CN107299113A - Application processes of the H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo - Google Patents
Application processes of the H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo Download PDFInfo
- Publication number
- CN107299113A CN107299113A CN201710439507.0A CN201710439507A CN107299113A CN 107299113 A CN107299113 A CN 107299113A CN 201710439507 A CN201710439507 A CN 201710439507A CN 107299113 A CN107299113 A CN 107299113A
- Authority
- CN
- China
- Prior art keywords
- kdm6a
- embryo
- kdm6b
- h3k27me3
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
- C12N15/877—Techniques for producing new mammalian cloned embryos
- C12N15/8775—Murine embryos
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/89—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microinjection
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Developmental Biology & Embryology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of application processes of the H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo, analyze before implantation what difference is the tri-methylated patterns of H3K27 have with clone embryos in each period zona-free oocytes, influence of the difference of this pattern to clone embryos developmental potency, it was confirmed that the blastocyst rate of clone embryos and the birth rate of cloned animal can be improved by the fine setting to KDM6A and KDM6B.
Description
Technical field
The present invention relates to a kind of biological technical field, specifically a kind of H3K27me3 and its demethylase KDM6A/B exist
Application process in mouse nuclear transfer reconstructed embryo.
Background technology
Body-cell neucleus transplanting, which refers to somatic cell nuclear being injected into non-nucleus egg mother cell matter, obtains reconstructed embryo, by reconstructed embryo
Final development is the technology of offspring；The reprogramming of cell can pass through nuclear transfer, cell fusion, specific transcription factor and culture
The methods such as condition induction realize, but it is currently the only can inducing cell again develop into the reprogramming method of individual and there was only body
Nuclear transplantation, other method is merely able in the level of cell, molecule or biochemistry produce induction, and all there are some not
Foot part.Since somatic cell nuclear transfer technique is set up, cloning efficiency is constantly in relatively low level, only seldom reconstruct
Embryo can develop subjects born at term, generally only 1~2% birth rate in mouse, and most of Cloning of mouse are going out
Shortly can be dead after life, the abnormal symptoms such as the huge, Overgrowth of fetal of placenta also occur in the Cloning of mouse that success is born, i.e.,
So-called " fetus giantism ", the main cause for causing this phenomenon is that donorcells core can not completely be reprogrammed institute
Cause；Reprogramming generally refers to the erasing and reconstruction of epigenetic modification, in nuclear transfer reconstructed embryo, originally stable, whole end
The epigenetic modification pattern of the body cell of differentiation, before the activation of zygotic gene group in the extremely short time, by egg mother cell matter
The epigenetic modification pattern for embryonism is reversed by force.After donor nuclei is injected into non-nucleus egg mother cell, reprogrammed
Journey just starts to start, and this process mainly includes core and extranuclear structure rearrangement, DNA methylation, genomic imprinting, X chromosome work
Property, " erasing with rebuild " of a series of histone methyl/epigenetic modifications such as acetyl/phosphorylation and telomere length.
Since the reprogramming of somatic cells success that nuclear transfer technology is mediated, about the research of nuclear transfer technology, enclose all the time
Around how to improve reprogramming efficiency this key problem expansion, the reprogramming of nuclear transfer mediation generally comes from the following aspects
Evaluate：(1) blastocyst rate of reconstructed embryo；(2) birth rate of cloned animal；(3) survival rate of cloned animal；(4) from reconstruct
The success rate of embryonic stem cell is obtained in blastaea；In 2006, Japanese scientist Takahashi and Yamanaka utilized IPS
Technology is screened by permutation and combination and one by one in the gene of 24 kinds of candidates, and inductor reprogramming can be reached by finally determining
The fibroblast of mouse can be recovered multipotency character by key factor Oct-3/4, Sox2, c-Myc and Klf4, this four factors
State.
Body-cell neucleus transplanting is that terminal differentiation body cell can be uniquely restored to embryonic cell state and developed to be
The technological means of individual, after somatic cell nuclear enters ooecium matter, can make donor nuclear reprogramming within the extremely short time, be returned to complete
The state of energy property, the kytoplasm of egg mother cell is significantly larger than the specific transcription factor that external source is transferred to reprogramming of somatic cells ability,
In nuclear transfer reconstructed embryo, the epigenetic modification pattern of the body cell of stable, terminal differentiation, is activated in zygotic gene group originally
In the before extremely short time, the epigenetic modification pattern for embryonism is reversed by egg mother cell matter by force, when donor nuclei note
Enter to after non-nucleus egg mother cell, reprogramming process just starts to start, this process mainly include core and extranuclear structure reset,
DNA methylation, genomic imprinting, X chromosome activity, a series of histone methyl/tables such as acetyl/phosphorylation and telomere length
See " erasing is with rebuilding " of genetic modification.
During mice embryonic early development, epigenetic modification is also sending out violent change, this dynamic simultaneously
It is being that correct activation and silencing specific genes are prepared that change, which is, the type and degree of epigenetic modification on histone, directly
Connect and decide whether zygotic gene group being capable of successful activation；Histone methylated modification is that a kind of important epigenetics is repaiied
Decorations, histone methylated modification and heterosomal formation, the inactivation of X chromosome, the transcriptional regulatory of specific gene, genome
The process such as integrality and cell development has close ties, and this modification plays extremely important during early embryo development
Role；Current research shows that H3K9me3, H3K27me3 and H3K72me3 are the marks of DNA Transcription inhibitions；And
H3K4me3, H3K36me3 and H3K79me3 are relevant with the transcriptional activation of gene, and H3K27me3 modifications can be gone by two kinds of histones
Methylase KDM6A and KDM6B remove methyl, and KDM6A and KDM6B are respectively provided with Jmjc dioxygenase domains, this domain
It is the activated centre of demethylation, the two expression of important histone demethylase in Development of Mouse Embryos of KDM6A, KDM6B
How is pattern；How about is relation between KDM6A, KDM6B and H3K27me3 are modified in egg mother cell；Associated research is also not
Appear in the newspapers, in order to solve the above problems, each period embryo using lonely female activation as research object, research H3K27me3, KDM6A and
Relation of the KDM6B three in the time and functionally, come find improve Embryo viability method be current research direction.
With the research to embryonic stem cell versatility molecular mechanism, promote and the mechanism of reprogramming has deeply been recognized；Grind
Study carefully discovery, Oct4, Sox2, Nanog are bound to each other to form a compound, set up the feedback mechanism of a Self-controlled；Reprogramming
Shown in relation as accompanying drawing 1 between the factor and H3K27me3；As seen from the figure, the target gene of reprogramming transcription factor is largely divided into three
Class：(1) gene that active list reaches in embryonic stem cell, during reprogramming, the overwhelming majority suppresses the gene of expression and PcG is total to
Positioning, PcG protein families are PRC compound important components, wherein most importantly PRC2 is catalyzed histone H 3 the 27th
Tri-methylated, the gene modified with H3K27me3 of position lysine, its expression can be suppressed；(2) pressed down in embryonic stem cell
The gene of system, in reprogramming, it is some maintain dryness gene promoter regions the 4th lysine of histone H 3 it is tri-methylated
Modification, transcription factor can be recruited the promoter region to these genes again, activate the expression of dryness gene；(3) in "
The key gene of weighing apparatus state ", can form a kind of unique chromosome modification of multipotential stem cell during reprogramming, and this modification is same
When there is transcriptional activity H3K4me3 and suppress H3K27me3 marks, i.e., " bivalent construction domain ", this unique apparent modification maintains pass
The plasticity of key gene so that multipotential cell can have Mutiple Choice in atomization.
It is histone methylated modification not only with heterosomal formation, x chromosome inactivation, genetic transcription regulation, genome
Integrality has substantial connection, and plays key player during reprogramming of somatic cells and early embryo development, wherein,
This modifications of H3K27me3 can be removed methyl by two kinds of demethylases：(1) KDM6A, also referred to as UTX；(2) KDM6B, also known as
JMJD3, KDM6A and KDM6B make the H3K27me3 of specific gene modify removal in reprogramming, so that gene is activated,
KDM6A genes are located on X chromosome, comprising six TPR, and can escape the deactivation of X chromosome, KDM6A is equal with KDM6B
Containing a JmjC domain guarded very much, JmjC domains complete demethyl in the case where divalent iron ion and α-ketoglutaric acid are participated in
The process of change.
It is reported that, in Mouse Embryo Development and cell differentiation, KDM6A has to the key gene for influenceing embryonic development
Important regulating and controlling effect；The same with KDM6A, KDM6B is equally the important demethylases of H3K27me3, is compiled by autosome
Code, shows in the research to mouse, and KDM6B participates in turn of white and brown fat by the activity of the fatty key gene of regulation and control
Change process；After bone injury, KDM6B can adjust the differentiation of osteoclast, and may limit the morbidity of osteoporosis, Er Qieyu
Skin repair has certain contact；After damaged nerve cell, KDM6B can limit hyper-proliferative and the regeneration of schwann cell, from
And prevent the generation of neurofibroma, in addition, KDM6B also plays adjustment effect in proinflammatory and anti-inflammatory response, in summary,
KDM6A and KDM6B demethylation enzymatic activity is extremely important in cell differentiation, Cycle Regulation, macrophage is not only involved in thin
Born of the same parents differentiation, it is neural stem cell differentiating, and can with the reprogramming process of regulating cell, participate in ES cell differentiation, regulation and control embryo
The many aspects such as the expression of tire development related gene, H3K27me3 histone demethylases KDM6A/B is found in 2007, with
Correlation research be concentrated mainly on the Biochemical Mechanism of demethylation in terms of, research KDM6A/B is in nuclear transfer reconstruct embryonic development
Effect have not been reported.
The content of the invention
Reconstructed it is an object of the invention to provide a kind of H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer
Application process in embryo, to solve the problems mentioned in the above background technology.
To achieve the above object, the present invention provides following technical scheme：
A kind of application processes of H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo, including
Following steps：
1) preparing experiment animal：
The donor mice of egg mother cell when being imaged using Oct4 promoters-green fluorescent transgenic mouse as living cells
(OG2)；
2) MII period egg mother cells are collected：
3) preparing experiment reagent：
3.1) embryo medium：
3.2) immunofluorescence and the related main agents of Western blotting：
4% paraformaldehyde liquid, Triton X-100, phosphate buffered saline, polysorbas20, DAPI dyestuffs,
Antibody Oct4, antibody Nanog, antibody SSEA1, antibody Sox2, antibody H3K27me3, antibody KDM6A, antibody KDM6B, RNA are carried
Take kit, real-time fluorescence quantitative PCR；
4) quantitative primer
4.1) KDM6A, primer sequence is：
forward-TATTGGCCCAGGTGACTGTGAA
reverse-CAGATCTCCAGGTCGCTGAATAAAC
4.2) KDM6B, primer sequence is：
forward-GCTGGAGTGCTTGTTCCATGAG
reverse-GAAAGCCAATCATCACCCTTGTC
4.3) Gapdh, primer sequence is：
forward-AAAATGGTGAAGGTCGGTGTG
reverse-AATGAAGGGGTCGTTGATGG
5) experimental method
5.1) the lonely female activation of MII phases egg mother cell
5.2) siRNA microinjections
SiRNA-KDM6A, siRNA-KDM6B and siRNA- control group are diluted to respectively with the TE buffer solutions of nuclease free
Liquid after dilution, is slowly injected among the kytoplasm of egg mother cell by 40mM using micromanipulation arm by injection needle, note
Egg mother cell room temperature after penetrating is transferred to KSOM nutrient solutions after recovering 15min, is placed in 2h in 37 DEG C of incubators；
5.3) real-time quantitative PCR, advises according to quantitative specification, is tested；
5.4) immunofluorescence dyeing
5.4.1) embryo fixes：Embryo is put into the paraformaldehyde fixer that mass fraction is 4%, room temperature 60min or 4
Fixation is stayed overnight under the conditions of DEG C；
5.4.2 it is) penetrating：Embryo after fixation is cleaned one time with 1ml phosphate buffered salines, mass fraction is moved into
For 0.5% Triton X-100 solution room temperature treatment 15min；
5.4.3) close：Embryo is put into containing the Triton X-100 and mass fraction that mass fraction is 0.2%
30min is closed for room temperature in 1% bovine serum albumin solution；
5.4.4) antibody incubation：Embryo is moved into 37 DEG C of incubation 1h in the antibody crossed through diluted, dilution contains matter
The bovine serum albumin(BSA) that the polysorbas20 and mass fraction that amount fraction is 1% are 1%, is floated after incubation with phosphate buffered saline
Wash 3 times, each 5min, add the antibody-solutions of confining liquid dilution, confining liquid is containing the polyethylene glycol octyl group that mass fraction is 0.2%
Phenyl ether and the bovine serum albumin solution that mass fraction is 1%, room temperature lucifuge use phosphate buffered saline after being incubated 1h
Lucifuge is rinsed 3 times, each 5min；
5.4.5) DAPI dyeing：Embryo's room temperature lucifuge is dyed into 15min, 3 are rinsed with phosphate buffered saline lucifuge
It is secondary, each 5min；
5.4.6) mounting：The anti-quenching medium of drop of plus one moves into anti-essence on slide, by the embryo after dyeing and gone out in agent, covering
Mountant mounting after cover glass；
5.4.7) co-focusing imaging：Image is gathered using Nikon A1R Laser Scanning Confocal Microscopes；
5.5) living cells is imaged：Egg mother cell after microinjection siRNA, after lonely female activation 6h, is incubated at Nikon
Ti-E installs living cells imaging system additional, and uses 488nm laser scannings, is imaged by Nikon A1R camera scannings；
5.6) data statistics and analysis.
It is used as further scheme of the invention：In the step 1, the mouse is purchased from University of the Inner Mongol's Animal Experimental Study
Center, donor mouse is raised in SPF grades of 22~24 DEG C of Animal Houses, relative humidity 50~60%, and Animal House light application time is daily early 8
Point is to late 8 points.
It is used as further scheme of the invention：In the step 3.1, the compound method of embryo medium is：
1) the dense liquid storages of HCZB：500mL；Constituent is：Ultra-pure water 495ml, sodium chloride 2380mg, potassium chloride 180mg, 7
Water magnesium sulfate 145mg, disodium ethylene diamine tetraacetate 20mg, sodium lactate 2.65mL, glucose 500mg, potassium dihydrogen phosphate 80mg；
2) the dense liquid storages of 10ml calcium chloride 100X：It is formulated by 0.2g calcium chloride dihydrates and 10ml ultra-pure waters；
3) the dense liquid storages of 10ml strontium chlorides 100X：It is formulated by the water strontium chlorides of 2.666g six and 10ml ultra-pure waters；
4) the dense liquid storages of 20ml glutamine 100X：It is formulated by 0.294g glutamine and 20ml without calcium CZB solution；
5) cytochalasin B solution：It is dissolved in dimethyl sulphoxide solution and is prepared with 1mg/ml proportioning by cytochalasin B
Form；
6) polyvinylpyrrolidonesolution solution：
Mass fraction is 10% PVP solution：It is formulated by 1g PVP and 10ml HCZB；
Mass fraction is 3% PVP solution：It is formulated by 0.3g PVP and 10ml HCZB；
7) hyaluronidase solution：It is formulated by 20ml M2 nutrient solutions and 100mg hyaluronidases.
It is used as further scheme of the invention：In the step 5.2, the compound method of KSOM nutrient solutions is：Often
0.38mg containing disodium EDTA, sodium chloride 559.5mg, potassium chloride in 100mLKSOM-AA embryo mediums
18.5mg, potassium dihydrogen phosphate 4.75mg, 7 water magnesium sulfate 4.95mg, lactylate salt solution 0.174ml, glucose 3.60mg, carbonic acid
Hydrogen sodium 210.0mg, glutamine 14.5mg, Sodium Pyruvate 2.2mg, dual anti-1 6.3mg, dual anti-2 5.0mg, essential amino acid
1.0ml, nonessential amino acid 0.5ml；Wherein disodium EDTA is preferentially added dropwise, and 100mg bovine serum albumin(BSA)s are added
It is added in 100mLKSOM-AA embryo mediums, gently mixing makes bovine serum albumin(BSA) slow mechanism dissolved, should not be aggressively shaken liquid
Cause protein denaturation to avoid generation foam；With 0.22 μm of syringe filter nutrient solution to sterile plastic tube
Interior, solution is stored in 4 DEG C, 1~2 week holding time.
It is used as further scheme of the invention：In the step 5.6, data statistics uses SPSS10.0 with analysis method
Statistics software is analyzed and processed, P<0.05 is significant difference, P<0.01 is that difference is extremely notable.
Compared with prior art, the beneficial effects of the invention are as follows：The present invention passes through the embryo to the lonely female different times of mouse
Carry out H3K27me3 modifications situation to be detected, as a result show, in mouse 8- cells and mulberry body, can't detect H3K27me3
Modification；In preimplantation embryos, KDM6A, KDM6B expression quantity are very high, but can't detect KDM6A's in 8- cell stage embryos
Albumen；In preimplantation embryos, KDM6A, KDM6B have functional compensation phenomenon on mRNA and protein level；Reduction
KDM6B expression quantity, is favorably improved the blastocyst rate and quality of blastocysts of embryo, i.e. 95.1%vs.84.3%, P<0.05, KDM6B
The reduction of expression quantity, contributes to Oct4-GFP expression, so as to contribute to the lifting of egg mother cell reprogramming ability；The present invention with
Mouse is research object, analyzes the tri-methylated patterns of H3K27 and the difference of clone embryos in the preceding each period zona-free oocytes of implantation,
And influence of the difference to clone embryos developmental potency, as a result show to improve KDM6A and/or reduce KDM6B expression quantity, have
Help improve blastocyst rate, blastaea and the nuclear-transfered embryonic stem cell quality of embryo；Pass through the fine setting energy to KDM6A and KDM6B
The blastocyst rate of clone embryos and the birth rate of cloned animal are improved, is that the further development of somatic cell nuclear transfer technique is made
Further place mat.
Brief description of the drawings
The dynamic change that Fig. 1 is H3K27me3 in mouse preimplantation embryos-mouse lonely female activation embryo each stage of development is shown
It is intended to, a length of 10 μm of engineer's scale.
The dynamic change that Fig. 2 is H3K27me3 in mouse preimplantation embryos-in 2- cells, 4- cells, 8- cells, mulberry body
With blastaea period H3K27me3 immunofluorescence dyeing result schematic diagrams, a length of 10 μm of engineer's scale.
Fig. 3 be mouse preimplantation embryos in H3K27me3 dynamic change-hatched blastocyst in H3K27me3 fluorescence signals only
It is present at inner cell mass, a length of 10 μm of engineer's scale.
Fig. 4 is expression pattern cylindricality comparison diagram of the MII egg mother cells before stoning with KDM6A, KDM6B gene after stoning.
Fig. 5 is the change curve that KDM6A each periods before implantation are detected by real-time quantitative PCR.
Fig. 6 is the change curve that KDM6B each periods before implantation are detected by real-time quantitative PCR.
The cellular localization figure that Fig. 7 is KDM6A and KDM6B in MII period egg mother cells.Upper drawing scale is 50 μm, figure below
For 20 μm.
Fig. 8 be by immuning fluorescent dyeing analysis KDM6A in 2- cells, 4- cells, 8- cells, mulberry body and blastaea
Positioning figure, engineer's scale length is 20 μm.
Fig. 9 be by immuning fluorescent dyeing analysis KDM6B in 2- cells, 4- cells, 8- cells, mulberry body and blastaea
Positioning figure, engineer's scale length is 20 μm.
Figure 10 is to detect KDM6A, KDM6B albumen comparison diagram in MII phase egg mother cells by immuning hybridization.
Figure 11 is Subcellular Localization figures of the KDM6A in fetal fibroblast, and engineer's scale length is 50 μm.
Figure 12 is Subcellular Localization figures of the KDM6B in fetal fibroblast, and engineer's scale length is 50 μm.
Figure 13 is KDM6A-siRNA interference position schematic diagrames.
Figure 14 is KDM6B-siRNA interference position schematic diagrames.
Figure 15 is that siRNA microinjections are entered into MII phases egg mother cell and embryo collection time point schematic diagram.
Figure 16 is the measurement result cylindricality that real-time quantitative PCR verifies siRNA interference fragments specificity and jamming effectiveness efficiency
Figure.
Figure 17, which is that Immunofluorescence test list is double, to be disturbed after KDM6A and KDM6B in 8- cells, mulberry body period embryo
H3K27me3 variation diagram.
Figure 18 is the change that Immunofluorescence test list pair disturbs H3K27me3 in mulberry body period embryo after KDM6A and KDM6B
Change figure.
Figure 19 is the mRNA expression curve maps that real-time quantitative PCR detects KDM6B after injection KDM6A-siRNA.
Figure 20 is the mRNA expression curve maps that real-time quantitative PCR detects KDM6A after injection KDM6B-siRNA.
Figure 21 is the albumen variation diagram that immuning hybridization detects KDM6A, KDM6B after injection siRNA.
Figure 22 is the albumen situation of change column diagram that immuning hybridization detects KDM6A, KDM6B after injection siRNA.
Figure 23 is influences of the interference KDM6A and KDM6B to quality of blastocysts respectively, and engineer's scale is 100 μm.
Figure 24 is statistics column diagrams of the injection siRNA to embryonic blastula developmental rate.
After Figure 25 is injection siRNA, blastaea DAPI nuclear targeting electron microscopes, figure medium scale is 50 μm.
Figure 26 is the blastomere number statistical result schematic diagram to DAPI nuclear targetings, * * P ＜ 0.01, * * * P ＜
0.001。
Figure 27 is that nest-type PRC detects OG2 transgenic mices, has the mouse of single band pure for Oct4-GFP at 200bp
Zygote, testing result schematic diagram.
Figure 28 is GFP fluorescence signals in blastaea after 488nm laser scanning surfaces detection interference KDM6B, and engineer's scale is 50 μ before interference
Engineer's scale is 20 μm after m, interference.
Shot under the image that Figure 29 takes pictures for injection Control-siRNA embryos through living cells delay, amplification 200X.
Shot under the image that Figure 30 takes pictures for injection KDM6B-siRNA embryos through living cells delay, amplification 200X.
Embodiment
The technical scheme of this patent is described in more detail with reference to embodiment.
Fig. 1-30 are referred to, a kind of H3K27me3 and its demethylase KDM6A/B is in mouse nuclear transfer reconstructed embryo
Application process, comprises the following steps：
1) preparing experiment animal：
The donor mice of egg mother cell when being imaged using Oct4 promoters-green fluorescent transgenic mouse as living cells
(OG2)；
2) MII period egg mother cells are collected：
3) preparing experiment reagent：
3.1) embryo medium：
3.2) immunofluorescence and the related main agents of Western blotting：
4% paraformaldehyde liquid (PFA), Triton X-100, phosphate buffered saline (PBS), polysorbas20,
DAPI dyestuffs, antibody (Oct4) (thinner ratio 1:500), antibody (Nanog) (thinner ratio 1:500), antibody (SSEA1) (thinner ratio
1:50), antibody (Sox2) (thinner ratio 1:500), antibody (H3K27me3) (thinner ratio 1:50), antibody (KDM6A) (thinner ratio 1:
50), antibody (KDM6B) (thinner ratio 1:500), RNA extracts kits, real-time fluorescence quantitative PCR；
4) quantitative primer
4.1) KDM6A, primer sequence is：
forward-TATTGGCCCAGGTGACTGTGAA
reverse-CAGATCTCCAGGTCGCTGAATAAAC
4.2) KDM6B, primer sequence is：
forward-GCTGGAGTGCTTGTTCCATGAG
reverse-GAAAGCCAATCATCACCCTTGTC
4.3) Gapdh, primer sequence is：
forward-AAAATGGTGAAGGTCGGTGTG
reverse-AATGAAGGGGTCGTTGATGG
5) experimental method
5.1) the lonely female activation of MII phases egg mother cell
Lonely female activation embryo collects time point such as Fig. 1,
5.2) siRNA microinjections
SiRNA-KDM6A, siRNA-KDM6B and siRNA- control group are diluted to respectively with the TE buffer solutions of nuclease free
Liquid after dilution, is slowly injected among the kytoplasm of egg mother cell by 40mM using micromanipulation arm by injection needle, note
Egg mother cell room temperature after penetrating is transferred to KSOM nutrient solutions after recovering 15min, is placed in 2h in 37 DEG C of incubators；
5.3) real-time quantitative PCR, advises according to quantitative specification, is tested；
5.4) immunofluorescence dyeing
5.4.1) embryo fixes：Embryo is put into the paraformaldehyde fixer that mass fraction is 4%, room temperature 60min or 4
Fixation is stayed overnight under the conditions of DEG C；
5.4.2 it is) penetrating：Embryo after fixation is cleaned one time with 1ml phosphate buffered salines, mass fraction is moved into
For 0.5% Triton X-100 solution room temperature treatment 15min；
5.4.3) close：Embryo is put into containing the Triton X-100 and mass fraction that mass fraction is 0.2%
30min is closed for room temperature in 1% bovine serum albumin solution；
5.4.4) antibody incubation：Embryo is moved into 37 DEG C of incubation 1h in the antibody crossed through diluted, dilution contains matter
The bovine serum albumin(BSA) that the polysorbas20 and mass fraction that amount fraction is 1% are 1%, is floated after incubation with phosphate buffered saline
Wash 3 times, each 5min, add the antibody-solutions of confining liquid dilution, confining liquid is containing the polyethylene glycol octyl group that mass fraction is 0.2%
Phenyl ether and the bovine serum albumin solution that mass fraction is 1%, room temperature lucifuge use phosphate buffered saline after being incubated 1h
Lucifuge is rinsed 3 times, each 5min；
5.4.5) DAPI dyeing：Embryo's room temperature lucifuge is dyed into 15min, 3 are rinsed with phosphate buffered saline lucifuge
It is secondary, each 5min；
5.4.6) mounting：The anti-quenching medium of drop of plus one moves into anti-essence on slide, by the embryo after dyeing and gone out in agent, covering
Mountant mounting after cover glass；
5.4.7) co-focusing imaging：Image is gathered using Nikon A1R Laser Scanning Confocal Microscopes；
5.5) living cells is imaged：Egg mother cell after microinjection siRNA, after lonely female activation 6h, is incubated at Nikon
Ti-E installs living cells imaging system additional, and uses 488nm laser scannings, is imaged by Nikon A1R camera scannings；
5.6) data statistics and analysis；
5.7) result：The dynamic change situation that H3K27me3 is modified in parthenogenetic embryo is as follows：
The dynamic change of H3K27me3 in mice embryonic thelykaryon is detected, lonely female activation is carried out to egg mother cell, according to Fig. 1's
Time point embryo collection, is detected in MII, 2- cell, 4- cells, 8- cells, mulberry body, blastaea and hatched blastocyst period respectively
H3K27me3 is modified, as a result as shown in Figure 2；There is H3K27me3 to modify in the egg mother cell in MII periods；Opened from 2- cells
Beginning H3K27me3 fluorescence signal starts to weaken；In 8- cells and mulberry body period, there is no H3K27me3 fluorescence signals；In blastaea rank
Cell in section, whole embryo is respectively provided with H3K27me3 modifications；After hatching, H3K27me3 fluorescence signals are only in inner cell
Exist at group, as shown in Figure 3；H3K27me3 modifications not only exist in each period all the time in embryo in polar body, and fluorescence signal
Intensity is higher than nucleus in embryo；
5.7.1) the dynamic change situation of demethylase KDM6A and KDM6B mRNA in preimplantation embryos
By quantitative fluorescent PCR (RT-qPCR) technology, with KDM6A and KDM6B in egg mother cell after stoning before detection stoning
MRNA changes of contents, as shown in Figure 4；KDM6A, KDM6B are primarily present in egg mother cell matter；Detected by RT-qPCR
KDM6A, KDM6B dynamic change in each period embryo before bed, after activation of oocytes, KDM6A, KDM6B immediately begin to degraded,
KDM6A mRNA is nearly no detectable in blastula stage, as shown in figure 5, and KDM6B in 8 cell stages close to minimum point, such as Fig. 6
It is shown；
5.7.2) KDM6A and dynamic changes of the KDM6B in preimplantation embryos
The position of KDM6A and KDM6B in each period embryo, KDM6A and KDM6B albumen are determined by immunofluorescence technique
Content is very high in MII egg mother cells, and the main integrated distributions of KDM6A, around spindle, KDM6B is uniformly distributed in whole
In individual MII periods egg mother cell, as shown in Figure 7；Detect that KDM6A fluorescence signals disappear in 8- cell stages, at the same time
H3K27me3 fluorescence signal can not be detected, as shown in Figure 8；And can detect in each period of embryonic development
KDM6B fluorescence signal, as shown in Figure 9；Being tested using immuning hybridization further confirms the result of immunofluorescence dyeing, each to collect
The egg mother cell in 1000 pieces of MII periods, KDM6A, KDM6B and H3K27me3 albumen table are detected using Western blot respectively
Up to amount, the result of immunofluorescence dyeing is consistent with the result of immunofluorescence, respectively in 154kDa (KDM6A), 180kDa (KDM6B)
There is the hybridising band cleaned with 55kDa (H3K27me3) position, as shown in Figure 10；In order to ensure the specificity of antibody, together
When immunofluorescence dyeing is carried out in fetal fibroblast, as depicted in figs. 11-12.
5.7.3) disclosing KDM6A and KDM6B by RNA perturbation techniques has functional compensation phenomenon
The function of demethylase is respectively provided with due to KDM6A and KDM6B and expression quantity is higher in egg mother cell, according to
This, thus it is speculated that KDM6A and KDM6B has functional compensation mechanism in early embryo development, and in order to verify that this is guessed, we design
And synthesized siRNA, targeting interference KDM6A and KDM6B；Because gene is frequently present of alternative splicing isomery in egg mother cell
Body, in order to prevent KDM6A and KDM6B from there is isomers, designs two kinds in KDM6A promoter downstream 585 and 1,518bp respectively
SiRNA, by two kinds of siRNA according to 1:1 mixing is referred to as KDM6A-siRNA；Similarly in the KDM6B He of promoter downstream 4,536
Two kinds of siRNA are separately designed at 4,749bp, KDM6B-siRNA is turned into after uniform mixing；At the same time, also having synthesized will not shadow
The control-siRNA for ringing any endogenous gene is used in control group, as illustrated in figs. 13-14；Control-siRNA gene
Sequence is as follows：
KDM6A-1
Sense：GGACUUGCAGCACGAAUUATT
Anti：UAAUUCGUGCUGCAAGUCCAG
KDM6A-2
Sense：CGCUGCUACGAAUCUCUAATT
Anti：UUAGAGAUUCGUAGCAGCGAA
KDM6B-1
Sense：CGUCCAAUAUUCCUGUUUATT
Anti：UAAACAGGAAUAUUGGACGCA
KDM6B-2
Sense：CCGUGCAGCUAUACAUGAATT
Anti：UUCAUGUAUAGCUGCACGGTG
MII phase egg mother cells are entered into siRNA microinjections, as shown in figure 15；In order to verify siRNA validity and special
Property, the expression quantity of KDM6A, KDM6B in egg mother cell after injection siRNA are detected by Real-time quantitative PCR, such as schemed
Shown in 16；Real-time quantitative PCR result shows, KDM6A-siRNA and KDM6B-siRNA jamming effectiveness more than 90%, and
And expression of the Control-siRNA to endogenous gene GAPDH has little to no effect；And to injecting siRNA 8- cells
Immunofluorescence test H3K27me3 modification situation is carried out with mulberry body period embryo, as shown in figs. 17-18；Immunofluorescence results
Absolutely prove, individually the either of which in interference KDM6A and KDM6B does not interfere with the modification of H3K27me3 in embryo, in 8-
Cell and mulberry body period disturb KDM6A, KDMB6 to make occur H3K27me3 fluorescence signal in nucleus simultaneously；Immediately
And to individually having injected KDM6A-siRNA embryo, KDM6B mRNA expressions are detected in development in different stages, use
After same method, detection injection KDM6B-siRNA, KDM6A mRNA expressions, as shown in Figure 19-20；Single-trunk disturbs result
Show, KDM6A and KDM6B has the transcription of any one gene in Replacement effect, i.e. both reductions in mRNA level in-site,
The transcription of another gene can be increased；Because in embryo stage, the mRNA expression of some genes and protein content are not
Synchronous, for ruled it out, collect respectively and inject control-siRNA, KDM6A-siRNA and KDM6B-
The embryo of 2- cell stages is each after siRNA, carries out immuning hybridization experiment, as shown in fig. 21-22；Western blot detect albumen
Result and Real time PCR detect that mRNA result is consistent, result above confirms KDM6A, KDM6B in mRNA and albumen
Level is respectively provided with functional compensation effect.
5.7.4) the influence of KDM6A, KDM6B to embryonic development
In order to study the effect of KDM6A and KDM6B in preimplantation embryos, respectively statistics injection KDM6A-siRNA and
Embryonic development situation after KDM6B-siRNA, statistical result shows that individually the cleavage rates of interference KDM6A and KDM6B embryos are respectively
97.7% and 98.6%, with the not notable (P of control group (98.0%) difference>0.05)；The double interference group spilting of an egg of KDM6A and KDM6B
Rate is substantially less than control group (89.2%vs.98.0%, P<0.05), in addition, individually the blastocyst rate of interference KDM6A groups is notable
Less than control group (52.7%vs.84.3%, P<0.05)；The blastocyst rate of the double interference groups of KDM6A and KDM6B is minimum in each group,
With control group difference extremely notable (31.0%vs.84.3%, P<0.01)；Meanwhile, inject the blastocyst rate of KDM6B-siRNA experimental groups
It is significantly higher than control group (95.1%vs.84.3%, P<0.05), as shown in figure 24；It has also been found that interference KDM6 can not only be improved
Blastocyst rate, further improves quality of blastocysts, as shown in figure 23；It is right in order to further verify that interference KDM6B can improve quality of blastocysts
The blastaea for injecting KDM6B-siRNA carries out DAPI nuclear targetings, as shown in figure 25；Cell in blastaea after statistics interference KDM6B
Several situations of change, as shown in figure 26；As a result show, the cell number in blastaea is significantly higher than control group in interference KDM6B groups
(140.7vs.116.3,P<0.01)。、
5.7.5) reduction KDM6B expression quantity is favorably improved Oct4-GFP expression
In order to further explore influences of the interference KDM6B to embryonic development, I is used with Oct4 promoter green fluorescences
The egg mother cell of protein transgenic mice, i.e. OG2- egg mother cells, Oct4 (POU5F1) be a kind of crucial reprogramming factor and
Pluripotency marker's molecule, is one of goldstandard of embryo quality identification, due to OG2 transgenic mices mainly in the expression of blastaea
It is a heterozygote, in order to prevent losing Oct4-GFP genes in meiosis process, ovum has been screened by nested PCR method female thin
The donor mice of born of the same parents, as shown in figure 27；By injecting the embryo after KDM6B-siRNA through 488nm laser scanning imagings, such as Figure 28
It is shown, in order to obtain dynamic Oct4-GFP expressions, the embryo for injecting KDM6B-siRNA and control-siRNA is entered
Row living cells time-lapse photography, as illustrated in figs. 29-30, copolymerization burnt and living cells result show, interference KDM6B expression, can be with
The fluorescence signal intensity of Oct4-GFP at inner cell mass is significantly improved, so as to illustrate that the quality of blastaea has been lifted.
The present invention operation principle be：The present invention is thin to mouse MII phases, 2- cells, 4- using immune prominent light detection method
H3K27me3 modifications are detected in born of the same parents, 8- cells, mulberry body, blastaea and hatched blastocyst, and KDM6A, KDM6B are existed again afterwards
The distribution situation in embryonic development each period is detected, as a result finds that H3K27me3 has dynamic change in preimplantation embryos
Change, H3K27me3 modification is not present in the embryo in 8- cells and mulberry body period.
Conventional research shows that H3K27me3 is a kind of apparent modification of inhibition of gene expression, after activation of oocytes,
H3K27me3 fluorescence signal intensity starts to weaken, thus it is speculated that this decrease is likely to relevant with zygotic gene group activation (ZGA)；This
When zygote changed by Disease in Infants regulation and control zygotropism regulation and control, it is desirable to have a large amount of new genetic transcriptions, immunofluorescence and exempt from
Epidemic disease Touch blot hybridization shows there is very strong H3K27me3 modifications in MII phases egg mother cell and hatched blastocyst in inner cell mass；
" differentiation degree is higher, and H3K27me3 expression is lower " is pointed out in research in stem cell, and this puts and in egg mother cell
Test result it is consistent；The result that H3K27me3 modifications are not present in 8- cells, morula stage is different from previous research, this
It is probably caused by the time point of embryo collection is different to plant difference.
KDM6A and KDMB6 are specificity can to remove H3K27me3 in vivo and methylate two kinds of enzymes of modification, current technology
In, KDM6A, KDM6B function were only studied in ox preimplantation embryos, was had not been reported in model animal mouse；This hair
Bright result shows that KDM6A, KDM6B expression quantity in oocyte of mouse are very high, and is examined in the embryo of 8- cell stages
KDM6A fluorescence signal is not detected, in addition, the present invention have also demonstrated only after double interference KDM6A, KDM6B, in 8- cells
With just occur in morula H3K27me3 modify so that prove in oocyte of mouse only have KDM6A, KDM6B both
Specific demethylase.
Tested and found by siRNA interference and western blot hybridization, no matter KDM6A and KDM6B is in mRNA level in-site or egg
The phenomenon of functional compensation is respectively provided with white matter level, i.e. one of reduction, another rises therewith；When egg mother cell injection
After KDM6B-siRNA, embryonic blastula rate and embryo quality are all significantly better than control group；Moreover, the drop of KDM6B expression quantity
It is low, contribute to Oct4-GFP expression, this illustrates that KDM6B has unfavorable work for the development of preimplantation embryos from another point of view
With；It is noted that, KDM6A expression quantity can rise after interference KDM6B, blastocyst rate and embryo quality
Whether relevant with KDM6A expression quantity up-regulations improve, also need further research.
The better embodiment to this patent is explained in detail above, but this patent is not limited to above-mentioned embodiment party
, can also be on the premise of this patent objective not be departed from formula, the knowledge that one skilled in the relevant art possesses
Make a variety of changes.
Claims (5)
1. a kind of application processes of the H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo, its feature
It is, comprises the following steps：
1) preparing experiment animal：
The donor mice (OG2) of egg mother cell when being imaged using Oct4 promoters-green fluorescent transgenic mouse as living cells；
2) MII period egg mother cells are collected：
3) preparing experiment reagent：
3.1) embryo medium：
3.2) immunofluorescence and the related main agents of Western blotting：
4% paraformaldehyde liquid, Triton X-100, phosphate buffered saline, polysorbas20, DAPI dyestuffs, antibody
Oct4, antibody Nanog, antibody SSEA1, antibody Sox2, antibody H3K27me3, antibody KDM6A, antibody KDM6B, RNA extract examination
Agent box, real-time fluorescence quantitative PCR；
4) quantitative primer
4.1) KDM6A, primer sequence is：
forward-TATTGGCCCAGGTGACTGTGAA
reverse-CAGATCTCCAGGTCGCTGAATAAAC
4.2) KDM6B, primer sequence is：
forward-GCTGGAGTGCTTGTTCCATGAG
reverse-GAAAGCCAATCATCACCCTTGTC
4.3) Gapdh, primer sequence is：
forward-AAAATGGTGAAGGTCGGTGTG
reverse-AATGAAGGGGTCGTTGATGG
5) experimental method
5.1) the lonely female activation of MII phases egg mother cell
5.2) siRNA microinjections
SiRNA-KDM6A, siRNA-KDM6B and siRNA- control group are diluted to respectively with the TE buffer solutions of nuclease free
Liquid after dilution, is slowly injected among the kytoplasm of egg mother cell by 40mM using micromanipulation arm by injection needle, note
Egg mother cell room temperature after penetrating is transferred to KSOM nutrient solutions after recovering 15min, is placed in 2h in 37 DEG C of incubators；
5.3) real-time quantitative PCR, advises according to quantitative specification, is tested；
5.4) immunofluorescence dyeing
5.4.1) embryo fixes：Embryo is put into the paraformaldehyde fixer that mass fraction is 4%, room temperature 60min or 4 DEG C of bars
Fixation is stayed overnight under part；
5.4.2 it is) penetrating：Embryo after fixation is cleaned one time with 1ml phosphate buffered salines, moving into mass fraction is
0.5% Triton X-100 solution room temperature treatment 15min；
5.4.3) close：It is 1% that embryo is put into containing mass fraction into the Triton X-100 and mass fraction that are 0.2%
Bovine serum albumin solution in room temperature closing 30min；
5.4.4) antibody incubation：Embryo is moved into 37 DEG C of incubation 1h in the antibody crossed through diluted, dilution is containing quality point
The bovine serum albumin(BSA) that the polysorbas20 and mass fraction that number is 1% are 1%, 3 are rinsed after incubation with phosphate buffered saline
Secondary, each 5min adds the antibody-solutions of confining liquid dilution, confining liquid is containing the polyethylene glycol octyl group benzene that mass fraction is 0.2%
Base ether and the bovine serum albumin solution that mass fraction is 1%, room temperature lucifuge are kept away after being incubated 1h with phosphate buffered saline
Light is rinsed 3 times, each 5min；
5.4.5) DAPI dyeing：By embryo's room temperature lucifuge dye 15min, with phosphate buffered saline lucifuge rinse 3 times, often
Secondary 5min；
5.4.6) mounting：The anti-quenching medium of drop of plus one moves into anti-essence on slide, by the embryo after dyeing and gone out in agent, covers lid glass
Mountant mounting after piece；
5.4.7) co-focusing imaging：Image is gathered using Nikon A1R Laser Scanning Confocal Microscopes；
5.5) living cells is imaged：Egg mother cell after microinjection siRNA, after lonely female activation 6h, is incubated at Nikon Ti-E
Install living cells imaging system additional, and use 488nm laser scannings, be imaged by Nikon A1R camera scannings；
5.6) data statistics and analysis.
2. H3K27me3 according to claim 1 and its demethylase KDM6A/B is in mouse nuclear transfer reconstructed embryo
Application process, it is characterised in that in the step 1, the mouse is purchased from University of the Inner Mongol's Animal Experimental Study center, donor mouse
Raise in SPF grades of 22~24 DEG C of Animal Houses, relative humidity 50~60%, Animal House light application time is early 8 points to late 8 points daily.
3. H3K27me3 according to claim 1 and its demethylase KDM6A/B is in mouse nuclear transfer reconstructed embryo
Application process, it is characterised in that in the step 3.1, the compound method of embryo medium is：
1) the dense liquid storages of HCZB：500mL；Constituent is：Ultra-pure water 495ml, sodium chloride 2380mg, potassium chloride 180mg, 7 water sulphur
Sour magnesium 145mg, disodium ethylene diamine tetraacetate 20mg, sodium lactate 2.65mL, glucose 500mg, potassium dihydrogen phosphate 80mg；
2) the dense liquid storages of 10ml calcium chloride 100X：It is formulated by 0.2g calcium chloride dihydrates and 10ml ultra-pure waters；
3) the dense liquid storages of 10ml strontium chlorides 100X：It is formulated by the water strontium chlorides of 2.666g six and 10ml ultra-pure waters；
4) the dense liquid storages of 20ml glutamine 100X：It is formulated by 0.294g glutamine and 20ml without calcium CZB solution；
5) cytochalasin B solution：By cytochalasin B with 1mg/ml proportioning be dissolved in dimethyl sulphoxide solution prepare and
Into；
6) polyvinylpyrrolidonesolution solution：
Mass fraction is 10% PVP solution：It is formulated by 1g PVP and 10ml HCZB；
Mass fraction is 3% PVP solution：It is formulated by 0.3g PVP and 10ml HCZB；
7) hyaluronidase solution：It is formulated by 20ml M2 nutrient solutions and 100mg hyaluronidases.
4. H3K27me3 according to claim 1 and its demethylase KDM6A/B is in mouse nuclear transfer reconstructed embryo
Application process, it is characterised in that in the step 5.2, the compound method of KSOM nutrient solutions is：Per 100mLKSOM-AA embryos training
0.38mg containing disodium EDTA in nutrient solution, sodium chloride 559.5mg, potassium chloride 18.5mg, potassium dihydrogen phosphate 4.75mg,
7 water magnesium sulfate 4.95mg, lactylate salt solution 0.174ml, glucose 3.60mg, sodium acid carbonate 210.0mg, glutamine
14.5mg, Sodium Pyruvate 2.2mg, dual anti-1 6.3mg, dual anti-2 5.0mg, essential amino acid 1.0ml, nonessential amino acid
0.5ml；Wherein disodium EDTA is preferentially added dropwise, and 100mg bovine serum albumin(BSA)s are added into 100mLKSOM-AA embryos
In tire nutrient solution, gently mixing makes bovine serum albumin(BSA) slow mechanism dissolved, should not be aggressively shaken liquid and be led with avoiding generation foam
Cause protein denaturation；With in 0.22 μm of syringe filter nutrient solution to sterile plastic tube, solution is stored in 4 DEG C, guarantor
Deposit the time 1~2 week.
5. H3K27me3 according to claim 1 and its demethylase KDM6A/B is in mouse nuclear transfer reconstructed embryo
Application process, it is characterised in that in the step 5.6, data statistics is with analysis method using SPSS10.0 statistics softwares point
Analysis is handled, P<0.05 is significant difference, P<0.01 is that difference is extremely notable.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710439507.0A CN107299113A (en) | 2017-06-12 | 2017-06-12 | Application processes of the H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710439507.0A CN107299113A (en) | 2017-06-12 | 2017-06-12 | Application processes of the H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107299113A true CN107299113A (en) | 2017-10-27 |
Family
ID=60134766
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710439507.0A Pending CN107299113A (en) | 2017-06-12 | 2017-06-12 | Application processes of the H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107299113A (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858377A (en) * | 2017-11-10 | 2018-03-30 | 黑龙江省农业科学院畜牧研究所 | The method for improving the complete silence embryo target gene of microinjection siRNA |
| CN109609583A (en) * | 2018-12-04 | 2019-04-12 | 北京农学院 | Embryo's colouring method, the method and kit for judging Embryo viability |
| CN110042123A (en) * | 2019-01-07 | 2019-07-23 | 西北农林科技大学 | A method of bovine somatic cells cloning efficiency is improved by inducing expression zfp57 |
| CN110499293A (en) * | 2019-07-23 | 2019-11-26 | 张文胜 | Method for improving multipotential stem cell reprogramming efficiency |
| WO2020018106A1 (en) * | 2018-07-19 | 2020-01-23 | Children's Medical Center Corporation | Compositions and methods for generating physiological x chromosome inactivation |
| CN112048467A (en) * | 2020-09-11 | 2020-12-08 | 江苏集萃药康生物科技有限公司 | Application of KSOM-AA culture solution in-vitro culture of NOD (non-specific oligonucleotide) background mouse embryos |
| CN113288964A (en) * | 2021-05-25 | 2021-08-24 | 吉林医药学院 | Application of novel kidney-warming and sperm-producing drink as medicine for reducing expression level of H3K27me3 |
| US11390885B2 (en) | 2014-09-15 | 2022-07-19 | Children's Medical Center Corporation | Methods and compositions to increase somatic cell nuclear transfer (SCNT) efficiency by removing histone H3-lysine trimethylation |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009114011A1 (en) * | 2008-03-11 | 2009-09-17 | President And Fellows Of Harvard College | Histone demethylation proteins and methods of use thereof |
| CN102344907A (en) * | 2010-07-29 | 2012-02-08 | 内蒙古大学 | Method for activating reconstructed embryo |
| WO2016044271A2 (en) * | 2014-09-15 | 2016-03-24 | Children's Medical Center Corporation | Methods and compositions to increase somatic cell nuclear transfer (scnt) efficiency by removing histone h3-lysine trimethylation |
| WO2017062706A1 (en) * | 2015-10-09 | 2017-04-13 | Children's Medical Center Corporation | Methods and compositions to increase human somatic cell nuclear transfer (scnt) efficiency by removing histone h3-lysine trimethylation, and derivation of human nt-esc |
| CN106608869A (en) * | 2015-10-27 | 2017-05-03 | 中国科学院上海药物研究所 | Histone demethylase JMJD3 inhibitor, preparation method and application thereof |
-
2017
- 2017-06-12 CN CN201710439507.0A patent/CN107299113A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009114011A1 (en) * | 2008-03-11 | 2009-09-17 | President And Fellows Of Harvard College | Histone demethylation proteins and methods of use thereof |
| CN102344907A (en) * | 2010-07-29 | 2012-02-08 | 内蒙古大学 | Method for activating reconstructed embryo |
| WO2016044271A2 (en) * | 2014-09-15 | 2016-03-24 | Children's Medical Center Corporation | Methods and compositions to increase somatic cell nuclear transfer (scnt) efficiency by removing histone h3-lysine trimethylation |
| WO2017062706A1 (en) * | 2015-10-09 | 2017-04-13 | Children's Medical Center Corporation | Methods and compositions to increase human somatic cell nuclear transfer (scnt) efficiency by removing histone h3-lysine trimethylation, and derivation of human nt-esc |
| CN106608869A (en) * | 2015-10-27 | 2017-05-03 | 中国科学院上海药物研究所 | Histone demethylase JMJD3 inhibitor, preparation method and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| KRUIDENIER L 等: "A selective jumonji H3K27 demethylase inhibitor modulates the proinflammatory macrophage response", 《NUTURE》 * |
| YANG LEI 等: "The Maternal Effect Genes UTX and JMJD3 Play Contrasting Roles in Mus musculus Preimplantation Embryo Development", 《SCIENTIFIC REPORTS》 * |
| 冯欢 等: "H3 K27 me3去甲基化酶Jmjd3调节胎鼠肺上皮细胞增殖和分化", 《基础医学与临床》 * |
| 宋丽爽: "H3K27me3去甲基化酶UTX、JMJD3在小鼠孤雌胚胎中的表达模式", 《中国优秀硕士学位论文全文数据库(电子期刊)基础科学辑》 * |
| 杨磊: "H3K27me3及其去甲基化酶KDM6A/B在小鼠核移植重构胚中的作用", 《中国博士学位论文全文数据库(电子期刊)基础科学辑》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11390885B2 (en) | 2014-09-15 | 2022-07-19 | Children's Medical Center Corporation | Methods and compositions to increase somatic cell nuclear transfer (SCNT) efficiency by removing histone H3-lysine trimethylation |
| CN107858377A (en) * | 2017-11-10 | 2018-03-30 | 黑龙江省农业科学院畜牧研究所 | The method for improving the complete silence embryo target gene of microinjection siRNA |
| WO2020018106A1 (en) * | 2018-07-19 | 2020-01-23 | Children's Medical Center Corporation | Compositions and methods for generating physiological x chromosome inactivation |
| CN113316457A (en) * | 2018-07-19 | 2021-08-27 | 儿童医疗中心有限公司 | Compositions and methods for generating physiological X chromosome inactivation |
| CN109609583A (en) * | 2018-12-04 | 2019-04-12 | 北京农学院 | Embryo's colouring method, the method and kit for judging Embryo viability |
| CN110042123A (en) * | 2019-01-07 | 2019-07-23 | 西北农林科技大学 | A method of bovine somatic cells cloning efficiency is improved by inducing expression zfp57 |
| CN110499293A (en) * | 2019-07-23 | 2019-11-26 | 张文胜 | Method for improving multipotential stem cell reprogramming efficiency |
| CN112048467A (en) * | 2020-09-11 | 2020-12-08 | 江苏集萃药康生物科技有限公司 | Application of KSOM-AA culture solution in-vitro culture of NOD (non-specific oligonucleotide) background mouse embryos |
| CN113288964A (en) * | 2021-05-25 | 2021-08-24 | 吉林医药学院 | Application of novel kidney-warming and sperm-producing drink as medicine for reducing expression level of H3K27me3 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107299113A (en) | Application processes of the H3K27me3 and its demethylase KDM6A/B in mouse nuclear transfer reconstructed embryo | |
| Vodička et al. | The miniature pig as an animal model in biomedical research | |
| CN104531704B (en) | Utilize the method for CRISPR-Cas9 system knock-out animal FGF5 gene | |
| JP2022095796A (en) | Cell-based treatment and drug discovery in hirschsprung's disease enabled by pluripotent stem cell-derived human enteric neural crest lineages | |
| Nagashima et al. | Growing human organs in pigs—A dream or reality? | |
| US20090252711A1 (en) | Stem Cells And Methods Of Making And Using Stem Cells | |
| CN102250830B (en) | In-vitro separating and culturing method for germline stem cell | |
| CN103952368B (en) | A kind of culture fluid promoting porcine somatic cell cloning embryos vitro Development of Embryos | |
| Han et al. | Overexpression of Tet3 in donor cells enhances goat somatic cell nuclear transfer efficiency | |
| CN107227298A (en) | A kind of clone embryos treatment fluid and its application method and the purposes of the treatment fluid | |
| Dua et al. | Cryobanking of primary somatic cells of elite farm animals-A pilot study in domesticated water buffalo (Bubalus bubalis) | |
| CN107937445A (en) | The method that gene knockout dog is prepared using somatic cell clone technique | |
| Okumura et al. | Contribution of rat embryonic stem cells to xenogeneic chimeras in blastocyst or 8‐cell embryo injection and aggregation | |
| CN106399248A (en) | Method for inducing transdifferentiation of fibroblasts to nerve cells | |
| CN103074297B (en) | Livestock spermatogonial stem cell medium | |
| CN103305459A (en) | Method for conversion of porcine spermatogonia stem cell into embryonic stem cell-like cell by small molecule induction | |
| Gurdon | The egg and the nucleus: a battle for supremacy (Nobel Lecture). | |
| CN114276984B (en) | Method for transdifferentiating female germ stem cells into functional sperm and application | |
| Zhang et al. | Generation of mouse–human chimeric embryos | |
| CN101956003A (en) | Method for detecting exogenous gene integration sites in pig genome | |
| Eun et al. | SV40 large T antigen disrupts embryogenesis of canine and porcine somatic cell nuclear transfer embryo | |
| Burgess | Stem cells: a short course | |
| CN108624621B (en) | The preparation method of the somatic cell clone animal of non-human primates | |
| Miyamoto | Various nuclear reprogramming systems using egg and oocyte materials | |
| CN112226404B (en) | Culture medium composition and culture method for promoting animal embryo in-vitro development |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171027 |