CN101956003A - Method for detecting exogenous gene integration sites in pig genome - Google Patents

Abstract

The invention discloses a method for detecting exogenous gene integration sites in pig genome, and relates to a method for detecting exogenous gene integration sites. The method solves the problems of complicated operation and large errors in the conventional method for detecting the exogenous gene integration sites. The method comprises the following steps of: 1, performing PCR amplification on sites where TgInS1, TgInS2 and TgInS3 exogenous genes are inserted in the genome; and 2, performing electrophoresis to detect the exogenous gene integration sites in the pig genome. The method is simple to operate; and compared with the conventional method for detecting the exogenous gene integration sites, the method has the advantages of small human errors and accurate detection results.

Description

The detection method in exogenous origin gene integrator site in the pig genome

Technical field

The present invention relates to the detection method in exogenous origin gene integrator site.

Background technology

People import needed external source goal gene in the host cell by carriers such as plasmid or retrovirus; make stable the combining of foreign gene and host genome; it can duplicating and increase with host genome; can obtain in vivo again expressing; and can stably entail the offspring, this animal of carrying foreign gene is called as transgenic animal.The all cells of transgenic animal all should be integrated with foreign gene, and foreign gene can be entailed filial generation, if foreign gene only is integrated into the part cell of animal or the genome of histoorgan, then are called mosaic.The goal gene that is integrated into host genome is called foreign gene or commentaries on classics (planting) gene (An Xiaorong, 2001).Through nearly 40 years development, people have successfully cultivated transgenic animal such as the transgene rabbit that carries different foreign genes, sheep, pig, ox, fish, chicken, mouse, rat in succession.At present, transgenic technology has become with fastest developing speed, a most popular subject of current life science, its at functional genome research, directive breeding, genetically modified organism reactor, set up aspects such as human diseases model and all brought into play huge effect.

After exogenous origin gene integrator was gone into the acceptor gene group, integration generally had stability, and major part entails the offspring in Mendelian's mode, but foreign gene is not incorporated on the karyomit(e) sometimes, but had instability with the episome form; Think that at present the power of genetic expression and the copy number of integration have nothing to do, and relevant with the integration position; Integrate that the flanking sequence also may cause the foreign gene site is reset, lacked, repetition or dystopy phenomenon; The integration of foreign gene may cause host cell gene sudden change new phenotype to occur, and some must the gene transcription process also may to interrupt host cell, or activates deleterious gene, causes embryo's deformity or dead.It is generally acknowledged that the integration site of foreign gene has fundamental influence to its expression level, a same sometimes foreign gene can be at certain integration site normal expression, and does not express or low expression level (Wang Jiying, 2002) in other sites.Therefore, the detection in exogenous origin gene integrator site is to follow-up study and inquires into foreign gene phenotype and function and select suitable individuality to expand the group crucial.

Experimental results show that, exogenous origin gene integrator occurs in the S phase of dna replication dna mostly to host genome, may insert optional position in the acceptor gene group randomly with the form of unit point or multidigit point, thereby there are " effectively integrating ", " reticent integrate " and " toxicity integration " three kinds of integrated states, the also non-homogeneous of its expression level (Wu Bo, 2003).At present, the exogenous origin gene integrator site has position effect by generally acknowledged.The result of study that personnel selection betaglobulin gene carries out transgenic mice shows, the chromosomal foci difference that foreign gene is integrated in the different transgenic mices, in these different transgenic mices, the expression activity that the foreign gene of being integrated has is very low, the then basic nothing that has is expressed, wherein have only when the betaglobulin gene integration is on No. 3 karyomit(e) of mouse, just can in the skeletal muscle of transgenic mice, express.The integration of foreign gene also has similar phenomenon with expression in other transgenic animal such as genetically engineered fish, transgenic sheep and the transgenic cattle.This position effect not only influences the expression of exogenous gene level, and influence the development models of foreign gene, so that has same foreign gene but in the transgenic mice of different integration sites, transcribing in different times and different tissues of foreign gene is activated.There are some researches show that also if the exogenous origin gene integrator site is positioned at heterochromatic zone (as the LINE sequence), its expression can be suppressed or be reticent fully; If but the exogenous origin gene integrator site is arranged in the chromatin district (as the Rosa26 district of mouse) of transcriptionally active, it also can extensive and high-caliber expression.

At present, the pig gene order-checking is finished, and has 19 pairs of karyomit(e)s in the pig genome, about 2.7 hundred million bases, and the inside comprises about more than 30,000 genes, and how finding the site that can be fit to the foreign gene stable integration in genome is the emphasis of studying at present.

The transgene clone technology combines nuclear transfer technology exactly and produces transgenic animal with transgenic technology, at first foreign gene is imported in the donorcells, screening is selected positive cells and is done nuclear transplantation as nuclear donor then, so obtains animal and is transgenic and cloned animal.In February, 1997, Wilmut etc. utilize nuclear transfer technology to obtain the first in the world adult body cell clone sheep---" Dolly ", utilize the same year the transgene clone technology to obtain the world the first body-cell neucleus transplanting transgene clone sheep---" Polly " again.At present, transgenic cattle (Cibelli, 1998 of several genes have been obtained to express abroad by the somatic cell nuclear transfer technique route; WallRJ, 2005), sheep (SchniekeAE, 1997; McCreathKJ, 2000) and pig (Lai, 2002; DaiY, 2002; PhelpsCJ, 2003; Hao, Y.H, 2006) etc.Domesticly also transgenic goat (Wang Hai etc., 2004) and transgenic cattle (Gong Guochun etc., 2003) have been obtained by this technological line.In October, 2006, Liu Zhonghua etc. obtain domestic the first adult somatic cell clone pig, and December in the same year, Liu Zhonghua etc. obtained the domestic first routine gfp transgene clone pig again, and this is marking China's transgene clone technology and is also reaching international standards.

After exogenous origin gene integrator is gone into genome, need identify the integration site of foreign gene, the basic skills that detects foreign gene is that the method by molecular biology and cytobiology detects exogenous gene sequence, analyzes the integration situation (Tang Jiaming, 2002) of foreign gene.This method complicated operation, personal errors is big, and detected result is not accurate enough.

Summary of the invention

The objective of the invention is in order to solve the detection method complicated operation in existing exogenous origin gene integrator site, the problem that error is bigger, and the detection method in exogenous origin gene integrator site in the pig genome is provided.

The detection method in exogenous origin gene integrator site is carried out according to following steps in the pig genome of the present invention: one, extract the transgenic pig progeny genome DNA, respectively at TgInS1, pcr amplification is carried out in the site that TgInS2 and TgInS3 foreign gene insert in the genome, wherein, primer at TgInS1 is P-TgInS1U upstream primer: 5'-CTATTGCCTTGGCAGACTGACCTCT-3', P-TgInS1D downstream primer: 5'-ACAGATCAATGGAATAGAACAGAGGG-3', the pcr amplification condition is: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 1min, totally 30 circulations, 72 ℃ are extended 5min, 4 ℃ of insulation 1h; PCR reaction system 25 μ l are made up of the pure water of P-TgInS1D downstream primer, 1 * PCR damping fluid and the surplus of the P-TgInS1U upstream primer of 0.2 mM dNTP, 0.5 U Taq DNA polysaccharase, 100 ng pig genomic dnas, 1.25 μ M, 1.25 μ M; Primer at TgInS2 is P-TgInS2U upstream primer: 5'-CTGTTCTGCCTAAACCGCATCACCATG-3', P-TgInS2D downstream primer: 5'-GCCTGGAGACGCCATCCACGCTGTTT-3', the pcr amplification condition is: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ extend 1min, totally 30 circulations, 72 ℃ and extend 5min, 4 ℃ and be incubated 1h; PCR reaction system 25 μ l are made up of the pure water of P-TgInS2D downstream primer, 1 * PCR damping fluid and the surplus of the P-TgInS2U upstream primer of 0.2 mM dNTP, 0.5 U Taq DNA polysaccharase, 100 ng pig genomic dnas, 1.25 μ M, 1.25 μ M; Primer at TgInS3 is P-TgInS3U upstream primer: 5'-CCCCGTGAGTCAAACCGCTATCCA-3', P-TgInS3D downstream primer: 5'-TGCATTCTGTCGATACGCCACGAGGAC-3', the pcr amplification condition is: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ extend 1min, totally 30 circulations, 72 ℃ and extend 5min, 4 ℃ and be incubated 1h; PCR reaction system 25 μ l are made up of the pure water of P-TgInS3D downstream primer, 1 * PCR damping fluid and the surplus of the P-TgInS2U upstream primer of 0.2 mM dNTP, 0.5 U Taq DNA polysaccharase, 100 ng pig genomic dnas, 1.25 μ M, 1.25 μ M; Two, the PCR reaction result of step 1 carries out electrophoresis detection, has promptly realized the detection in exogenous origin gene integrator site in the pig genome.

Among the present invention in the transgenic pig filial generation foreign gene be green fluorescence protein gene, it is at amplification in vitro foreign gene specific DNA fragment that the inventive method adopts the PCR method, thereby foreign gene is detected, its principle is to pass through sex change, annealing and extend three processes, can be with ten thousand times of template amplifications to hundred between two primers in short-term.This process is to finish by the adjustment of temperature and the acting in conjunction of polysaccharase in the PCR reaction.Because it is the required sample of PCR is few, highly sensitive and easy and simple to handle thereby be the transgenic animal exogenous origin gene integrator of the longest usefulness, the detection method of expression.Method of the present invention is simple to operate, and compares with the detection method in existing exogenous origin gene integrator site, and personal errors is little, and detected result is accurate.

Description of drawings

Fig. 1 is the electrophorogram of K25-2 and filial generation integration site downstream flank sequence amplification result thereof among the embodiment one Junction PCR gel electrophoresis result, and 1 ~ 7 swimming lane is filial generation integration site downstream flank sequence amplification result, and M is DL2000; Fig. 2 is the electrophorogram of K25-2 and filial generation integration site upstream flank sequence amplification result thereof among the embodiment one Junction PCR gel electrophoresis result, and M is that DL20001 ~ 7 swimming lanes are filial generation integration site downstream flank sequence amplification result; Fig. 3 is the electrophorogram of 1st PCR reaction product in the embodiment one, and the 1-6 swimming lane is the amplification of 6 kinds of degenerated primers (AD1-AD6), and M is DL15000; Fig. 4 is the electrophorogram of 2nd PCR reaction product in the embodiment one, and the 1-6 swimming lane is the amplification of 6 kinds of degenerated primers (AD1-AD6), and M is DL15000; Fig. 5 is the electrophorogram of 3rdPCR reaction product in the embodiment one, and the 1-6 swimming lane is the amplification of 6 kinds of degenerated primers (AD1-AD6), and M is DL15000.

Embodiment

Technical solution of the present invention is not limited to following cited embodiment, also comprises the arbitrary combination between each embodiment.

Embodiment one: the detection method in exogenous origin gene integrator site is carried out according to following steps in the present embodiment pig genome: one, extract the transgenic pig progeny genome DNA, respectively at TgInS1, pcr amplification is carried out in the site that TgInS2 and TgInS3 foreign gene insert in the genome, wherein, primer at TgInS1 is P-TgInS1U upstream primer: 5'-CTATTGCCTTGGCAGACTGACCTCT-3', P-TgInS1D downstream primer: 5'-ACAGATCAATGGAATAGAACAGAGGG-3', the pcr amplification condition is: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 1min, totally 30 circulations, 72 ℃ are extended 5min, 4 ℃ of insulation 1h; PCR reaction system 25 μ l are made up of the pure water of P-TgInS1D downstream primer, 1 * PCR damping fluid and the surplus of the P-TgInS1U upstream primer of 0.2 mM dNTP, 0.5 U Taq DNA polysaccharase, 100 ng pig genomic dnas, 1.25 μ M, 1.25 μ M; Primer at TgInS2 is P-TgInS2U upstream primer: 5'-CTGTTCTGCCTAAACCGCATCACCATG-3', P-TgInS2D downstream primer: 5'-GCCTGGAGACGCCATCCACGCTGTTT-3', the pcr amplification condition is: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ extend 1min, totally 30 circulations, 72 ℃ and extend 5min, 4 ℃ and be incubated 1h; PCR reaction system 25 μ l are made up of the pure water of P-TgInS2D downstream primer, 1 * PCR damping fluid and the surplus of the P-TgInS2U upstream primer of 0.2 mM dNTP, 0.5 U Taq DNA polysaccharase, 100 ng pig genomic dnas, 1.25 μ M, 1.25 μ M; Primer at TgInS3 is P-TgInS3U upstream primer: 5'-CCCCGTGAGTCAAACCGCTATCCA-3', P-TgInS3D downstream primer: 5'-TGCATTCTGTCGATACGCCACGAGGAC-3', the pcr amplification condition is: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ extend 1min, totally 30 circulations, 72 ℃ and extend 5min, 4 ℃ and be incubated 1h; PCR reaction system 25 μ l are made up of the pure water of P-TgInS3D downstream primer, 1 * PCR damping fluid and the surplus of the P-TgInS2U upstream primer of 0.2 mM dNTP, 0.5 U Taq DNA polysaccharase, 100 ng pig genomic dnas, 1.25 μ M, 1.25 μ M; Two, the PCR reaction result of step 1 carries out electrophoresis detection, has promptly realized the detection in exogenous origin gene integrator site in the pig genome.

Transgenic pig filial generation in the present embodiment step 1 is the gfp transgene pig, present embodiment is by pEGFP-C1 plasmid transfection pig inoblast, obtain the positive cell of stably express green fluorescence protein gene, and, utilize somatic cell nuclear transfer technique to obtain the gfp transgene pig with the nuclear donor of this positive cell as body-cell neucleus transplanting.Transgenic pig obtains to have 7 of the offspring pigs of positive phenotype by natural crossing, extracts former generation and F1 for the transgenic pig genomic dna, and isolation identification obtains green fluorescence protein gene integration site TgInS1, TgInS2 and TgInS3 in the pig genome.

The concrete grammar that obtains the gfp transgene pig is as follows:

One, the fibroblastic preparation of the pig of transfection green fluorescence protein gene

The separation and Culture of a, porcine fetus fibroblasts (PFF)

1, draws materials and handle

At first cut open the belly and take out whole pig uterus, put into and use the sterile plastics bag of 70% alcohol in advance, go back to the laboratory with the foam thermal insulation tape.Put into then in the foraminous plastic tub, spray with 70% alcohol, take out intrauterine fetus (not destroying amnion) and put into the PBS liquid that contains 200IU/ml penicillin and 200 μ g/ml Streptomycin sulphate, rinsing is 2 ~ 3 times on super clean bench, pick up fetus with tweezers, break amnion with the sterilization eye scissors fetus is flowed out, put into the PBS liquid that contains 100IU/ml penicillin and 100 μ g/ml Streptomycin sulphates, cut off head, tail, four limbs and gill, residue is organized standby.

On super clean bench, with containing among the aseptic PBS of 100IU/ml penicillin and 100 μ g/ml Streptomycin sulphates, in PBS, it is cut into fritter about 1mm3 with eye scissors in aseptic culture dish with above-mentioned pretreated portion of tissue rinsing 3 ~ 5 times.Adopt Trypsin enzyme process digestion method to cultivate the Harbin white pig fetal fibroblast.

2, digestion method is cultivated porcine fetus fibroblasts (PFF)

After treating that tissue block is sunk, supernatant is removed in suction, in culture dish, add the Digestive system that contains 0.25% trypsinase-0.04%EDTA, place 39 ℃ of digestion 30min down, the centre shakes up for several times, after digestion finishes, collection contains the Digestive system of dissociated cell, place 4 ℃ of refrigerator internal cooling, add Digestive system again at surplus tissue, repeat above-mentioned digestion step five times, and the Digestive system that contains cell that will at every turn collect is admixed together, the centrifugal supernatant that goes, be resuspended in the D-MEM/F-12 nutrient solution (containing 20% foetal calf serum, 2mmol/L glutamine, 100IU/ml penicillin and 100 μ g/ml Streptomycin sulphate) of 39 ℃ of pre-temperature of 1ml, after the piping and druming evenly, adjust cell density to 5 * 105 ~ 1 * 106 cell/ml with nutrient solution.Culturing bottle is placed 39 ℃, and saturated humidity is cultivated in the 5%CO2 incubator.Observe behind 48 ~ 72h, find that adherent back changes half or whole nutrient solutions, changed a nutrient solution in after this per two days.

3, porcine fetus fibroblasts goes down to posterity

When primary cell grows to 90% when converging, the sucking-off nutrient solution with the PBS flushing of no calcium ions and magnesium ions 1 ~ 2 time, adds 0.25% an amount of tryptic digestive juice and digests about 2 ~ 3min in 39 ℃, preferably is no more than 5min.Examine under a microscope, when treating most of cell rounding, add an amount of D-MEM/F-12+10% foetal calf serum nutrient solution immediately and stop digestion, inhale gently and beat, make cell suspension, abandon supernatant behind the centrifugal 5min of 1000rpm, be inoculated in and continue cultivation in other culturing bottles.Adherent tighter epithelial cell and indigested inoblast can continue to cultivate in the former ware.

The foundation of b, liposome transfection porcine fetus fibroblasts (PFF) method

1, luciferase plasmid is used liposome transfection pig inoblast

(1) cell transfecting: 24h before the transfection, cultured cells digestion is diluted to finite concentration (2 * 105), in 5 holes of evenly distribute in 24 orifice plates, cultivate 20 ~ 24h in 38.5 ℃, saturated humidity, 5%CO2 incubator, cell length to 80 before the transfection ~ 90% converges.Specific operation process is as follows: 0.8 μ g pEGFP-C1 plasmid DNA is dissolved among the DMEM of 50 μ l serum-frees, gently mixing; Respectively 2 μ l liposomes (shaking up gently with preceding) are dissolved among the DMEM of 50 μ l serum-frees, mixing gently mixes both within 5min then, and with pipettor mixing gently, room temperature leaves standstill hatches 20min, and the DNA-liposome complex is formed.Add the DMEM of 400 μ l serum-frees afterwards, gently mixing.Wash desire cells transfected twice with PBS, the DMEM with serum-free washes the desire cells transfected once again, then above-mentioned mixed solution is added in the cell, behind the 6h, pour out transfection liquid, replace transfection liquid with the DMEM that contains 20% serum, 38.5 ℃, saturated humidity, 5%C O2 continue cultivation.Behind the 24h, use fluorescence microscope.

(2) observe counting: after cultivating 24h, it is that the fluorescent microscope of 488nm is observed down the GFP protein expression that transfectional cell is placed on excitation wavelength, is standard to amplify 200 times field of microscope, count the cell count of 5 fields of microscope expression green fluorescences, calculate positive rate, estimate transfection efficiency with this.

2, G418 to transfection after the screening of cell

With fluorescence microscope transfection situation, write down the resistant cell number behind the cell transfecting 24h.Change the G418 that adds 500 μ g/ml behind the liquid then according to a conventional method, screened 7 days, the G418 that adds 200 μ g/ml after 7 days keeps screening.When treating that cell all sends green fluorescence under the fluorescent microscope, carry out had digestive transfer culture or frozen.

This experiment obtains stable integration pEGFP-C1 plasmid and the pig inoblast of egfp expression is arranged.

Two, the birth of body-cell neucleus transplanting and clone pig

1, somatocyte is prepared

5 ~ 10 times the cell of will going down to posterity treats that it covers with, behind contact inhibition 2d ~ 5d, and conventional digestion, centrifuge washing, last cell precipitation micrurgy liquid is resuspended as nuclear donor.

2, acceptor ovocyte stoning

Utilize blind suction method to carry out the mature oocyte stoning, promptly do " a 8 " font in diameter 60mm culture dish lid central authorities, long 1.5cm, the 100 μ l micrurgy drops of wide 20 ~ 30mm cover with mineral oil again.Donorcells and mature oocyte are changed over to simultaneously wherein in 38.5 ℃, the atmosphere surrounding of 5% C O2,95% air, saturated humidity balance 15min, on the inverted microscope that is equipped with micrurgy instrument and constant temperature platform, use fixedly suction pipe (internal diameter 25 ~ 35 μ m then, external diameter 100 ~ 120 μ m) sticking ovocyte, stoning/entry needle with internal diameter 15 ~ 25 μ m makes first polar body be in clock and watch 1 o ' clock position, then from 3 o'clock inserting needle, absorption first polar body and close on 10 ~ 20% kytoplasms that may contain oocyte nuclei.Select diameter 15 ~ 20 μ m, refractivity is strong, circle, and slick somatocyte is put into ovum week crack from the stoning otch, presses zona pellucida with injection needle points, and donorcells is contacted closely with the after birth of acceptor ovum.30 ovocytes of every batch operation, the cell that after the end donorcells-ooecium matter is constituted is transferred among the PZM-3 (reconstruct ovum), and at 38.5 ℃, the atmosphere surrounding of 5% C O2,95% air recovers 1.5 h in the saturated humidity.

3, fusion and activation

Transfer to balance 3 min in the fusion liquid with recovering good reconstruct ovum in batches, after fusion/activation liquid washing 3 times, put into for 5 every batch and be paved with the integration slot that merges liquid, stir recombinant eggs with very thin solid glass pin that draw and most advanced and sophisticated, make donorcells-recipient oocyte film contact surface parallel with electrode, apply one 30 μ s with the ECM2001 fusion instrument, 2.0kv/cm electric pulse induce fusion to activate simultaneously, with PZM-3 washing 5 times, change over to immediately in the embryo medium of mineral oil covering, 38.5 ℃, 5% CO ₂, 95% air atmosphere surrounding, saturated humidity is taken out after cultivating 0.5 h ~ 1 h, decision fusion under stereoscopic microscope.

4, embryo's vitro culture and egfp expression detect

The reconstructed embryo that merges is incubated in the PZM-3 nutrient solution, and culture condition is 38.5 ℃, the atmosphere surrounding of 5% C O2,95% air, saturated humidity; It is the 0th day that the embryo makes up the same day, is cultured to the 6th day and adds up spilting of an egg embryo number (embryo who contains two and two above blastomeres) and blastaea number, and fluoroscope is counted the blastaea number with green fluorescence down.

5, embryo transfer

The embryo transfer that is used to observe omnidistance reconstructed embryo of growing is merged within the 24h of back at electricity and is being carried out, spontaneous estrus the 0th day or the 1st day breed sow as acceptor (quiet and secludedly uprightly being reflected into the 0th day that oestruses) to occur pressing, the acceptor kind is long white, Da Bai or Du Luoke, implantation method is that transplant in modus operandi uterine tube deep, and every pig is transplanted at least 120 pieces of embryos.

6, cyesiognosis and feeding and management

After the embryo transfer, in 28-30 days, carrying out first, ultrasonic wave gestation detected to the acceptor that do not return feelings.Regularly detect once weekly afterwards, follow the tracks of the fetation situation, adjust feeding and management, be born until the transgene clone pig.

7, transgene clone pig phenotype and DNA identify

The spontaneous labor after 114 days of sow normal pregnancy, postnatal individuality is observed lamp (UV-5 type with portable ultraviolet, wavelength 365nm, intelligence source, Beijing leads to biotechnology research institute) excite, observe the egfp expression situation of body surface, for the dead individuality in birth back, get the tissue of ear's tissue, heart, lungs, kidney, spleen, muscle respectively, under fluorescent microscope, detect the egfp expression situation, ordinary method is extracted each tissue DNA, carries out PCR with GFP gene order special primer and measures; The upstream primer base sequence is: 5'-TGA ACC GCA TCG AGC TGA AGG G-3', and the downstream primer base sequence is: 5'-TCC AGC AGG ACC ATG TGA TCG C-3'; The PCR reaction conditions is: 94 ℃ of 3 min; 94 ℃ of 30 sec, 68 ℃ of 30 sec, 72 ℃ of 60 sec(25cycles); 72 ℃ of 5 min; 4 ℃ of 30min.

This experiment obtain can the expressing green fluorescent protein gene transgenic pig, wherein the gfp transgene pig be born back 2 days under 365nm wavelength ultraviolet excitation hoof be green; The gfp transgene pig be born back 2 days under 365nm wavelength ultraviolet excitation hoof and nose be green.

To the transgenic pig of the green fluorescence protein gene that obtains go down to posterity and the method identified as follows:

1, the transgenic pig offspring obtains

K25-2 transgenic pig of former generation and the natural crossing of wild-type landrace obtain 11 and 10 two nest F1 filial generation.

2, the extraction of genomic dna

The Universal Genomic DNA Extraction Kit Ver.3.0 that uses Dalian precious biotechnology company limited to produce carries out the extracting and purifying of genomic dna.Concrete steps are seen the test kit specification sheets.

3, the PCR method is to the evaluation of F1 filial generation

K25-2 transgenic pig of former generation and the hybridization of wild-type landrace obtain 11 and 10 two nest F1 filial generation respectively, with eGFP gene order special primer PCR are carried out in filial generation and measure.The upstream primer base sequence is: 5'-TGAACCGCATCGAGCTGAAGGG-3', the downstream primer base sequence is: 5'-TCCAGCAGGACCATGTGATCGC-3', product 308bp.The PCR reaction conditions is: 94 ℃ of 3min; 94 ℃ of 30sec, 68 ℃ of 30sec, 72 ℃ of 1min(30 cycles); 72 ℃ of 5min; 4 ℃ of 1h.

Wherein, among the Junction PCR gel electrophoresis result K25-2 and filial generation integration site downstream flank sequence amplification result's thereof electrophorogram as shown in Figure 1, K25-2 and filial generation integration site upstream flank sequence amplification result's thereof electrophorogram is as shown in Figure 2.M：DL2000。

Method to the clone of transgenic pig integration site and analysis is as follows:

A, TAIL-PCR are to the detection of integration site

1, primer sequence

(1) Auele Specific Primer

The upstream primer base sequence is: SPS1:5'-GCT ACC CGT GAT ATT GCT GAA GAG CTT GGC G-3'; SPS2:5'-GGA GGC TAA CTG AAA CAC GGA AGG AGA CAA TAC C-3'; SPS3:5'-CAG CTT GGA GCG AAC GAC CTA CAC CGA ACT-3'.The downstream primer base sequence is: SPA1:5'-GTT CAC CTT GAT GCC GTT CTT CTG CTT GTC-3'; SPA2:5'-GCT AGC GGA TCT GAC GGT TCA CTA AAC CAG-3'; SPA3:5'-CGG ATC TGA CGG TTC ACT AAA CCAG CTC TGC-3'.

(2) degenerated primer:

AD1:5'-NGT CGA SWG ANA WGA A-3'; AD2:5'-TGW GNA GSA NCA SAG A-3'; AD3:5'-AGW GNA GWA NCA WAG G-3'; AD4:5'-STT GNT AST NCT NTG C-3'; AD5:5'-NTC GAS TWT SGW GTT-3'; AD6:5'-WGT GNA GWA NCA NAG A-3'; Wherein, N=A, C, G, T; S=C, G; W=A, T.

2, TAIL-PCR reaction system and program

(1) 1st PCR reaction:

Reaction system (20 μ l): template DNA 1 μ l (＜100ng), 10x PCR reaction buffer 2.0 μ l, 2.5mmol dNTP is 1.6 μ l, each 2.5 μ l of 10 μ mol primer SPS1/SPA1,30 μ mol primer AD primer are 2.0 μ l, the LA-Taq archaeal dna polymerase 0.2 μ l of 5U/ μ l, deionized water 10.7 μ l.

PCR program: 94 ℃ of 5min; 94 ℃ of 10sec, 64 ℃ of 30sec, 72 ℃ of 3min(10 cycles); 94 ℃ of 10 sec, 25 ℃ of 3min, 72 ℃ of 2.5min; 94 ℃ of 10sec, 64 ℃ of 3min, 72 ℃ of 2.5min, 94 ℃ of 10sec, 64 ℃ of 3min, 72 ℃ of 2.5min, 94 ℃ of 10sec, 44 ℃ of 1min, 72 ℃ of 2.5min(15 cycles); 72 ℃ of 10min, 4 ℃ of 1h.

(2) 2ndPCR reaction:

Reaction system (20 μ l): the 1st PCR product of 200 times of dilutions of template DNA 1 μ l, 10x PCR reaction buffer 2.0 μ l, 2.5mmol dNTP is 1.6 μ l, each 2.5 μ l of 10 μ mol primer SPS2/SPA2,30 μ mol primer AD primer are 2.0 μ l, the LA-Taq archaeal dna polymerase 0.2 μ l of 5U/ μ l, deionized water 10.7 μ l.

PCR program: 94 ℃ of 5min; 94 ℃ of 10sec, 64 ℃ of 3min, 72 ℃ of 2.5min, 94 ℃ of 10sec, 64 ℃ of 3min, 72 ℃ of 2.5min, 94 ℃ of 10sec, 44 ℃ of 1min, 72 ℃ of 2.5min(12 cycles); 72 ℃ of 10min, 4 ℃ of 1h.

(3) 3rdPCR reaction:

Reaction system (20 μ l): the 2nd PCR product of 200 times of dilutions of template DNA 1 μ l, 10x PCR reaction buffer 2.0 μ l, 2.5mmol dNTP is 1.6 μ l, each 2.5 μ l of 10 μ mol primer SPS3/SPA3,30 μ mol primer AD primer are 2.0 μ l, the LA-Taq archaeal dna polymerase 0.2 μ l of 5U/ μ l, deionized water 12.7 μ l.

PCR program: 94 ℃ of 5min; 94 ℃ of 10sec, 44 ℃ of 1min, 72 ℃ of 2.5min(20 cycles); 72 ℃ of 10min, 4 ℃ of 1h.

3, the recovery of amplified production

15 μ l PCR products are detected with 1% agarose gel electrophoresis, the dna fragmentation that obtains is cut down, the gel of producing with sky, Beijing root biochemical technology company limited reclaims the test kit recovery.Concrete steps are seen the test kit specification sheets.Wherein, the electrophorogram of 1st PCR reaction product as shown in Figure 3, the electrophorogram of 2nd PCR reaction product as shown in Figure 4, the electrophorogram of 3rdPCR reaction product is as shown in Figure 5.

4, order-checking and sequential analysis

Order-checking is finished by Invitrogen company.Utilize the nucleotide sequence of the BLAST software of NCBI website and the known pig among the GenBank and ESTs to compare and do function and structural homology analysis, promptly determined integration site TgInS1, TgInS2 and TgInS3.

In the present embodiment step 2 electrophoresis detection result show any one group positive, can determine that exogenous origin gene integrator is to the site.

：TgInS1：5'-TTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAATGCATGAAGCTGGGTACGCGTAAGCTTGGGCCCCTCGAGAGCCTGCTGAAGCTGGGTACGCGTAAGCTTGGGCCCCTCGAGAGCCTGCTTTTTTGTACAAACTTGTTCTATAGTGTCACCTAAATAGGCCTATCCCGCGGCCTATGCTAGAGTCCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAAACGAGCTCTGATTATAGGGACCTCCCCACCGTACACGCGTTCTTAAAATGTTTTATTTGTAAACGGGCAATCATTGCTTTACATGGGAAAAAAAAAAAAATCCCGTTAAAGTTACTGTGAAAAATACTCAAAGAGAGGGAGGAGGAAAAAGAAAACAACGAAAACAAACACTACAAAAAAAAAAAAAAAAAGGGCGGCCGCCCGCGATCTAAAACTAGTCCGGACGCGTGGGTCGACGATATAGCCTGCTTTTTTGTACAAACTTGTTCTATAGTGTCACCTAAATAGGCCTATCCCGCGGCCTAGGCTAAAGTCCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAAACGAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAATGGGGCGGAGTTGTTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGATGTACTGCCAAAACCGCAAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAATAAGGCCGCGTTGCTGGCGTTATTCCATAGGCTCCGCCTCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCTTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTTGCTACTCCACACA-3'。 Other steps and parameter are identical with embodiment one.

：TgInS2：5'-TACCTCCATACTGTTTTCCATAGTGGTTGTACCAATTTATATTCCCACCAATAGTGCAAGAGGGTTGCCTTTTCCCCACAGCTTCTTTAGCATTTGTTATTTGTAGAATTATTAATGATGACCATTCTGAATGGTGTGAAGTGGTATTTCATTGTAGTTTTGTTTTGCATTTCTCAAATAGTTACTGATGTTGAACATTGTTTTACTCATGTGCCTACTGGCCATCCATGTGTCTTCTTTGGGGAAATGTTTATTTAGGTCTTCTGCCCGAGATTAAGCCCTTGTCATTTGTATTGTTTGCAATGATTTTCTCCATTCCATTGGTTGTATTTTGTTTGTTTTATGGTGTCCTTTGCTGTGCAAAAGCTTGTAAGTTTGATTCGGTTCAATTGGTTTATTTTTGTTTTTATTTCTATTGCCTTGGCAGACTGACCTCTGAAAATATTTGTATGGTTTATGTCACCACACATTTTGCCTATGTTCTCTTCTATAGCTTTATGGTGTCTTGTCTTCTGTTCAACTTTGTTAAGCCATTTTGAGCTTGTTTATTGTGCATGGTGGGCGGATGTATTCTAGTTTCACTGATGGACATGCAGCTGTCCAGTTTTCTGAAAAAAATATCCAGAAGAGATTGTCTTTTCCCCATTTTATATTCCTTCATCTTTTATTAAAGATTAATTGACCATAGGTATCTGGGTTTATTTCTGGGCCCTCTGTTCTATTCCATTGATCTGTATGTCTGTTTTTGTAACAGTGCCATATTGTCTTGATTACTATAGCTTTGTAAGAAACACCAAAATGTCTGAAGTCTGGAAGAGTTATGCCTCCAGCTTGCTTATTTTCTTTCCTCCCTCAGGAATATTTGGCAATTCTGGGTCTTTCATAGTTCCATCAACAATTTTGGATTATTTGTTCTAGTTCTGTAAAAAATGTGGGGTACTTTGTTGTGGTTTGTATTAAATCTGTAGATTGCTTTGGGTAATATGGCCATTTTAGCAATATTAGTTCCTCCAAGCCAGGAGCATGTGATATCTTTCCATTTCTTTGAATCCTCTTTATTTTCCTTGATTGATGTTTTATAGTTCTCTGAGTATAATTCTCTCACCCCCTTGGACAGATGTACTAGGTCTTTTATTTTTGGGGGTGAATCTTTAAAAGGTATTGCTTTAATTTTAATTCATTTTCTAATATTTTATTGTTAATATAAAGAAATGCAGTTGATTTCTGAATATTAATCTTGTATCCTGATACTTTGCTGAATTTTTTGACTCAGGAAGTAGTTTGTTTGTGCAGAGTCCTTAGGGTTTTCTATATATCATATCATGTTATTCAACTTGAGTGACAATTTTACCTCTTGGTTTCCAATTTAGATACCTGTTCTTTCTTTTATTTGTCTGATTTCTGTGGCTAGGACTTCCAATACTATATAAAAGCAGTGAG-3'。 Other steps and parameter are identical with embodiment one.

：TgInS3：5'-TCACCATGGTAATAGCTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTGTACCGGGCCCATAAGGCCCTATAGTGAGTCGTATTAAGTCGACCATGGTTTTTTCCTCCTGTGTGAAATGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGTTGGGCGTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAACCTGAGGCTATGGCAGGCCTGCCGCCCCGACGTTGGCTGCGAGCCCTGGGCCTTCACCCGAACTTGGGGGGTGGGGTGGGGAAAAGGAGAAACGCGGTGTATTGGCCCCAAGGGGTCCTCGTGGCGTATCGACAGAATGCAGCCCTGGAACCGACCCACGCGTTTATGAACAACGATCCAACACCGGCGTTTTTATTCTATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGGGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGCCTTTTATTGGCGTGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAATGCATGGCGGTAATACGGTTATCCACAGAATCAGGGGGAAA-3'。 Other steps and parameter are identical with embodiment one.

Claims (4)

1. the detection method in exogenous origin gene integrator site in the pig genome, the detection method that it is characterized in that exogenous origin gene integrator site in the pig genome is carried out according to following steps: one, extract the transgenic pig progeny genome DNA, respectively at TgInS1, pcr amplification is carried out in the site that TgInS2 and TgInS3 foreign gene insert in the genome, wherein, primer at TgInS1 is P-TgInS1U upstream primer: 5'-CTATTGCCTTGGCAGACTGACCTCT-3', P-TgInS1D downstream primer: 5'-ACAGATCAATGGAATAGAACAGAGGG-3', the pcr amplification condition is: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ are extended 1min, totally 30 circulations, 72 ℃ are extended 5min, 4 ℃ of insulation 1h; PCR reaction system 25 μ l are made up of the pure water of P-TgInS1D downstream primer, 1 * PCR damping fluid and the surplus of the P-TgInS1U upstream primer of 0.2 mM dNTP, 0.5 U Taq DNA polysaccharase, 100 ng pig genomic dnas, 1.25 μ M, 1.25 μ M; Primer at TgInS2 is P-TgInS2U upstream primer: 5'-CTGTTCTGCCTAAACCGCATCACCATG-3', P-TgInS2D downstream primer: 5'-GCCTGGAGACGCCATCCACGCTGTTT-3', the pcr amplification condition is: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ extend 1min, totally 30 circulations, 72 ℃ and extend 5min, 4 ℃ and be incubated 1h; PCR reaction system 25 μ l are made up of the pure water of P-TgInS2D downstream primer, 1 * PCR damping fluid and the surplus of the P-TgInS2U upstream primer of 0.2 mM dNTP, 0.5 U Taq DNA polysaccharase, 100 ng pig genomic dnas, 1.25 μ M, 1.25 μ M; Primer at TgInS3 is P-TgInS3U upstream primer: 5'-CCCCGTGAGTCAAACCGCTATCCA-3', P-TgInS3D downstream primer: 5'-TGCATTCTGTCGATACGCCACGAGGAC-3', the pcr amplification condition is: 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ extend 1min, totally 30 circulations, 72 ℃ and extend 5min, 4 ℃ and be incubated 1h; PCR reaction system 25 μ l are made up of the pure water of P-TgInS3D downstream primer, 1 * PCR damping fluid and the surplus of the P-TgInS2U upstream primer of 0.2 mM dNTP, 0.5 U Taq DNA polysaccharase, 100 ng pig genomic dnas, 1.25 μ M, 1.25 μ M; Two, the PCR reaction result of step 1 carries out electrophoresis detection, has promptly realized the detection in exogenous origin gene integrator site in the pig genome.

2.1,TgInS1：5'-TTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAATGCATGAAGCTGGGTACGCGTAAGCTTGGGCCCCTCGAGAGCCTGCTGAAGCTGGGTACGCGTAAGCTTGGGCCCCTCGAGAGCCTGCTTTTTTGTACAAACTTGTTCTATAGTGTCACCTAAATAGGCCTATCCCGCGGCCTATGCTAGAGTCCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAAACGAGCTCTGATTATAGGGACCTCCCCACCGTACACGCGTTCTTAAAATGTTTTATTTGTAAACGGGCAATCATTGCTTTACATGGGAAAAAAAAAAAAATCCCGTTAAAGTTACTGTGAAAAATACTCAAAGAGAGGGAGGAGGAAAAAGAAAACAACGAAAACAAACACTACAAAAAAAAAAAAAAAAAGGGCGGCCGCCCGCGATCTAAAACTAGTCCGGACGCGTGGGTCGACGATATAGCCTGCTTTTTTGTACAAACTTGTTCTATAGTGTCACCTAAATAGGCCTATCCCGCGGCCTAGGCTAAAGTCCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAAACGAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAATGGGGCGGAGTTGTTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGATGTACTGCCAAAACCGCAAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAATAAGGCCGCGTTGCTGGCGTTATTCCATAGGCTCCGCCTCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCTTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTTGCTACTCCACACA-3'。

3.1,TgInS2：5'-TACCTCCATACTGTTTTCCATAGTGGTTGTACCAATTTATATTCCCACCAATAGTGCAAGAGGGTTGCCTTTTCCCCACAGCTTCTTTAGCATTTGTTATTTGTAGAATTATTAATGATGACCATTCTGAATGGTGTGAAGTGGTATTTCATTGTAGTTTTGTTTTGCATTTCTCAAATAGTTACTGATGTTGAACATTGTTTTACTCATGTGCCTACTGGCCATCCATGTGTCTTCTTTGGGGAAATGTTTATTTAGGTCTTCTGCCCGAGATTAAGCCCTTGTCATTTGTATTGTTTGCAATGATTTTCTCCATTCCATTGGTTGTATTTTGTTTGTTTTATGGTGTCCTTTGCTGTGCAAAAGCTTGTAAGTTTGATTCGGTTCAATTGGTTTATTTTTGTTTTTATTTCTATTGCCTTGGCAGACTGACCTCTGAAAATATTTGTATGGTTTATGTCACCACACATTTTGCCTATGTTCTCTTCTATAGCTTTATGGTGTCTTGTCTTCTGTTCAACTTTGTTAAGCCATTTTGAGCTTGTTTATTGTGCATGGTGGGCGGATGTATTCTAGTTTCACTGATGGACATGCAGCTGTCCAGTTTTCTGAAAAAAATATCCAGAAGAGATTGTCTTTTCCCCATTTTATATTCCTTCATCTTTTATTAAAGATTAATTGACCATAGGTATCTGGGTTTATTTCTGGGCCCTCTGTTCTATTCCATTGATCTGTATGTCTGTTTTTGTAACAGTGCCATATTGTCTTGATTACTATAGCTTTGTAAGAAACACCAAAATGTCTGAAGTCTGGAAGAGTTATGCCTCCAGCTTGCTTATTTTCTTTCCTCCCTCAGGAATATTTGGCAATTCTGGGTCTTTCATAGTTCCATCAACAATTTTGGATTATTTGTTCTAGTTCTGTAAAAAATGTGGGGTACTTTGTTGTGGTTTGTATTAAATCTGTAGATTGCTTTGGGTAATATGGCCATTTTAGCAATATTAGTTCCTCCAAGCCAGGAGCATGTGATATCTTTCCATTTCTTTGAATCCTCTTTATTTTCCTTGATTGATGTTTTATAGTTCTCTGAGTATAATTCTCTCACCCCCTTGGACAGATGTACTAGGTCTTTTATTTTTGGGGGTGAATCTTTAAAAGGTATTGCTTTAATTTTAATTCATTTTCTAATATTTTATTGTTAATATAAAGAAATGCAGTTGATTTCTGAATATTAATCTTGTATCCTGATACTTTGCTGAATTTTTTGACTCAGGAAGTAGTTTGTTTGTGCAGAGTCCTTAGGGTTTTCTATATATCATATCATGTTATTCAACTTGAGTGACAATTTTACCTCTTGGTTTCCAATTTAGATACCTGTTCTTTCTTTTATTTGTCTGATTTCTGTGGCTAGGACTTCCAATACTATATAAAAGCAGTGAG-3'。

4.1,TgInS3：5'-TCACCATGGTAATAGCTTACCGTAAATACTCCACCCATTGACGTCAATGGAAAGTCCCTATTGGCGTTACTATGGGAACATACGTCATTATTGACGTCAATGGGCGGGGGTGTACCGGGCCCATAAGGCCCTATAGTGAGTCGTATTAAGTCGACCATGGTTTTTTCCTCCTGTGTGAAATGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGTTGGGCGTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAACCTGAGGCTATGGCAGGCCTGCCGCCCCGACGTTGGCTGCGAGCCCTGGGCCTTCACCCGAACTTGGGGGGTGGGGTGGGGAAAAGGAGAAACGCGGTGTATTGGCCCCAAGGGGTCCTCGTGGCGTATCGACAGAATGCAGCCCTGGAACCGACCCACGCGTTTATGAACAACGATCCAACACCGGCGTTTTTATTCTATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGGGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGCCTTTTATTGGCGTGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAATAACTAATGCATGGCGGTAATACGGTTATCCACAGAATCAGGGGGAAA-3'。

Images