, and the working concentration of wherein penicillin is The working concentration of 100U/ml, streptomysin are 0.1mg/ml；3 μM of CHIR99021 and 1 μM of PD0325901, it is described respectively to add Constituent concentration is its final concentration in the ES culture solutions of serum-free.Cell agglutinin, the cell agglutinin final concentration is added 100 μ g/ml obtain the ES culture solutions of serum-free and the mixed liquor of cell agglutinin, and in 35mm culture dishes, 2 μ l droplets are made It 30, is covered with paraffin oil, then R1-FD individual cells is added in 1 droplet, then PEF-FE individual cells are bonded R1- FD cells, it is one-to-one unicellular right to be built into, and after 20min, the cell that 2 are attached onto is sucked into glass tube, then It is that 50% polyethylene glycol PEG, 1500 aqueous solutions will be in glass tube after standing 1min to suck 1 μ l polyethylene glycol volume fractions again Unicellular pair and polyethylene glycol PEG1500 aqueous solutions add in 96 orifice plates, according to mouse embryo stem cell condition of culture into Row fusion culture, that is, saturated humidity, 37 DEG C, 5% (volume fraction) CO₂, 21% (volume fraction) O₂.Remaining each droplet, R1-FD Individual cells, PEF-FE individual cells repeat above-mentioned fusion treatment process.

The fused cell R1-PEF obtained through culture, as shown in D in Fig. 3, cell had both expressed red fluorescence or had expressed green Fluorescence, the visible fused cell form in the two row leftmost sides is not the crowned of mES, and tends to be flat；Intermediate and right diagram point It Wei not detect fused cell Green fluorescence and red fluorescence under fluorescence microscope, show mouse stem cells with Pig embryos at fibre Cell is unicellular merges successfully for dimension.

Fused cell culture can carry out secondary culture after 7 days, the secondary culture according to mouse embryo stem cell culture Condition carries out, and uses TrypLE^TM37 DEG C of digestion 3min of Express enzymes, specific dosage are trained with reference to specification with the ES of enzyme equivalent Nutrient solution terminates digestion, and culture solution is ES culture solutions used in the fused cell culture.

The 2. unicellular fusion method of pig mouse cell of embodiment, repeat embodiment 1, the present embodiment it is different from embodiment 1 In pig mouse cell is selected as in the present embodiment：Mouse embryo stem cell is R1 systems cell, and pig cell is pig multipotent stem cells The cultural method of KO, the pig multipotential cell KO is：By pig multipotent stem cells KO, carried out in KO-DMEM culture solutions Culture discards culture solution in passage, and DPBS is cleaned 1 time, and final concentration of 1mg/ml clostridiopetidase As IV is added in 39 DEG C of incubators 4min is digested, clostridiopetidase A is discarded, DPBS is washed 1 time, removes DPBS solution, uses ES culture solutions that precipitation is resuspended again, and clone is blown and beaten After uniform small agglomerate, 1:2 are passaged on the culture plate of the feeder cells of inoculation mitomycin C processing, and described 1:2 Refer to the cell that 1 culture hole digests out, 2 holes are passed in secondary culture and are cultivated.In KO-DMEM culture solution cultures The final concentration of 10 μm of ol/L of inhibitor Y27632, the inhibitor Y27632 in KO-DMEM culture solutions are added in liquid.Culture Condition：Saturated humidity, 39 DEG C, 5% (volume fraction) CO₂, 5% (volume fraction) O_2,。

Method with reference to described in embodiment 1 is that R1 systems cell carries out red fluorescence label to mouse embryo stem cell, is obtained R1-FD cell lines are obtained, pig multipotent stem cells KO carries out green fluorescent label and obtains KO-FE cell lines.

Wherein pig multipotent stem cells can form clone through culture, with glass tube respectively (firing is pointed) picking after culture R1-FD clones 3 and KO-FE and clones 3, and the pancreatin (being preheated through 37 DEG C) for being 0.25% containing mass fraction is transferred to mouth suction pipe 20 μ L pancreatin digestive juice in, 37 DEG C of 1min, R1-FD clone plus 20 μ L ES culture solutions terminate digestion, KO-FE clone plus 20ulKO-DMEM culture solutions terminate digestion, mouse embryo stem cell and pig multipotent stem cells be digested respectively it is unicellular, Follow-up unicellular fusion method is with reference to described in embodiment 1.

The fused cell R1-KO obtained through culture in the present embodiment, cell had both expressed red fluorescence or had expressed green fluorescence, Show mouse stem cells and pig multipotent stem cells are unicellular merges successfully.Fused cell form is not the crowned of mES, and becomes In flat.

The 3. unicellular fusion method of pig mouse cell of embodiment, repeat embodiment 1, the present embodiment it is different from embodiment 1 In pig mouse cell is selected as in the present embodiment：Mouse embryo stem cell is F1 systems cell, and pig cell is Pig embryos into fiber finer Born of the same parents PEF, cell culture condition is with fusion method with reference to embodiment 1.

The fused cell F1-PEF obtained through culture, cell had both expressed red fluorescence or had expressed green fluorescence, showed mouse Stem cell with Pig embryos fibroblast is unicellular merges successfully.Fused cell form is not the crowned of mES, and tends to be flat Shape.

The 4. unicellular fusion method of pig mouse cell of embodiment, repeat embodiment 2, the present embodiment it is different from embodiment 2 In pig mouse cell is selected as in the present embodiment：Mouse embryo stem cell is F1 systems cell, and pig cell is pig multipotential cell KO,

Unicellular fusion method is with reference to embodiment 2.

The fused cell F1-KO obtained through culture, cell had both expressed red fluorescence or had expressed green fluorescence, showed that mouse is dry Cell with pig multipotent stem cells are unicellular merges successfully.Fused cell form is not the crowned of mES, and tends to be flat.

1. conventional cell fusion method of comparative example.

As a contrast, fusion experiment is carried out to non-blooming R1 cells and PEF cells using traditional cell fusion method, In technology path such as Fig. 3 shown in A.WithDyeCycle^TMDyestuff dyes the cell of fusion, is carried out after 6 hours Streaming is screened.The fused cell of acquisition obtains cell clone through culture, as shown in C in Fig. 3.The specific method is as follows：

The specific method is as follows：The pancreatin digestive juice for being 0.25% by 37 DEG C of preheating pancreatin mass fractions, 1min digest mouse Embryonic stem cell adds the ES culture solutions of same pancreatin digestive juice equivalent to terminate, and 1200g centrifugations 3min abandons liquid, then with 500 μ LES trainings Nutrient solution is resuspended, and cell inoculation adds 2mLES culture solutions to being covered in the 6 orifice plates of gelatin in advance, and culture cell is thin to feeder layer Born of the same parents are fully erased, collect suspension, and 1200g centrifuges 3min, mixing 1 × 10⁸A R1-FD (has infected FUW-Dsred viruses, expression Red fluorescence) cell and 1 × 10⁸A PEF-FE (having infected FUW-Egfp viruses, express green fluorescence) cell, 1200g centrifugations 3min, DPBS are washed once, and 1200g centrifuges 3min, abandon liquid and 1 × SDS is added, 37 DEG C of incubation 3min, 1200g centrifugation 3min abandon liquid Add 1500, the 37 DEG C of incubation 1min of 1ml 50%PEG incubated in advance, 10ml DMEM is added dropwise, 1200g centrifuges 3min, and cell connects Kind arrives the 6 orifice plates culture containing matrigel 6 hours.Suspension is collected, 1200g centrifuges 3min, and phosphate buffer DPBS is washed three times, carefully Born of the same parents count 1 × 10 per 1ml⁶A cell adds 2 μ l'sDyeCycle^TMGreen stain, 37 DEG C of incubation 30min, Utilize BD FACSMelody^TMStreaming screening is carried out, then by cell culture in 24 orifice plates containing feeder cells, culture After obtain fused cell, passed on after 7 days, use TrypLE^TM37 DEG C of digestion 3min of Express enzymes, with the ES culture solutions with enzyme equivalent It terminates, the culture solution of fused cell is ES culture solutions.

The streaming screening sequence is as follows：

(1) prepare before loading：The ethyl alcohol that volume fraction is 75%, sterile water, DPBS；(2) 3L bodies are added in sheath fluid bucket Fraction is 75% ethyl alcohol, after covering lid, rocks sheath fluid bucket；(3) machine is connected；(4) software is opened, new experiment is established, Loading analyzes cell and screening door is arranged；(5) 2 BD collecting pipes are installed and 500 μ l DPBS is wherein added；(6) cell is screened； (7) sheath fluid bucket is disconnected, 3ml sterile waters are added, are cleaned；(8) cleaning solution is finally used, is cleaned；(10) it shuts down.

The acquisition of xenogenesis fused cell and efficiency compare

2 × 10 are needed in traditional fusion experiment⁶A cell, significant difference obtains clone 39 ± 6.3, and (cell is given birth in agglomerate It is long and be projecting shape, both expressed red fluorescence or expressed green fluorescence), unicellular fusion only needs 80 cells of operation, obtains Clone 40 ± 4.9.It is for statistical analysis to traditional fusion method and unicellular fusion method cloning efficiency of the present invention, 0.01 differences of p value < are extremely notable.Detailed results such as table 2.For the feasibility of the method for the unicellular fusion of verification, the present invention is using separately One mice embryonic stem cell system F1 can equally obtain above-mentioned as a result, two kinds of method comparison results are as shown in table 3.

2 xenogenesis R1 and PEF fused data statistical form of table

Every group is repeated 3 times, and b subscripts represent difference extremely significantly (P<0.01), a subscripts represent difference not significantly (P > 0.05)

3 xenogenesis F1 and PEF fused data statistical form of table

Every group is repeated 3 times, and b subscripts represent difference extremely significantly (P<0.01), a subscripts represent difference not significantly (P > 0.05)

Xenogenesis fused cell biological characteristics：

Fused cell Morphology observation：

In the case where just setting microscope detect cellular morphology after the fused cell secondary culture that embodiment 1-4 is obtained as shown in figure 4, It can be seen that fused cell form is not the crowned of mES, and tend to be flat.

To prove the species specificity of xenogenesis fused cell, screens mouse specific gene Wdr59 and Akt1 and pig is special Gene Stat3, detailed results are shown in Fig. 5 shown in A that 4 kinds of xenogenesis fused cells had both expressed the kind specific gene of pig, also expressed small The kind specific gene of mouse.4 kinds of xenogenesis fused cell AP are positive, and as shown in B in Fig. 5, Real-Time is analysis shows fused cell Middle versatility gene Sox2 is expressed relative to Pig embryos fibroblast height, and the expression quantity of Nanog is relatively low, and the expression of Oct4 does not have It is detected, as shown in C in Fig. 5.

Xenogenesis fused cell differentiation capability detects:

To verify the versatility of xenogenesis fused cell, i.e., embryoid body is formed to the differentiation capability of xenogenesis fused cell in vitro It is detected.Postdigestive xenogenesis fused cell is seeded in the culture dish of the coated 35mm of no matrix, can be formed after cultivating 7d Embryoid body, as shown in A in Fig. 6, PCR detection embryoid bodies can be sent to triploblastica differentiation, PCR detections primer sequence used certainly Row are as shown in table 1, and in Fig. 6 shown in B, Gapdh is that reference gene, MyoD and Tagln represent mesoderm, and Sox7 represents entoderm, Ncam represents ectoderm.Detect the triploblastica Marker (pTagln, pSox7, pNcam) of pig and the triploblastica of mouse simultaneously Marker(mMyoD,mSox7,mNcam).Xenogenesis fused cell has the ability broken up to triploblastica.

SEQUENCE LISTING

<110>Northeast Agricultural University

<120>The one unicellular fusion method of boar mouse cell

<130>

<160> 40

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> pOct4-F

<400> 1

gaaggtgttc agccaaacga c 21

<210> 2

<211> 18

<212> DNA

<213> pOct4-R

<400> 2

cgatacttgt ccgctttc 18

<210> 3

<211> 21

<212> DNA

<213> pSox2-F

<400> 3

aaccagaaga acagcccaga c 21

<210> 4

<211> 21

<212> DNA

<213> pSox2-R

<400> 4

tccgacaaaa gtttccactc g 21

<210> 5

<211> 21

<212> DNA

<213> pNanog-F

<400> 5

cctccatgga tctgcttatt c 21

<210> 6

<211> 20

<212> DNA

<213> pNanog-R

<400> 6

catctgctgg aggctgaggt 20

<210> 7

<211> 24

<212> DNA

<213> pGapdh-F

<400> 7

gcaaagtgga cattgtcgcc atca 24

<210> 8

<211> 24

<212> DNA

<213> pGapdh-R

<400> 8

tcctggaaga tggtgatggc cttt 24

<210> 9

<211> 23

<212> DNA

<213> pNcam-F

<400> 9

tgaacctaat caagcaggac gac 23

<210> 10

<211> 24

<212> DNA

<213> pNcam-R

<400> 10

agagaaaagc aatgagacaa acgt 24

<210> 11

<211> 24

<212> DNA

<213> pTagln-F

<400> 11

ccataagagg gaattcacag agag 24

<210> 12

<211> 23

<212> DNA

<213> pTagln-R

<400> 12

ctgggatgag gagacagtag agc 23

<210> 13

<211> 20

<212> DNA

<213> pSox17-F

<400> 13

gacatgaaga tgaagggcga 20

<210> 14

<211> 22

<212> DNA

<213> pSox17-R

<400> 14

gtacttgtag ttggggtggt cc 22

<210> 15

<211> 23

<212> DNA

<213> pStat3-F

<400> 15

aactttatca gtaaggagag gga 23

<210> 16

<211> 21

<212> DNA

<213> pStat3-R

<400> 16

gacacaagga tgttggtagc a 21

<210> 17

<211> 20

<212> DNA

<213> mGapdh-F

<400> 17

cccactaaca tcaaatgggg 20

<210> 18

<211> 20

<212> DNA

<213> mGapdh-R

<400> 18

ccttccacaa tgccaaagtt 20

<210> 19

<211> 23

<212> DNA

<213> mOct4-F

<400> 19

tctttccacc aggcccccgg ctc 23

<210> 20

<211> 23

<212> DNA

<213> mOct4-R

<400> 20

tgcgggcgga catggggaga tcc 23

<210> 21

<211> 23

<212> DNA

<213> mSox2-F

<400> 21

tagagctaga ctccgggcga tga 23

<210> 22

<211> 23

<212> DNA

<213> mSox2-R

<400> 22

ttgccttaaa caagaccacg aaa 23

<210> 23

<211> 20

<212> DNA

<213> mNanog-F

<400> 23

cacccaccca tgctagtctt 20

<210> 24

<211> 20

<212> DNA

<213> mNanog-R

<400> 24

accctcaaac tcctggtcct 20

<210> 25

<211> 24

<212> DNA

<213> mAfp-F

<400> 25

catcaccttt acccagtttg ttcc 24

<210> 26

<211> 24

<212> DNA

<213> mAfp-R

<400> 26

gacactgatg tctttccact ccac 24

<210> 27

<211> 24

<212> DNA

<213> mSm22-a-F

<400> 27

gctgaagaat ggtgtgattc tgag 24

<210> 28

<211> 24

<212> DNA

<213> mSm22-a-R

<400> 28

ccttcataga ggtcaacagt ctgg 24

<210> 29

<211> 24

<212> DNA

<213> mNcam-F

<400> 29

tgctcaa`gtc cctagactgg aacg 24

<210> 30

<211> 26

<212> DNA

<213> mNcam-R

<400> 30

cttctcgggc tctgtcagtg gtgtgg 26

<210> 31

<211> 19

<212> DNA

<213> mSox17-F

<400> 31

ggcacggaac ccaaccagc 19

<210> 32

<211> 25

<212> DNA

<213> mSox17-R

<400> 32

cagtcgtgtc cctggtaggg aagac 25

<210> 33

<211> 23

<212> DNA

<213> mMyoD-F

<400> 33

gctcaggaag attgctgtgt cca 23

<210> 34

<211> 24

<212> DNA

<213> mMyoD-R

<400> 34

CCGCAACACTCCATGCATATCTCC 24

<210> 35

<211> 24

<212> DNA

<213> mRex1-F

<400> 35

acgagtggca gtttcttctt ggga 24

<210> 36

<211> 24

<212> DNA

<213> mRex1-R

<400> 36

tatgactcac ttccaggggg cact 24

<210> 37

<211> 18

<212> DNA

<213> mWdr59-F

<400> 37

ctgggaacct gcgtctgt 18

<210> 38

<211> 19

<212> DNA

<213> mWdr59-R

<400> 38

cggagttggc aatagtgag 19

<210> 39

<211> 20

<212> DNA

<213> mAkt1-F

<400> 39

gcacaagcga ggggagtaca 20

<210> 40

<211> 19

<212> DNA

<213> mAkt1-R

<400> 40

caggcagcgg atgatgaag 19

Claims (10)

1. a unicellular fusion method of boar mouse cell, which is characterized in that be to pass through mouse embryo stem cell respectively with pig cell Pancreatin be digested to it is unicellular after, it is one-to-one unicellular right to be built into using cell agglutinin, described unicellular in poly- second two Fused culture obtains fused cell under the action of alcohol, and the pig cell is pig multipotent stem cells or Pig embryos into fiber finer Born of the same parents.

2. the unicellular fusion method of boar mouse cell according to claim 1, which is characterized in that the fusion method tool Body includes the following steps：

1) cell culture：Mouse embryo stem cell is cultivated in ES culture solutions respectively, it is thin to obtain mouse embryo stem cell Born of the same parents clone；By Pig embryos fibroblast in the cell culture fluid containing 15% mass content fetal calf serum, obtained through culture Pig embryos fibroblast；Or pig multipotent stem cells are seeded to the mouse fetal of mitomycin C processing into fiber finer It on the feeder cells of born of the same parents, is cultivated in pig multipotent stem cells culture solution, obtains pig multipotent stem cells cell clone；

2) unicellular fusion：Mouse embryo stem cell cell clone after culture is obtained after pancreatin digests respectively with pig cell Unicellular, the ES culture solutions of serum-free and cell agglutinin are prepared into droplet, and cell agglutinin is final concentration of in the droplet 100μg/mL；By the unicellular and pig cell of mouse embryo stem cell it is unicellular be bonded in each droplet be built into it is one-to-one It is unicellular right, then fused culture obtains fused cell under the action of polyethylene glycol.

3. the unicellular fusion method of boar mouse cell according to claim 2, which is characterized in that the step 1) pig is more Energy property stem cell medium adds the ROCK1 inhibitor of final concentration of 10 μm of ol/L.

4. the unicellular fusion method of boar mouse cell according to claim 2, which is characterized in that step 1) the ES trainings The basal medium of nutrient solution is DMEM, fetal calf serum, 2mM glutamy in the ES culture solutions also containing mass fraction 15% Amine, 0.1mM beta -mercaptoethanols, 1000U/mL leukocyte inhibitory factors, 1% nonessential amino acid of mass fraction and mass fraction 1% is dual anti-, each adding ingredient it is a concentration of its ES cultivate liquid culture medium in final concentration, it is described it is dual anti-refer to containing simultaneously There is the reagent of two kinds of antibiotic of penicillin and streptomysin；The Mouse Embryonic Stem Cell Culture condition is：Saturated humidity, 37 DEG C, The CO of volume fraction 5%₂, volume fraction 21% O₂。

5. the unicellular fusion method of boar mouse cell according to claim 2, which is characterized in that step 1) the pig embryo The fibroblastic culture solution of tire is the cell culture fluid of 15% fetal calf serum, is that the DMEM for being 82% by mass fraction is cultivated The L- paddy ammonia that nonessential amino acid that fetal calf serum that base, mass fraction are 15%, mass fraction are 1%, mass fraction are 1% The dual anti-composition of amide and mass fraction 1%, its a concentration of final concentration in cell culture fluid of each adding ingredient, institute It refers to reagent simultaneously containing two kinds of antibiotic of penicillin and streptomysin, the Pig embryos Fibroblast cell-culture item to state dual anti- Part：39 DEG C, the CO of volume fraction 5%₂, volume fraction 21% O₂；

The basal medium of the pig multipotent stem cells culture solution is KnockOut DMEM culture solutions, also contains mass fraction 0.5%N2 cell culture additive, the B27 additives of mass fraction 1%, 0.25mg/ml bovine serum albumin(BSA)s, mass fraction 1%L- glutamine, 1% nonessential amino acid of mass fraction, 0.2mM beta -mercaptoethanols, 40 μ g/ml vitamin Cs, 5ng/ml people Source leukocyte inhibitory factor, 16ng/ml basic fibroblast growth factors and mass fraction 1% are dual anti-, each ingredient Its a concentration of final concentration in KnockOut DMEM culture solutions, it is described it is dual anti-refer to simultaneously contain penicillin and streptomysin two The reagent of kind antibiotic, the pig multipotent stem cells condition of culture are：The CO of 39 DEG C of temperature, volume fraction 5%₂, volume point The O of number 5%₂。

6. the unicellular fusion method of boar mouse cell according to claim 2, which is characterized in that step 2) the no blood The basal medium of clear ES culture solutions is DMEM, also contains 2mM glutamine, 0.1mM β in the ES culture solutions of the serum-free Mercaptoethanol, 1000U/mL leukocyte inhibitory factors, 1% nonessential amino acid of mass fraction, mass fraction 1% be dual anti-, 3 μM CHIR99021 and 1 μM of PD0325901, the constituent concentration respectively added are it in the ES of serum-free cultivates liquid culture medium Final concentration, it is described it is dual anti-refer to reagent simultaneously containing two kinds of antibiotic of penicillin and streptomysin.

7. the unicellular fusion method of boar mouse cell according to claim 2, which is characterized in that the step 2) pancreatin Digestion refers to each mouse embryo stem cell cell clone, and to be utilized respectively 20 μ L pancreatin mass fractions with pig cell be 0.25% Pancreatin digestive juice digests 1min at 37 DEG C, used training when being then respectively adding mouse embryo stem cell with pig cell culture Nutrient solution stops digestion.

8. the unicellular fusion method of boar mouse cell according to claim 4, which is characterized in that the step 2) fusion Before culture, the polyethylene glycol 1500 aqueous solution that 1 μ L polyethylene glycol volume fractions are 50% is added to each pair of unicellular centering, it is quiet It sets to be transferred to after 1min in fusion culture solution and cultivate, the fusion culture solution is ES culture solutions.

9. the unicellular fusion method of boar mouse cell according to claim 4, which is characterized in that the step 2) fusion Culture refers to cultivating the cell after fusion in ES culture solutions according to the condition of culture of mouse embryo stem cell, fusion training It is that the cell mass after the pancreatin digestive juice for being 0.25% with pancreatin mass fraction after 7 days, 7 days cultivates fusion disappears to support the time Change, 37 DEG C of digestion 3min are used in combination after being terminated with the ES culture solutions of pancreatin digestive juice equivalent and enter secondary culture.

10. the unicellular fusion method of boar mouse cell according to claim 9, which is characterized in that the step 2) pancreas Enzyme is TrypLE Express enzymes.