CN110036021B - Compounds and methods for targeting molecules to specific cellular locations - Google Patents

Compounds and methods for targeting molecules to specific cellular locations Download PDF

Info

Publication number
CN110036021B
CN110036021B CN201780065902.5A CN201780065902A CN110036021B CN 110036021 B CN110036021 B CN 110036021B CN 201780065902 A CN201780065902 A CN 201780065902A CN 110036021 B CN110036021 B CN 110036021B
Authority
CN
China
Prior art keywords
cell
vire2
asp
arg
ser
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201780065902.5A
Other languages
Chinese (zh)
Other versions
CN110036021A (en
Inventor
潘申权
李晓阳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National University of Singapore
Original Assignee
National University of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University of Singapore filed Critical National University of Singapore
Publication of CN110036021A publication Critical patent/CN110036021A/en
Application granted granted Critical
Publication of CN110036021B publication Critical patent/CN110036021B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes

Abstract

The present invention relates to a peptide comprising the following components: (i) SEQ ID NO:1 or (ii) has an amino acid sequence identical to SEQ ID NO:1 with at least 80% sequence identity. The invention also relates to conjugates, host cells, bioimaging systems, methods of visualizing the internalization process, methods of internalizing a drug into a cell, and the use of a conjugate of the invention as a drug or as a research agent.

Description

Compounds and methods for targeting molecules to specific cellular locations
Technical Field
The present invention relates to a peptide comprising or consisting of: (i) SEQ ID NO:1 or (ii) has an amino acid sequence identical to SEQ ID NO:1 has an amino acid sequence of at least 80% amino acid sequences of sequence identity. The invention also relates to conjugates, host cells, bioimaging systems, methods of visualizing the internalization process, methods of internalizing drugs into cells, and the use of the conjugates of the invention as pharmaceuticals or research reagents.
Background
Agrobacterium tumefaciens (A. Tumefaciens) causes crown gall tumors on various plants by transferring tumorigenic T-DNA into plant cells (1-3). Under laboratory conditions, the bacteria can transfer T-DNA to other eukaryotic species, including yeast (4, 5), fungi (6), algae (7), and cultured human cells (8). It has been developed as a DNA delivery vector that is widely used as a master for genetic engineering of plants (9) and non-plant organisms (10).
During Agrobacterium (Agrobacterium) mediated transformation (AMT), agrobacterium tumefaciens delivers T-DNA and bacterial virulence proteins into host cells via a bacterial type IV secretion system (T4 SS) consisting of VirB/VirD4 (11, 12). Agrobacterium VirBA/VirD4T4SS is a typical of the T4SS family, and is widely used by bacteria to translocate DNA (13, 14) and protein macromolecules (15) to a variety of bacteria and eukaryotic cells (16). The agrobacterium T4SS device consists of 12 bacterial virulence proteins, including VirB1-11 and VirD4, which form a multi-subunit transmembrane channel (17) that delivers macromolecules into host cells.
Agrobacterium T4SS delivers at least 5 protein substrates into a host cell; these include VirD2, virD5, virE2, virE3 and VirF (18-20). Evidence suggests that these bacterial effectors rely on their C-terminal positive electrical signal for export into the host cell (19). Upon delivery, these effector proteins act synergistically within the host cell and facilitate the transformation process. Host factors have been shown to interact with these effectors and are critical for successful transformation (21).
T-DNA is produced as single-stranded (ss) DNA molecules from the Ti plasmid by the VirD2 protein which functions as an endonuclease in bacterial cells (22-24). VirD2 remains covalently associated with the 5' end of the T-DNA and is introduced into the host cell in this manner via T4SS (23). Within the host cytoplasm, naked T-DNA is subsequently coated by T4 SS-delivered VirE2, which is a ssDNA binding protein, forming a T complex (25-27). Both VirD2 and VirE2 contain functional Nuclear Localization Signal (NLS) sequences (28) that interact with the host input protein alpha protein. They may act synergistically for nuclear import of T complexes in host cells.
VirE2, an abundant effector protein secreted into recipient cells, is also crucial for many other processes during the transformation process. In vitro studies have shown that VirE2 forms voltage-gated and ssDNA-specific channels on artificial membranes, suggesting that it may promote T-DNA entry into host cells (29). VirE2 protects T-DNA from nucleolytic degradation (30,31) since it binds to the T-strand in a cooperative manner within the host cytoplasm. As a major component of the T complex, virE2 transport affects the fate of the T chain.
VirE2 has been shown to be involved in nuclear targeting of T-DNA in two different ways. First, two independent NLS sequences have been identified in the VirE2 molecule that are involved in direct interactions with the a-isomer of the Arabidopsis thaliana (Arabidopsis) import protein (28). Second, virE2 can also interact with the plant transcription factor VIP1 (32); this host protein undergoes MAPK3 mediated phosphorylation and nuclear translocation induced by agrobacterium infection, which may lead to nuclear import of VirE2 and thus of the T chain (33, 34).
Within the host cell nucleus, VIP1 may interact with host histones, which may facilitate targeting of the T complex to host chromatin (34). Furthermore, virE2 can interact with another host protein, VIP2, a putative transcriptional repressor, located in plant nuclei (35). The need for VIP2 for stable transformation suggests that the interaction between VirE2 and VIP2 may promote T-chain integration into the host genome (35).
Thus, targeting molecules or drugs to specific locations within cells is important and challenging in the fields of drug development and life sciences. There is a continuing need for techniques that facilitate the introduction of molecules or drugs into cells through the plasma membrane of the cell and to the specific desired location.
Drawings
The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings.
FIG. 1 shows the association of Agrobacterium-delivered VirE2 with host plasma membrane and endocytic vacuole. (A) VirE2 was detected in Nicotiana benthamiana (N.benthamiana) cells at various time intervals. Agrobacterium tumefaciens EHA105virE 2:GFP11 was infiltrated into transgenic Nicotiana sempervirens (Nb 308A) leaves expressing GFP1-10 and DsRed. Projected Z series images were obtained 32 and 48 hours after agroinfiltration. (B) VirE2 accumulates at the cytoplasmic side of tobacco cells that are in contact with agrobacterium tumefaciens cells. Agrobacterium tumefaciens strain EHA105virE2:: GFP11 (pGFP 1-10 and pVBA-RFP), which is also capable of delivering VirE2-GFP11 and T-DNA expressing GFP1-10, was infiltrated with DsRed into wild-type Nicotiana benthamiana leaves. Images were obtained 2 days after agroinfiltration. (C) Agrobacterium-delivered VirE2 accumulates at the host plasma membrane. Wild type Nicotiana benthamiana leaves were infiltrated with a uniform mix of Agrobacterium tumefaciens strain EHA105virE2:: GFP11 (pGFP 1-10), which was capable of delivering VirE2-GFP11 and T-DNA expressing GFP1-10, and EHA105virE2:: GFP11 (PM-rb), which was capable of delivering VirE2-GFP11 and T-DNA expressing Plasma Membrane (PM) tracer. Images were obtained 2 days after agroinfiltration. (D) Co-localization of Agrobacterium-delivered VirE2 in tobacco epidermal cells with FM 4-64-labeled plasma membrane (top panel) or endocytic vacuole (bottom panel). Wild type Nicotiana benthamiana leaves were infiltrated with Agrobacterium tumefaciens strain EHA105virE2:: GFP11 (pGFP 1-10) and then stained with FM 4-64. Images were obtained 2 days after agroinfiltration. Scale bar, 10 μm.
FIG. 2 shows that Agrobacterium accumulates in the intercellular spaces of the infiltrated leaf epidermal cells. (A) Projected Z series of leaves of Nicotiana benthamiana (Nb 308A) infiltrated with GFP-labeled Agrobacterium tumefaciens cells EHA105 (pVB-GFP). Images were obtained 2 days after agrobacteria infiltration under a confocal microscope with an orinbas UAPO N340 x n.a.1.15 water immersion objective. White lines were added to the image, indicating the boundaries between leaf epidermal cells. (B) Projected Z series of wild type Nicotiana benthamiana leaves infiltrated with a homogeneous mixture of GFP-labeled Agrobacterium tumefaciens cells EHA105 (pVB-GFP) and DsRed-labeled Agrobacterium tumefaciens cells EHA105 (pVB-RFP). Scale bar, 20 μm.
FIG. 3 shows the co-migration of VirE2 with FM4-64 labeled endocytic vacuoles in Nicotiana benthamiana epidermal cells. Wild type Nicotiana benthamiana leaves were infiltrated with Agrobacterium tumefaciens cells EHA105virE2:: GFP11 (pGFP 1-10) and then stained with FM 4-64. Images were obtained 2 days after agroinfiltration. Scale bar, 20 μm.
Figure 4 shows that interference with host endocytosis impairs VirE2 trafficking and attenuates its virulence. (A) The expression of the defective clathrin Hub impairs the departure of VirE2 from the plasma membrane. Leaves of Nicotiana benthamiana (Nb 308A) were infiltrated with Agrobacterium tumefaciens strains EHA105virE2:: GFP11 (pXY 01) or EHA105virE2:: GFP11 (pXY 01-Hub), which was capable of delivering VirE2-GFP11 and T-DNA expressing Hub. Projected Z series images were obtained 4 days after agroinfiltration. Scale bar, 20 μm. (B) VirE2-GFP remaining at the host cell boundary was measured in each image Composite material Intensity of signal, n: the number of images measured. (C) ES1 treatment reduced nuclear accumulation of VirE2 in plant epidermal cells. GFP11 alone or in combination with ES1 was infiltrated into Nicotiana benthamiana (Nb 308A) leaves with EHA105virE 2:. The frame-shaped area is enlarged to highlight the nuclei. Projected Z series images were obtained 2 days after Agrobacterium infiltration. Scale bar, 20 μm. (D) Measurement of VirE2-GFP in each host cell nucleus Composite material Intensity of signal, n: the number of nuclei measured. (E) ES1 or tyrphostin A23 treatment attenuated tumorigenesis in Arabidopsis roots. Chemically treated Arabidopsis roots were co-cultured with Agrobacterium strain A348 for tumorigenesis. (F) quantification of tumor formation frequency. * P is<0.01 (unpaired T-test).
FIG. 5 shows that expression of Hub impairs FM4-64 uptake in the epidermal cells of Nicotiana benthamiana. (A) Wild type Nicotiana benthamiana leaves were infiltrated with Agrobacterium tumefaciens cells EHA105 (pXY 01) or EHA105 (pXY 01-Hub), followed by FM4-64 staining on day 2 or day 4 after Agrobacterium infiltration. 5 hours after staining, projected Z series images were obtained under a confocal microscope with an Olympus UAPO N34040 XN.A.1.15 water immersion objective. Scale bar, 20 μm. (B) quantification of FM4-64 uptake. The number of FM4-64 stained endocytic vacuoles was calculated in each image (n = 20). * P <0.01 (unpaired T-test).
FIG. 6 shows that expression of dominant negative clathrin Hub impairs VirE2 departure from the plasma membrane in Nicotiana benthamiana epidermal cells. (A) Wild type Nicotiana benthamiana leaves were infiltrated with Agrobacterium tumefaciens cells EHA105virE 2:GFP11 (pXY 01). (B) Wild type Nicotiana benthamiana leaves were infiltrated with Agrobacterium tumefaciens cells EHA105virE 2:GFP11 (pXY 01-Hub). The projected Z-series images are displayed. Scale bar, 20 μm.
Figure 7 shows that ES1 treatment affects early endosome and VirE2 trafficking. (A) ES1 treatment resulted in the accumulation of SYP 61-containing endosomes in epidermal cells of the leaf of Nicotiana benthamiana. Wild type N.benthamiana leaves were infiltrated with Agrobacterium tumefaciens cells EHA105 (pXY 01-SYP 61-mC) alone or mixed with ES1 (25. Mu.M). In a control, transiently expressed SYP61-mCherry labeled circular early endosomes in the present Nicotiana tabacum epidermal cells. ES1 treatment induced aggregation of endosomes containing SYP61 (indicated by arrows). (B) Accumulation of an endosome containing SYP61 limited VirE2 trafficking in the present nicotiana tabacum epidermal cells. The wild type Nicotiana benthamiana leaves were infiltrated with a homogeneous mixture of Agrobacterium tumefaciens cells EHA105virE2:: GFP11 (pGFP 1-10) and EHA105virE2:: GFP11 (pXY 01-SYP 61-mC) together with the chemoeffector ES 1. Projected Z series images were obtained on day 2 after agroinfiltration. Scale bar, 20 μm.
Figure 8 shows that mutations at the VirE2 endocytosis motif affect VirE2 internalization and impair agrobacterium-mediated transformation. (A) Schematic positions of the VirE2 putative endocytic motif were identified by eukaryotic linear motif resources at functional sites in the protein (www.ELM.eu.org). The invariant amino acids of the endocytic motif are marked in red. (B) Mutations at the double endocytic motif at the C-terminus of VirE2 affect the internalization of VirE2 into the host cell. Leaves of Nicotiana benthamiana (Nb 308A) were infiltrated with Agrobacterium tumefaciens EHA105virE 2:GFP11 or a mutant strain containing alanine in place of the corresponding tyrosine. Projected Z series images were obtained on day 2 after Agrobacterium infiltration. Scale bar, 20 μm. (C) The percentage of VirE2 that stayed at the cell boundary was expressed as VirE2-GFP associated with the host cell boundary Composite material Divided by the total intensity in each image, n: measured byThe number of images. (D) Mutations at the double endocytic motif at the C-terminus of VirE2 reduced the transient transformation efficiency. Wild type Nicotiana benthamiana leaves were infiltrated with Agrobacterium tumefaciens EHA105 or mutant strains containing the binary vector pQH121-mC (CaMV 35S promoter controls free mCherry in T-DNA). Projected Z series images were obtained 2 days after agroinfiltration under confocal microscope with olympl SAPO N10 × n.a.0.40 objective. The individual optical portions of the bright field are shown to indicate cell shape (lower panel). Scale bar, 50 μm. (E) The intensity of the transiently expressed mCherry was measured in each image, n: the number of images measured. (F) Mutations at the double endocytic motif at the C-terminus of VirE2 reduced stable transformation efficiency. Agrobacterium tumefaciens A348 and mutant strains were used for the determination of neoplasia. (G) quantification of tumor formation frequency. * p is a radical of<0.05，**p<0.01 (unpaired T-test).
Figure 9 shows that mutations at other putative VirE2 endocytosis sorting motifs do not affect VirE2 internalization in host cells. Leaves of Nicotiana benthamiana (Nb 308A) were infiltrated with Agrobacterium tumefaciens EHA105virE2:: GFP11 or VirE2 mutants in which the corresponding tyrosine or leucine residue was replaced by alanine. Projected Z series images were obtained 2 days after Agrobacterium infiltration. Scale bar, 20 μm.
Figure 10 shows the sequence alignment analysis of VirE2 from different types of Ti plasmids. Sequence alignment showed that the endocytic motif of the double tyrosine group is conserved at the C-terminus on VirE2 proteins from different types of Ti plasmids.
Figure 11 shows that the endocytic motif at the C-terminus of VirE2 interacts with plant AP2M and that the AP2M mutation reduces tumorigenesis. (A) the VirE 2C-terminal tail interacts with AP 2M. The VirE 2C-terminal tail fused to GST (GST-VirE 2C) was used to perform in vitro pull-down assays, with the AP2M cargo (cargo) binding domain fused to MBP (MBP-AP 2 MC). The pull-down (top panel) and 20% input (bottom panel) fractions were analyzed by western blot. Free MBP and MBP-AP2MC fusion proteins plus asterisks. (B) Double mutations at the double endocytic motif abolished the interaction between the VirE 2C-terminal tail and the AP2M cargo binding domain. The pull-down (top panel) and 20% input (bottom panel) fractions were analyzed by western blot. Fusion of MBP-AP2MC plus asterisk. (C) Arabidopsis ap2m-1 and ap2m-2 mutations attenuated tumorigenesis in root transformation experiments. (D) quantification of tumor formation frequency. * P <0.01 (unpaired T-test). PD: pulling down; IB: and (4) performing immunoblotting.
Detailed Description
It is an object of the present invention to meet the above-described need by providing compounds and methods for targeting molecules to specific cellular locations. Surprisingly, the inventors found that the internalization of VirE2 is mediated by SEQ ID NO:1, or a specific sequence motif. Conjugation of the motif to other molecular groups (e.g., drugs) will mediate internalization of the conjugate. Furthermore, this motif allows for the establishment of methods to visualize internalization and internalize drugs into cells.
In a first aspect, the present invention therefore relates to a peptide comprising or consisting of: (i) SEQ ID NO:1 or (ii) has an amino acid sequence identical to SEQ ID NO:1 has an amino acid sequence of at least 80% amino acid sequences of sequence identity.
In various embodiments of the invention, the peptide is 10 to 200 amino acids in length. In alternative embodiments, the peptide of the invention consists of no more than 500 amino acids, no more than 450 amino acids, no more than 400 amino acids, no more than 350 amino acids, no more than 300 amino acids, no more than 250 amino acids, no more than 200 amino acids, no more than 150 amino acids, no more than 100 amino acids, no more than 80 amino acids, no more than 50 amino acids, or no more than 30 amino acids. In other embodiments, the peptide is 10 to 100 amino acids in length, 15 to 130 amino acids in length, 20 to 170 amino acids in length, or 30 to 210 amino acids in length.
The scope of the present invention also includes embodiments wherein the amino acid sequence has an amino acid sequence identical to SEQ ID NO:1, at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, at least 97%, or at least 99%.
In another aspect, the invention relates to a conjugate comprising a peptide of the invention, wherein the peptide further comprises at least one functional moiety.
In various embodiments of the invention, the at least one functional moiety is conjugated to the N-terminus of the peptide.
Also included within the scope of the invention are various embodiments wherein the at least one functional moiety is conjugated to the C-terminus of the peptide.
In various embodiments of the above aspects, the at least one functional moiety does not comprise SEQ ID NO:2 or a C-terminal fragment thereof.
In another aspect, the invention relates to a conjugate of the invention, with the proviso that the at least one functional moiety does not comprise the amino acid sequence of SEQ ID NO:3 or an N-terminal fragment thereof.
In various embodiments of the invention, wherein the functional moiety is a pharmaceutically or biologically active compound.
The scope of the present invention also includes various embodiments wherein the functional moiety further comprises or is Green Fluorescent Protein (GFP) or a fragment thereof.
In various embodiments of the invention, the conjugate further comprises at least one moiety for translocation into a cell. In a more preferred embodiment, the moiety for translocation into a cell is the C-terminal sequence of VirE2. In an even more preferred embodiment, the moiety for translocation into a cell comprises R-X (7) -R-X-R-X-R-X-X sequence or from R-X (7) -R-X-R-X-R-X-X, wherein X is any proteinogenic amino acid and R is arginine. In further preferred embodiments, the moiety for translocation into a cell is a cell penetrating peptide or agent.
In a third aspect, the present invention relates to a vector comprising a nucleotide sequence encoding a peptide of the present invention.
In another aspect, the invention relates to a host cell comprising the vector of the invention.
In a fifth aspect, the present invention relates to a biological imaging system for visualizing internalization comprising (a) a conjugate of the invention conjugated to a first GFP fragment; and (b) a cell expressing a second GFP fragment, wherein the first GFP fragment and the second GFP fragment can assemble to form a functional GFP.
In various embodiments of the invention, the conjugate of (a) (a) is conjugated to a polypeptide according to SEQ ID NO: 5; and/or (b) the cell expresses a polypeptide according to SEQ ID NO: 6.
Also included within the scope of the invention are various embodiments wherein the cells are selected from the group consisting of plant cells, yeast cells, fungi, algae, or cultured mammalian cells. In a preferred embodiment, the cell is a plant cell.
In various embodiments of the above aspects, the cell expresses a clathrin-associated adaptor (adaptor) AP2 complex (AP 2M).
In another aspect, the invention relates to a method of visualizing an internalization process, comprising: (a) providing a biometric imaging system of the present invention; (b) contacting the conjugate with a cell.
In a seventh aspect, the present invention relates to a method of internalizing a drug into a cell, comprising: (a) providing a conjugate of the invention and a cell; (b) contacting the conjugate with a cell.
In an eighteenth aspect, the invention relates to a conjugate according to the invention for use as a medicament.
In a final aspect, the invention relates to the use of the conjugates of the invention as research reagents.
As used herein, "at least one" relates to one or more, in particular 1, 2, 3, 4,5, 6, 7, 8, 9, 10 or more.
Examples of the invention
Materials and methods
Strains, plasmids and growth conditions
The bacterial strains and plasmids used in this study are listed in table 1. Agrobacterium tumefaciens strains were grown in LB (Luria-Bertani) medium at 28 ℃. If necessary, the medium was supplemented with 100. Mu.g ml -1 Carbenicillin or 50. Mu.g ml -1 Kanamycin.
Plant material
Arabidopsis (ecotype, columbia-0) wild-type and mutant plants were used in root transformation experiments. The AP2M inserted mutants, AP2M-1 (SALK _ 083693) and AP2M-2 (CS 807972) were obtained from the Arabidopsis thaliana biological resource center at the State university of Ohio.
The present Nicotiana sempervirens wild-type and transgenic lines Nb308A (expressing GFP1-10 and DsRed) (36) were used in Agrobacterium infiltration experiments.
Construct
GFP1-10 constructs
To construct a binary vector (pXY 01) for target gene expression in plant cells, the binary vector backbone was amplified from plasmid ER-gb (37) with primer set 5' CTAGTCTAGACCCGGGGCTCGAGCCTGGGATCCGAGCTCGAATTCCGGATCGTCAAACATTTTGGCA ATAAAGTTT-; the PCR product was then digested with XbaI and self-ligated to generate binary vector pXY01.
The GFP1-10 coding sequence was amplified from pQH308A (36) with primers 5 'CTAGTCTAGAATGGTTTCGAAAGGCGAGGA-3' and 5 'CGCGGATCCTTATTTCTCGTTTGGGTCTTTGC-3' and inserted into pXY01 to yield pGFP1-10.
Agrobacterium-tagged constructs
The scaffold was amplified from pCB301 with primer set 5 'ACGCGTCGACCTCGAGGGGGGGG-3' and 5 'ACGCGTCGACTCTCAGTAAAGCGCTGGCTG-3'; the PCR product was then digested with SalI and self-ligated to generate pXY301, which 301 lacks the T-DNA right border sequence. The virB promoter region was amplified from plasmid pTiA6 with primers 5 'ACGCGTCGACATGGTTTACAGACAGACGCGTAATCTC-3' and 5 'ACCTTATCTCCTTAGCTCGCAAC-3' and cloned into pXY301 to generate pVB. The DsRed coding sequence was amplified with primers 5 '-and 5' -CGGGGTACCATGGCCTCCCGAGGACG-3 'and 5' -and cloned into pVB to generate pVB-RFP. The GFP coding sequence was amplified with primers 5 'CGGGGTACCATGTCTAAAGGTGAAGAATTTATTCACTG-3' and 5 'CGGGGTACCTTTATTTGTACAATTCATCCATACCATG-3' and cloned into pVB to generate pVB-GFP. The ampicillin resistance cassette was then amplified from pACT2 (Clontech) with primers 5' ATGCAATCATGATTCAAATATGTATCCGCCTCAAGAGAGA-.
Hub constructs
A1860 bp DNA fragment encoding the C-terminal portion of CHC1 (At 3g 1130) was amplified from the whole Arabidopsis cDNA preparation with primers 5 'TCCCCCGGGATGAAGAGTTTAACTTAAATGTTCAGGCTG-3' and 5 'CGGATCCTTAGTAGCCGCCCATCGGGT-3'. The PCR fragment was cloned into the vector pXY01 to generate pXY01-Hub, wherein the Hub is under the control of CaMV35S promoter.
SYP61 constructs
To label early endosomes, the full-length genomic sequence of Arabidopsis SYP61 (Atlg 28490) was amplified from Arabidopsis genomic DNA with primers 5 'CTAGTCTAGAATGTCTTCAGCTCAAGATCCATTCT-3' and 5 'CCGCTCGAGGTCAAGAAGACAAGAACGAATAGG 3' and cloned into the binary vector pXY01 such that SYP61 was under the control of the CaMV35S promoter. The mCherry coding sequence was then amplified with primers 5 'CCGCTCGAGGGAGTGGCTCTGGCGGGGGATCAATGGTGAGCAAGGGGCGAGGA-3' and 5 'CGCGGATCCTTACTTGTTACAGCTCGTCTCATGGCCG-3' and the PCR fragment was cloned at the C-terminus to yield pXY01-SYP61-mC.
Transient mCherry expression constructs
The mCherry coding sequence was amplified with primers 5' and 5' CCGCTCGAGATGGCAAGGGCGAGGA-3 ' and 5' CGGGGTACCTTACTTGTACAGCTCGTCCATGCCG-3' and cloned into the binary vector pQH121 to generate pQH121-mC, where mCherry is under the control of the CaMV35S promoter.
Pull-down constructs
The coding sequence of the 295 amino acid C-terminal cargo binding domain of the μ 2-subunit (AP 2M) was amplified from Arabidopsis thaliana cDNA with primers 5' CGCGGATCCTCACCATTCATTCATCGAAGCCA-; the PCR fragment was cloned into the vector pMAL-c2x (New England Biotechnology) to produce pMBP-AP2MC.
Amplifying a coding sequence of the 76-amino-acid C-terminal tail of VirE2 from pTibo542 (EHA 105) by using primers 5' CGCGGATCCATCGTCCGCCGATCGCAA-; the PCR fragment was cloned into the vector pGEX-4T-1 (general electro-medical group) to generate pGST-VirE2C.
Agrobacterium infiltration method
Agrobacterium tumefaciens cells were grown overnight in LB; the culture was then diluted 50-fold in LB medium and further grown for 5-6 hours. Unless otherwise stated, bacteria were harvested and resuspended in water to OD 600 =1.0. The bacterial suspension was infiltrated into the underside of the fully depleted Nicotiana benthamiana leaves using a syringe. The infiltrated plants were then placed at 22 ℃ under a 16 hour light/8 hour dark photoperiod.
Detection of Agrobacterium-delivered VirE2 in Nicotiana benthamiana
Agrobacterium-delivered VirE2 was detected using the split GFP system described (36). VirE2-GFP11 fusions were expressed in bacteria using the labeled Agrobacterium tumefaciens strain EHA105virE2:: GFP 11. GFP1-10 was expressed in plant cells using the transgenic line Nb308A or transient expression using Agrobacterium tumefaciens strains containing the binary plasmid pGFP1-10.
Detection of plant plasma membranes and early endosomes
Plasma membrane or early endosome detection was performed by transient expression using Agrobacterium tumefaciens strains containing binary plasmid pm-rb (37) containing T-DNA encoding a plasma membrane marker, or pXY01-SYP61-mC, pXY01-SYP61-mC containing T-DNA encoding an early endosome marker SYP61, respectively.
FM4-64 dyeing
FM4-64 (Invitrogen Life technologies, inc., USA) at a concentration of 25 μ M in distilled water was infiltrated into the underside of the leaf of Nicotiana benthamiana. Images were taken 1 hour after infiltration.
Transient transformation test
Agrobacterium tumefaciens EHA105 or mutant strain comprising pQH121-mC was introduced at low concentration (OD) 600 = 0.005) into wild type Nicotiana benthamiana leaves, pQH121-mC contains the T-DNA encoding mCherry. Images were obtained 2 days after agroinfiltration and used for intensity calculations.
Stable transformation test
Arabidopsis wild-type or mutant seeds (Columbia-0) were surface sterilized using 15% bleach solution and incubated for 2 days at 4 ℃. The seeds were then placed in solidified 1/2 × MS medium (supplemented with 1% sucrose and 1% sucrose)0.5g L -1 MES, pH 5.8) and incubated at 22 ℃ for 10-12 days with a 16 h light/8 h dark photoperiod. The roots from individual seedlings were cut into 3-5mm sections and mixed with 1ml of 1X 10 8 Cells/ml of Agrobacterium tumefaciens cells (A348 or mutant) were mixed and plated on solidified 1/2 × MS plates. The plates were then incubated at 22 ℃ for 36 hours. Root segments were included in 100. Mu.g ml -1 Cefotaxime was aligned on 1/2 × MS medium plates and maintained at 22 deg.C for 5-6 weeks.
Chemical treatment
Agrobacterium tumefaciens cells were grown in water and the cell concentration was adjusted to OD 600 =0.5; ES1 was added to the cell suspension to a final concentration of 25. Mu.M. The mixture was then infiltrated into bunsen tobacco leaves. As a control, a suspension of Agrobacterium tumefaciens cells in water was infiltrated into Nicotiana benthamiana leaves alone. The infiltrated plants were then placed at 22 ℃ under a 16 hour light/8 hour dark photoperiod.
During the stable transformation experiments, arabidopsis roots from individual seedlings were cut into 3-5mm pieces and mixed with ES1 or tyrphostin A23 (Sigma) to a final concentration of 60. Mu.M or 50. Mu.M in water, respectively, and the mixture was then kept in the dark for 3 hours. As a control, the root segments were treated with water only. The root segments were then mixed with Agrobacterium tumefaciens for root transformation experiments as described above.
In vitro pull-down test
BL21 (DE 3) E.coli strain was used to produce fusion proteins. A single colony of cells was inoculated into LB broth and grown overnight at 37 ℃. The cell culture was then diluted to OD in fresh LB broth 600 =0.1, and grown at 28 ℃ for a further 1.5 hours until OD 600 =0.6. The expression of the fusion protein was then induced with isopropyl β -D-1-thiogalactoside (IPTG) at a final concentration of 1mM for 6 hours at 28 ℃.
Bacterial cells were harvested by centrifugation at 5000g for 5 minutes at 4 ℃ and washed once with pulldown lysis buffer (50 mM Tris & HCl, 50mM NaCl, pH 7.5). The cells were then resuspended in pulldown lysis buffer containing protease inhibitor cocktail (Nacalai Tesque) and briefly sonicated (12 times 20 seconds, 40% power). Cell debris was removed by centrifugation at 12000g for 15 min at 4 ℃.
The supernatant of the bait protein (MBP or MBP-labeled protein) was incubated with 150. Mu.l amylose resin (Nelumbo Biotechnology) for 3 hours at 4 ℃ on a rotator. The column was then washed 5 times with pull-down wash buffer (50 mM Tris. HCl, 50mM NaCl, 0.5% Triton X-100, pH 7.5).
The supernatant of prey protein (GST-tagged protein) was added to a column containing the MBP-tagged bait protein immobilized and incubated overnight at 4 ℃ on a rotator. The column was then washed 5 times with pull-down wash buffer and the captured proteins were eluted with pull-down lysis buffer containing 10mM maltose.
MBP-labeled proteins were detected by immunoblotting with anti-MBP antibody (sc-809, san Crux Biotechnology) and GST-labeled proteins by immunoblotting with anti-GST antibody (sc-459, san Crux Biotechnology).
Confocal microscope
Perkin-Elmer beyond-the-horizon rotating Disk system (Ultra View Vox Spinning Disk system) with EM-CCD camera was used for confocal microscopy. Unless otherwise stated, the agroinfiltrated Nicotiana benthamiana leaves were observed 2 days after agroinfiltration. To observe the leaf epidermis, agroinfiltrated leaf tissue was isolated from Nicotiana benthamiana plants and immersed in water on a glass slide with a cover slip. All images are composed of
Figure BDA0002038399600000101
3D image analysis software 6.2.1. Unless otherwise noted, all images were obtained under a confocal microscope with an olymplsapo 60 × n.a.1.20 water immersion objective.
Quantification of fluorescence intensity
The fluorescence intensity was measured using ImageJ (http:// rsbweb. Nih. Gov/ij /).
Statistical analysis
Quantitative data are expressed as mean ± SEM from at least three independent experiments. Statistical differences between groups were analyzed using unpaired T-test, where appropriate. Differences were considered significant when P < 0.05.
TABLE 1 strains and plasmids used in this experiment
Figure BDA0002038399600000111
/>
Figure BDA0002038399600000121
/>
Figure BDA0002038399600000131
Example 1: association of VirE2 with host plasma membrane upon delivery
To visualize VirE2 delivery, virE2-GFP11 fusions were expressed in Agrobacterium tumefaciens, and GFP1-10 was expressed in plant cells. VirE2-GFP11 produced by complementation of VirE2-GFP11 and GFP1-10 following delivery of VirE2-GFP11 into plant cells Composite material Fluorescence signal visualization (36).
First, delivery of VirE2 into tobacco cells was observed at an early stage; the T-DNA free strain EHA105 was used to avoid any potential complications due to T-DNA trafficking. VirE2-GFP 11-producing Agrobacterium tumefaciens EHA105virE 2:GFP11 was infiltrated into transgenic Nicotiana benthamiana (Nb 308A) leaves expressing GFP1-10 and DsRed. Delivery of VirE2 into tobacco cells was detected at different time points under confocal microscopy. As shown in fig. 1A, a small amount of VirE2 began to appear at the tobacco cell border 32 hours after agroinfiltration (upper panel). Over time, more VirE2 was observed at the cell boundary; the VirE2 signal becomes filamentous. Most tobacco cells showed VirE2 accumulation in the nucleus 48 hours after Agrobacterium infiltration (FIG. 1A lower panel). The data indicate that VirE2 first appears at the tobacco cell boundary and then moves into the nucleus.
The broad localization of Agrobacterium tumefaciens cells within plant tissues was subsequently determined. Bacterial cells were constructed to express GFP under the control of the virB promoter so that they were naturally fluorescently labeled during agroinfiltration. After infiltration of GFP-labeled Agrobacterium tumefaciens cells EHA105 (pAT-GFP) into N.benthamiana leaves, it was observed that most of the bacterial cells were arranged at the intercellular spaces of the Agrobacterium-infiltrated tobacco cells (FIG. 2A). Then uniformly mixing GFP marked bacterial cells and DsRed marked bacterial cells; infiltrating the blend into Nicotiana benthamiana leaves; it was observed that the bacterial cells were closely arranged in separate single cells at the intercellular space (fig. 2B). These indicate that the limited intercellular space of the nicotiana benthamiana epidermal cells can accommodate only a single bacterial cell, and that space limitations may only allow the sides of the bacteria to come into close contact with the host cells.
The relative positioning of the Agrobacterium tumefaciens cells and VirE2 delivered into the plant cells was then determined. Agrobacterium tumefaciens strain EHA105virE2:: GFP11 (pGFP 1-10 and pVBA-RFP), which is also capable of delivering VirE2-GFP11 and T-DNA expressing GFP1-10, was infiltrated with DsRed into wild-type Nicotiana benthamiana leaves. At 48 hours after agroinfiltration, virE2 accumulated on the cytoplasmic side of tobacco cells in close contact with Agrobacterium tumefaciens cells (FIG. 1B). Interestingly, virE2 was delivered into plant cells from both sides of the bacterial cells. This suggests that a single bacterium can deliver VirE2 to two adjacent host cells simultaneously.
To determine the subcellular location of the agrobacterium-delivered VirE2 within the host cell, a specific plant plasma membrane tracker was expressed within the plant cell by T-DNA delivered by the same bacterial cell as that delivering VirE2-GFP11 (37). The agrobacterium-delivered VirE2 was found to co-localize with a transiently expressed plasma membrane tracker (fig. 1C), indicating that VirE2 is associated with the plant cell plasma membrane at the time of delivery.
Example 2: association of Agrobacterium-delivered VirE2 with endocytic vacuoles
To investigate how membrane-bound VirE2 migrates into the cytoplasm, the membrane was labeled with the fluorescent styryl dye FM4-64 and then monitored for dynamics (38). Such dyes are lipophilic; where it is used it may mark the membrane but it cannot itself penetrate the membrane. This property would allow us to monitor the transport process of VirE 2-bound membranes. Agrobacterium tumefaciens EHA105virE2 GFP11 cells were infiltrated into N.benthamiana leaves to initiate VirE2 delivery; after 48 hours, the FM4-64 dye was then infiltrated into the same area. As shown in FIG. 1D, virE2 was co-localized with FM 4-64-labeled plasma membrane (top panel) in a manner similar to the use of a plasma membrane tracker (FIG. 1C). Interestingly, virE2 also co-localized with the FM4-64 labeled endocytic vacuole, which pinches off from the plasma membrane (FIG. 1D lower panel).
Furthermore, even when the FM4-64 labeled vacuole moved within the cytoplasm, co-localization of VirE2 with the FM4-64 labeled endocytic vacuole continued (FIG. 3). The moving speed ranged from 0.4 to 2.1 μm/sec, which is consistent with endosomal kinetics reported in previous studies (39). The data indicate that VirE2 delivered to the host plasma membrane can utilize host endocytosis for cellular internalization and cytoplasmic movement.
Example 3: efficient VirE2 transport requires endocytosis
Subsequently, it was examined whether internalization of the VirE2 protein requires host endocytosis processes. Plant endocytosis processes are reported to be mediated by clathrin tripodal complexes (40); overexpression of the C-terminal part of the clathrin heavy chain (Hub) results in a strong dominant negative effect on clathrin-mediated endocytosis (CME), the clathrin heavy chain binding to and depleting the clathrin light chain (41-43).
We then tested the effect of over-expressing Hub in this Semlens tobacco leaf; FM4-64 dye was used to monitor general endocytosis process. Transient expression of Hub under the CaMV35S promoter was found to significantly reduce internalization of FM4-64 dye (fig. 5). This indicates that the dominant negative strategy using Hub can indeed influence the endocytosis process in the epidermal cells of Nicotiana benthamiana. Interestingly, hub overexpression was found to increase VirE2 accumulation at the cell boundary (fig. 4A and B). Time course experiments showed that VirE2 stayed longer at the cell boundaries in tobacco cells over-expressing Hub compared to controls (fig. 6). These indicate that functional clathrin and active CME processes are required for VirE2 to leave the plant cell membrane.
To demonstrate that host endocytosis is important for VirE2 trafficking, the chemical inhibitor endopeptide (endosidin) 1 (ES 1) was used to interfere with the endocytosis process, as ES1 affects the endocytosis pathway and leads to aggregation of early endosomes in arabidopsis (44). SYP61-mCherry was used to label highly dynamic circular early endosomes (44, 45); it is transiently expressed in E.benthamiana epidermal cells treated with ES 1. ES1 treatment was found to result in abnormal aggregation of SYP61-mCherry markers (fig. 7A), indicating aggregation of early endosomes in leaf epidermal cells. Interestingly, ES1 treatment resulted in aberrant VirE2 trafficking in the host cytoplasm; virE2 accumulated in ES 1-induced endosomal aggregates (fig. 7B). This indicates that ES1 interferes with host endocytosis and limits VirE2 movement.
The effect of ES1 on VirE2 nuclear targeting was then tested, as it has previously been shown that agrobacterium-delivered VirE2 efficiently targets plant cell nuclei in a Nuclear Localization Signal (NLS) -dependent manner (36). As shown in fig. 4C and D, ES1 treatment significantly reduced nuclear accumulation of VirE2 within tobacco cells, while VirE2 accumulated at cell boundaries or within the cytoplasm. This suggests that ES1 affects VirE2 transport rather than delivery or oligomerization of VirE2. Taken together, these findings suggest that host endocytosis plays an important role in cytoplasmic trafficking and subsequent nuclear targeting of VirE2 within plant cells.
Example 4: AMT procedures require endocytosis
To confirm the importance of endocytosis, the effect of chemical inhibitors on agrobacterium-mediated transformation (AMT) was investigated, as the transformation process requires a functional VirE2. Tumorigenesis experiments were performed using ES1 or arabidopsis thaliana roots treated with tyrphostin a23, which is also a CME inhibitor of arabidopsis thaliana (46). As shown in fig. 4E and F, treatment with ES1 or tyrphostin a23 significantly attenuated tumorigenesis. These results indicate that interfering with host endocytosis can attenuate stable transformation of plant cells, probably because blocked endocytosis affects movement of VirE2, thereby affecting its role in AMT.
Example 5: virE2 transport requires a double endocytic motif of the C-terminal tail of VirE2
Subsequently, it was investigated how to select the cargo VirE2 as internalization process. In general, the selection of plasma membrane-associated cargo proteins for the internalization process depends on the recognition of endocytic signals by various host adaptors on the cytoplasmic side of the cargo protein (47, 48). After delivery into host plant cells via T4SS, virE2 may interact with one of the host adaptor proteins at the plasma membrane. Sequence analysis indicated that VirE2 (accession AAZ 50538) contained 5 putative endocytic sorting motifs (fig. 8A).
To test the importance of these putative motifs for VirE2 transport, potentially critical leucine or tyrosine residues of each di-leucine-or tyrosine-based motif (49) were mutated to alanine. In addition, a double mutant was constructed for the motif of the two tyrosine groups in spatial proximity at the C-terminus (fig. 8A). The cell localization and distribution of agrobacterium-delivered VirE2 was then tested for each mutant. Neither single nor double mutations in the motif of the double C-terminal tyrosine group affected delivery of VirE2 to the host cell membrane (fig. 8B and C); however, the double mutation resulted in significantly higher levels of VirE2 accumulation at the membrane site (fig. 8C). Mutations at other putative endocytic motifs of VirE2 did not affect VirE2 delivery or internalization processes (fig. 9). The results indicate that the motif of the putative double C-terminal tyrosine group is important for VirE2 transport.
Example 6: AMT requires a double endocytic motif in the C-terminal tail of VirE2
To determine whether the motif of the double C-terminal tyrosine group is required for VirE2 function, transient expression of mCherry under the control of the CaMV35S promoter on T-DNA was tested after AMT. mCherry expression was analyzed based on fluorescence intensity due to VirE2 mutation at the double C-terminal endocytic signal. As shown in fig. 8D and E, both single and double mutations at the double C-terminal endocytosis signal significantly reduced transient AMT efficiency, although the effect of the double mutation (Y488A/Y494A) was more pronounced than the single mutation Y494A (which was more able to affect function than Y488A). These indicate that a double C-terminal endocytosis signal is required for VirE2 function, whereas the last endocytosis signal at the VirE2 terminus is more important.
Sequence alignment analysis showed that the endocytic motifs of the double C-terminal tyrosine group were conserved on VirE2 proteins from different Ti plasmids, indicating their conserved role in different agrobacterium strains (fig. 10). Furthermore, mutations in these conserved motifs on VirE2 from virulence strain a348 also attenuated tumor formation on the root segment of arabidopsis (fig. 8F and G). The results indicate that the endocytic signal of the tyrosinyl group located at the VirE 2C-terminus is important for both transient and stable VirE2 function of AMT process.
Example 7: the endocytic motif at the C-terminal end of VirE2 interacts with plant AP2M
The above results led us to hypothesize that the endocytic motif of the double C-terminal tyrosine group of VirE2 might be recognized by clathrin-associated sortilin, since clathrin-mediated endocytosis process is facilitated by a set of host adaptors called "clathrin-associated sortilin", which are responsible for endocytosis signal recognition and cargo binding (47, 48). Wherein the adaptor protein 2 (AP-2) complex recognizes the endocytic signal of the tyrosine group and binds thereto via the C-terminal domain of the μ -subunit (AP 2M) (50).
To test the potential interaction of VirE2 with the AP-2 complex, an in vitro pull-down assay was performed using its fusion protein. As shown in FIG. 11A, when the C-terminal tail of VirE2 is fused to GST (GST-VirE 2C), it interacts with the cargo binding domain of AP2M fused to MBP (MBP-AP 2 MC). However, double mutations at the endocytic signal of the double tyrosine group abolished this interaction (fig. 11B). These results indicate that AP2M recognizes and binds to the VirE 2C-terminal tail through the bis-tyrosine-based sorting motif.
Example 8: attenuation of tumorigenesis by ap2m mutations
To further confirm the importance of host AP-2 complexes in the course of AMT, two insertional mutants of arabidopsis AP2M were tested for tumorigenesis. As shown in fig. 11C and D, both insertion mutants of AP-2M showed significantly reduced tumor formation compared to the wild-type control. These demonstrate that the host AP-2 complex is indeed required for Agrobacterium-mediated transformation of plant cells.
The present invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the removed material is specifically recited herein. Other embodiments are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention also will be described in terms of any individual member or subgroup of members of the Markush group.
Those skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. In addition, it will be apparent to those skilled in the art that various substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The compositions, methods, procedures, treatments, molecules, and specific compounds described herein are presently representative of preferred embodiments, which are exemplary and are not intended as limitations on the scope of the invention. Variations and other uses will occur to those skilled in the art within the spirit of the invention and the scope of the claims. The listing or discussion of a prior-published document in this specification should not be taken as an admission that the document is part of the state of the art or is common general knowledge.
The invention described in detail herein may be suitably practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising," "including," "containing," and the like are to be construed broadly and without limitation. Thus, the word "comprise", or variations such as "comprises" or "comprising", will be understood accordingly to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. Additionally, the terms and expressions which have been employed herein are used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by exemplary embodiments and optional features, modification and variation of the inventions herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
The contents of all documents and patent documents cited herein are incorporated by reference in their entirety.
Reference to the literature
1.M.D.Chilton，M.H.Drummond，D.J.Merio，D.Sciaky，A.L.Montoya，M.P.Gordon，E.W.Nester，Stable incorporation of plasmid DNA into higher plant cells：the molecular basis of crown gall tumorigenesis.Cell 11，263(1977).
2.P.Zambryski.M.Holsters，K.Kruger，A.Depicker，J.Schell，M.Van Montagu，H.M.Goodman，Tumor DNA structure in plant cells transformed by A.tumefaciens.Science 209，1385(1980).
3.L.M.Albright，M.F.Yanofsky，B.Leroux，D.Q.Ma，E.W.Nester，Processing of the T-DNA of Agrobacterium tumefaciens generates border nicks and linear，single-stranded T-DNA.J.Bacteriol.169，1046(1987).
4.P.Bundock，A.den Dulk-Ras，A.Beijersbergen，P.J.Hooykaas，Trans-kingdom T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces cerevisiae.EMBO J.14，3206(1995).
5.K.L.Piers.J.D.Heath，X.Liang，K.M.Stephens，E.W.Nester，Agrobacterium tumefaciens-mediated transformation of yeast.Proc.Natl.Acad.Sci.U.S.A.93，1613(1996).
6.M.J.de Groot，P.Bundock，P.J.Hooykaas，A.G.Beijersbergen，Agrobacterium tumefaciens-mediated transformation of filamentous fungi.Nat.Biotechnol.16，839(1998).
7.S.Kathiresan，A.Chandrashekar，G.A.Ravishankar，R.Sarada，Agrobacterium-Mediated Transformation in the Green Alga Haematococcus Pluvialis(Chlorophyceae，Volvocales)(1).J.Phycol.45，642(2009).
8.T.Kunik，T.Tzfira，Y.Kapulnik，Y.Gafni，C.Dingwall，V.Citovsky，Genetic transformation of HeLa cells by Agrobacterium.Proc.Natl.Acad.Sci.U.S.A.98，1871(2001).
9.T.Tzfira，V.Citovsky，Agrobacterium-mediated genetic transformation of plants：biology and biotechnology.Curr.Opin.Biotechnol.17，147(2006).
10.C.B.Michielse，P.J.Hooykaas，C.A.van den Hondel，A.F.Ram，Agrobacterium-mediated transformation as a tool for functional genomics in fungi.Curr.Genet.48，1(2005).
11.K.J.Fullner，J.C.Lara，E.W.Nester，Pilus assembly by Agrobacterium T-DNA transfer genes.Science 273，1107(1996).
12.E.Cascales，P.J.Christie，Definition of a bacterial type IV secretion pathway for a DNA substrate.Science 304，1170(2004).
13.A.Beijersbergen，A.D.Dulk-Ras，R.A.Schilperoort，P.J.Hooykaas，Conjugative Transfer by the Virulence System of Agrobacterium tumefaciens.Science 256，1324(1992).
14.H.H.Low，F.Gubellini，A.Rivera-Calzada，N.Braun，S.Connery，A.Dujeancourt，F.Lu，A.Redzej，R.Fronzes，E.V.Orlova，G.Waksman，Structure of a type IV secretion system.Nature 508，550(2014).
15.E.Cascales，P.J.Christie，The versatile bacterial type IV secretion systems.Nat.Rev.Microbiol.1，137(2003).
16.V.Chandran Darbari，G.Waksman，Structural Biology of Bacterial Type IV Secretion Systems.Annu.Rev.Biochem.84，603(2015).
17.P.J.Christie，K.Atmakuri，V.Krishnamoorthy，S.Jakubowski，E.Cascales，Biogenesis，architecture，and function of bacterial type IV secretion systems.Annu.Rev.Microbiol.59，451(2005).
18.A.C.Vergunst.B.Schrammeijer，A.den Dulk-Ras，C.M.de Vlaam，T.J.Regensburg-Tuink，P.J.Hooykaas，VirB/D4-dependent protein translocation from Agrobacterium into plant cells.Science 290，979(2000).
19.A.C.Vergunst，M.C.van Lier，A.den Dulk-Ras，T.A.Stuve，A.Ouwehand，P.J.Hooykaas，Positive charge is an important feature of the C-terminal transport signal of the VirB/D4-translocated proteins of Agrobacterium.Proc.Natl.Acad.Sci.U.S.A.102，832(2005).
20.B.Schrammeijer，A.den Dulk-Ras，A.C.Vergunst，E.Jurado Jacome，P.J.Hooykaas，Analysis of Vir protein translocation from Agrobacterium tumefaciens using Saccharomyces cerevisiae as a model：evidence for transport of a novel effector protein VirE3.Nucleic Acids Res.31，860(2003).
21.S.B.Gelvin，Plant proteins involved in Agrobacterium-mediated genetic transformation.Annu.Rev.Phytopathol.48，45(2010).
22.K.Wang，L.Herrera-Estrella.M.Van Montagu，P.Zambryski，Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfefr from Agrobacterium to the plant genome.Cell 38，455(1984).
23.M.F.Yanofsky，S.G.Porter，C.Young，L.M.Albright，M.P.Gordon.E.W.Nester，The virD operon of Agrobacterium tumefaciens encodes a site-specific endonuclease.Cell 47，471(1986).
24.P.Scheiffele，W.Pansegrau，E.Lanka，Initiation of Agrobacterium tumefaciens T-DNA processing.Purified proteins VirDl and VirD2 catalyze site-and strand-specific cleavage of superhelical T-border DNA in vitro.J.Biol.Chem.270，1269(1995).
25.P.J.Christie，J.E.Ward，S.C.Winans，E.W.Nester，The Agrobacterium tumefaciens virE2 gene product is a single-stranded-DNA-binding protein that associates with T-DNA.J.Bacteriol.170，2659(1988).
26.V.Citovsky，M.L.Wong，P.Zambryski，Cooperative interaction of Agrobacterium VirE2 protein with single-stranded DNA：implications for the T-DNA transfer process.Proc.Natl.Acad.Sci.U.S.A.86，1193(1989).
27.P.Sen，G.J.Pazour，D.Anderson，A.Das，Cooperative binding of Agrobacterium tumefaciens VirE2protein to single-stranded DNA.J.Bacteriol.171，2573(1989).
28.S.Bhattacharjee，L.Y.Lee，H.Oltmanns，H.Cao，Veena，J.Cuperus，S.B.Gelvin，IMPa-4，an Arabidopsis importin alpha isoform，is preferentially involved in Agrobacterium-mediated plant transformation.Plant Cell 20，2661(2008).
29.F.Dumas，M.Duckely，P.Pelczar，P.Van Gelder，B.Hohn，An Agrobacterium VirE2 channel for transferred-DNA transport into plant cells.Proc.Natl.Acad.Sci.U.S.A.98，485(2001).
30.L.Rossi，B.Hohn，B.Tinland，Integration of complete transferred DNA units is dependent on the activity of virulence E2protein of Agrobacterium tumefaciens.Proc.Natl.Acad.Sci.U.S.A.93，126(1996).
31.V.M.Yusibov，T.R.Steck，V.Gupta，S.B.Gelvin，Association of single-stranded transferred DNA from Agrobacterium tumefaciens with tobacco cells.Proc.Natl.Acad.Sci.U.S.A.91，2994(1994).
32.T.Tzfira，M.Vaidya，V.Citovsky，VIP1，an Arabidopsis protein that interacts with Agrobacterium VirE2，is involved in VirE2 nuclear import and Agrobacterium infectivity.EMBO J.20，3596(2001).
33.A.Djamei，A.Pitzschke，H.Nakagami，I.Rajh，H.Hirt，Trojan horse strategy in Agrobacterium transformation：abusing MAPK defense signaling.Science 318，453(2007).
34.J.Li，A.Krichevsky，M.Vaidya，T.Tzfira，V.Citovsky，Uncoupling of the functions of the Arabidopsis VIP1 protein in transient and stable plant genetic transformation by Agrobacterium.Proc.Natl.Acad.Sci.U.S.A.102，5733(2005).
35.A.Anand，A.Krichevsky，S.Schornack，T.Lahaye，T.Tzfira，Y.Tang，V.Citovsky，K.S.Mysore，Arabidopsis VIRE2 INTERACTING PROTEIN2 is required for Agrobacterium T-DNA integration in plants.Plant Cell 19，1695(2007).
36.X.Li，Q.Yang，H.Tu，Z.Lim，S.Q.Pan，Direct visualization of Agrobacterium-delivered VirE2 in recipient cells.Plant J.77，487(2014).
37.B.K.Nelson，X.Cai，A.Nebenfuhr，A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plants.Plant J.51，1126(2007).
38.N.Geldner，N.Anders，H.Wolters，J.Keicher，W.Komberger，P.Muller，A.Delbarre，T.Ueda.A.Nakano，G.Jurgens，The Arabidopsis GNOM ARF-GEF mediates endosomal recycling，auxin transport，and auxin-dependent plant growth.Cell 112，219(2003).
39.A.Maizel，D.von Wangenheim，F.Federici，J.Haseloff.E.H.Stelzer，High-resolution live imaging of plant growth in near physiological bright conditions using light sheet fluorescence microscopy.Plant J.68，377(2011).
40.H.T.McMahon，E.Boucrot，Molecular mechanism and physiological functions of clathrin-mediated endocytosis.Nat.Rev.Mol.Cell Biol.12，517(2011).
41.S.H.Liu，M.L.Wong，C.S.Craik，F.M.Brodsky，Regulation of clathrin assembly and trimerization defined using recombinant triskelion hubs.Cell 83，257(1995).
42.S.Kitakura，S.Vanneste，S.Robert，C.Lofke，T.Teichmann，H.Tanaka，J.Friml，Clathrin mediates endocytosis and polar distribution of PIN auxin transporters in Arabidopsis.Plant Cell 23，1920(2011).
43.P.Dhonukshe，F.Aniento，I.Hwang，D.G.Robinson，J.Mravec，Y.D.Stierhof，J.Friml，Clathrin-mediated constitutive endocytosis of PIN auxin efflux carriers in Arabidopsis.Curr.Biol.17，520(2007).
44.S.Robert，S.N.Chary，G.Drakakaki，S.Li，Z.Yang，N.V.Raikhel，G.R.Hicks，Endosidinl defines a compartment involved in endocytosis of the brassinosteroid receptor BRI1 and the auxin transporters PIN2 and AUX1.Proc.Natl.Acad.Sci.U.S.A.105，8464(2008).
45.O.Foresti，J.Denecke，Intermediate organeiles of the plant secretory pathway：identity and function.Trafffic 9，1599(2008).
46.D.N.Banbury，J.D.Oakley，R.B.Sessions，G.Banting，Tyrphostin A23 inhibits internalization of the transferrin receptor by perturbing the interaction between tyrosine motifs and the medium chain subunit of the AP-2 adaptor complex.J.Biol.Chem.278，12022(2003).
47.J.S.Bonifacino，L.M.Traub，Signals for sorting of transmembrane proteins to endosomes and lysosomes.Annu.Rev.Biochem.72，395(2003).
48.L.M.Traub，Tickets to ride：selecting cargo for clathrin-regulated internalization.Nat.Rev.Mol.Cell Biol.10，583(2009).
49.L.M.Traub，J.S.Bonifacino，Cargo recognition in clathrin-mediated endocytosis.Cold Spring Harb.Perspect.Biol.5，a016790(2013).
50.L.P.Jackson.B.T.Kelly，A.J.McCoy，T.Gaffry，L.C.James，B.M.Collins，S.Honing，P.R.Evans，D.J.Owen，A large-scale conformational change couples membrane recruitment to cargo binding in the AP2 clathrin adaptor complex.Cell 141，1220(2010).
51.M.De Cleene，J.De Ley，The host range of crown gall.The Botanical Review 42，389(1976).
52.B.Lacroix，T.Tzfira，A.Vainstein.V.Citovsky，A case of promiscuity：Agrobacterium′s endless hunt for new partners.Trends Genet.22，29(2006).
53.L.Otten.H.De Greve，J.Leemans，R.Hain，P.Hooykaas，J.Schell，Restoration of virulence of Vir region mutants of Agrobacterium tumefaciens strain B6S3 by coinfection with normal and mutant Agrobacterium strains.Mol Gen Genet.195，159-163(1984).
54.J.Aguilar，J.Zupan，T.A.Cameron，P.C.Zambryski，Agrobacterium type IV secretion system and its substrates form helical arrays around the circumference of virulence-induced cells.Proc.Natl.Acad.Sci.U.S.A.107，3758(2010).
55.L.G.Wu，E.Hamid，W.Shin，H.C.Chiang，Exocytosis and endocytosis：modes，functions，and coupling mechanisms.Annu.Rev.Physiol.76，301(2014).
56.J.Mercer.M.Schelhaas，A.Helenius，Virus entry by endocytosis.Annu.Rev.Biochem.79，803(2010).
57.M.Bar，A.Avni，Endosomal trafficking and signaling in plant defense responses.Curr.Opin.Plant Biol.22，86(2014).
58.X.Chen，N.G.Irani，J.Friml，Clathrin-mediated endocytosis：the gateway into plant cells.Curr.Opin.Plant Biol.14,674(2011).
59.C.Xiang，P.Han，I.Lutziger，K.Wang，D.J.Oliver，A mini binary vector series for plant transformation.Plant Mol.Biol.40，711-717(1999).
60.E.E.Hood，S.B.Gelvin，L.S.Melchers，A.Hoekema，New Agrobacterium helper plasmids for gene transfer to plants.Transgenic Res.2，208-218(1993).
61.V.C.Knauf，E.W.Nester，Wide host range cloning vectors：a cosmid clone bank of an Agrobacterium Ti plasmid.Plasmid 8，45-54(1982).
62.P.Y.Chen，C.K.Wang，S.C.Soong，K.Y.To，Complete sequence of the binary vector pBI121 and its application in cloning T-DNA insertion from transgenic plants.Mol.Breed.11，287-293(2003).
Sequence listing
<110> Singapore National University (National University of Singapore)
<120> Compounds and methods for targeting molecules to specific cellular locations
<130> 2016-202-01
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> internalization Signal of VirE2
<400> 1
Tyr Thr Ser Val Ala Glu Tyr Glu Arg Leu
1 5 10
<210> 2
<211> 487
<212> PRT
<213> Artificial sequence
<220>
<223> N-terminus of VirE2
<400> 2
Met Asp Pro Ser Ser Asn Glu Asn Val Tyr Val Gly Arg Gly His Asn
1 5 10 15
Ile Glu Asn Asp Asp Asp Thr Asp Pro Arg Arg Trp Lys Lys Ala Asn
20 25 30
Ile Ser Ser Asn Thr Ile Ser Asp Ile Gln Met Thr Asn Gly Glu Asp
35 40 45
Val Gln Ser Gly Ser Pro Thr Arg Thr Glu Val Val Ser Pro Arg Leu
50 55 60
Asp Tyr Gly Ser Val Asp Ser Ser Ser Ser Leu Tyr Ser Gly Ser Glu
65 70 75 80
His Gly Asn Gln Ala Glu Ile Gln Lys Glu Leu Ser Val Leu Phe Ser
85 90 95
Asn Met Ser Leu Pro Gly Asn Asp Arg Arg Pro Asp Glu Tyr Ile Leu
100 105 110
Val His Gln Thr Gly Gln Asp Ala Phe Thr Gly Ile Ala Lys Gly Asn
115 120 125
Leu Asp Gln Met Pro Thr Lys Ala Glu Phe Asn Ala Cys Cys Arg Leu
130 135 140
Tyr Arg Asp Gly Ala Gly Asn Tyr Tyr Pro Pro Pro Leu Ala Phe Asp
145 150 155 160
Lys Ile Ser Val Pro Glu Gln Leu Glu Glu Lys Trp Gly Met Met Glu
165 170 175
Ala Lys Glu Arg Asn Lys Leu Arg Phe Gln Tyr Lys Leu Asp Val Trp
180 185 190
Asn His Ala His Ala Asp Met Gly Ile Thr Gly Thr Glu Ile Phe Tyr
195 200 205
Gln Thr Asp Lys Asn Ile Lys Leu Asp Arg Asn Tyr Lys Leu Arg Pro
210 215 220
Glu Asp Arg Tyr Val Gln Thr Glu Lys Tyr Gly Arg Arg Glu Ile Gln
225 230 235 240
Lys Arg Tyr Gln His Glu Leu Gln Ala Gly Ser Leu Leu Pro Asp Ile
245 250 255
Met Ile Lys Thr Pro Gln Asn Asp Ile His Phe Val Tyr Arg Phe Ala
260 265 270
Gly Asp Asn Tyr Ala Asn Lys Gln Phe Ser Glu Phe Glu His Thr Val
275 280 285
Lys Arg Arg Tyr Gly Asp Glu Thr Glu Ile Lys Leu Lys Ser Lys Ser
290 295 300
Gly Ile Met His Asp Ser Lys Tyr Leu Glu Ser Trp Glu Arg Gly Ser
305 310 315 320
Ala Asp Ile Arg Phe Ala Glu Phe Val Gly Glu Asn Arg Ala His Asn
325 330 335
Arg Gln Phe Pro Thr Ala Thr Val Asn Met Gly Gln Gln Pro Asp Gly
340 345 350
Gln Gly Gly Leu Thr Arg Asp Arg His Val Ser Val Asp Phe Leu Met
355 360 365
Gln Ser Ala Pro Asn Ser Pro Trp Ala Gln Ala Leu Lys Lys Gly Glu
370 375 380
Leu Trp Asp Arg Val Gln Leu Leu Ala Arg Asp Gly Asn Arg Tyr Leu
385 390 395 400
Ser Pro Pro Arg Leu Glu Tyr Ser Asp Pro Ala His Phe Thr Glu Leu
405 410 415
Met Asn Arg Val Gly Leu Pro Ala Ser Met Gly Arg Gln Ser His Ala
420 425 430
Ala Ser Ile Lys Phe Glu Lys Phe Asp Ala Gln Ala Ala Val Ile Val
435 440 445
Leu Asn Gly Pro Glu Leu Arg Asp Ile His Asp Leu Ser Pro Glu Lys
450 455 460
Leu Gln Asn Leu Ser Thr Lys Asp Val Ile Val Ala Asp Arg Asn Glu
465 470 475 480
Asn Gly Gln Arg Thr Gly Thr
485
<210> 3
<211> 52
<212> PRT
<213> Artificial sequence
<220>
<223> C-terminus of VirE2
<400> 3
Gln Leu Arg Leu Pro Pro Asp Ala Ala Gly Val Leu Gly Glu Ala Thr
1 5 10 15
Asp Lys Tyr Ser Arg Asp Phe Val Arg Pro Glu Pro Ala Ser Arg Pro
20 25 30
Ile Ser Asp Ser Arg Arg Ile Tyr Glu Ser Arg Pro Arg Ser Gln Ser
35 40 45
Val Asn Ser Phe
50
<210> 4
<211> 549
<212> PRT
<213> Agrobacterium tumefaciens (Agrobacterium tumefaciens)
<400> 4
Met Asp Pro Ser Ser Asn Glu Asn Val Tyr Val Gly Arg Gly His Asn
1 5 10 15
Ile Glu Asn Asp Asp Asp Thr Asp Pro Arg Arg Trp Lys Lys Ala Asn
20 25 30
Ile Ser Ser Asn Thr Ile Ser Asp Ile Gln Met Thr Asn Gly Glu Asp
35 40 45
Val Gln Ser Gly Ser Pro Thr Arg Thr Glu Val Val Ser Pro Arg Leu
50 55 60
Asp Tyr Gly Ser Val Asp Ser Ser Ser Ser Leu Tyr Ser Gly Ser Glu
65 70 75 80
His Gly Asn Gln Ala Glu Ile Gln Lys Glu Leu Ser Val Leu Phe Ser
85 90 95
Asn Met Ser Leu Pro Gly Asn Asp Arg Arg Pro Asp Glu Tyr Ile Leu
100 105 110
Val His Gln Thr Gly Gln Asp Ala Phe Thr Gly Ile Ala Lys Gly Asn
115 120 125
Leu Asp Gln Met Pro Thr Lys Ala Glu Phe Asn Ala Cys Cys Arg Leu
130 135 140
Tyr Arg Asp Gly Ala Gly Asn Tyr Tyr Pro Pro Pro Leu Ala Phe Asp
145 150 155 160
Lys Ile Ser Val Pro Glu Gln Leu Glu Glu Lys Trp Gly Met Met Glu
165 170 175
Ala Lys Glu Arg Asn Lys Leu Arg Phe Gln Tyr Lys Leu Asp Val Trp
180 185 190
Asn His Ala His Ala Asp Met Gly Ile Thr Gly Thr Glu Ile Phe Tyr
195 200 205
Gln Thr Asp Lys Asn Ile Lys Leu Asp Arg Asn Tyr Lys Leu Arg Pro
210 215 220
Glu Asp Arg Tyr Val Gln Thr Glu Lys Tyr Gly Arg Arg Glu Ile Gln
225 230 235 240
Lys Arg Tyr Gln His Glu Leu Gln Ala Gly Ser Leu Leu Pro Asp Ile
245 250 255
Met Ile Lys Thr Pro Gln Asn Asp Ile His Phe Val Tyr Arg Phe Ala
260 265 270
Gly Asp Asn Tyr Ala Asn Lys Gln Phe Ser Glu Phe Glu His Thr Val
275 280 285
Lys Arg Arg Tyr Gly Asp Glu Thr Glu Ile Lys Leu Lys Ser Lys Ser
290 295 300
Gly Ile Met His Asp Ser Lys Tyr Leu Glu Ser Trp Glu Arg Gly Ser
305 310 315 320
Ala Asp Ile Arg Phe Ala Glu Phe Val Gly Glu Asn Arg Ala His Asn
325 330 335
Arg Gln Phe Pro Thr Ala Thr Val Asn Met Gly Gln Gln Pro Asp Gly
340 345 350
Gln Gly Gly Leu Thr Arg Asp Arg His Val Ser Val Asp Phe Leu Met
355 360 365
Gln Ser Ala Pro Asn Ser Pro Trp Ala Gln Ala Leu Lys Lys Gly Glu
370 375 380
Leu Trp Asp Arg Val Gln Leu Leu Ala Arg Asp Gly Asn Arg Tyr Leu
385 390 395 400
Ser Pro Pro Arg Leu Glu Tyr Ser Asp Pro Ala His Phe Thr Glu Leu
405 410 415
Met Asn Arg Val Gly Leu Pro Ala Ser Met Gly Arg Gln Ser His Ala
420 425 430
Ala Ser Ile Lys Phe Glu Lys Phe Asp Ala Gln Ala Ala Val Ile Val
435 440 445
Leu Asn Gly Pro Glu Leu Arg Asp Ile His Asp Leu Ser Pro Glu Lys
450 455 460
Leu Gln Asn Leu Ser Thr Lys Asp Val Ile Val Ala Asp Arg Asn Glu
465 470 475 480
Asn Gly Gln Arg Thr Gly Thr Tyr Thr Ser Val Ala Glu Tyr Glu Arg
485 490 495
Leu Gln Leu Arg Leu Pro Pro Asp Ala Ala Gly Val Leu Gly Glu Ala
500 505 510
Thr Asp Lys Tyr Ser Arg Asp Phe Val Arg Pro Glu Pro Ala Ser Arg
515 520 525
Pro Ile Ser Asp Ser Arg Arg Ile Tyr Glu Ser Arg Pro Arg Ser Gln
530 535 540
Ser Val Asn Ser Phe
545
<210> 5
<211> 16
<212> PRT
<213> Artificial sequence
<220>
<223> GFP11
<400> 5
Arg Asp His Met Val Leu His Glu Tyr Val Asn Ala Ala Gly Ile Thr
1 5 10 15
<210> 6
<211> 215
<212> PRT
<213> Artificial sequence
<220>
<223> GFP1-10
<400> 6
Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu
1 5 10 15
Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Arg Gly
20 25 30
Glu Gly Glu Gly Asp Ala Thr Ile Gly Lys Leu Thr Leu Lys Phe Ile
35 40 45
Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr
50 55 60
Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys
65 70 75 80
Arg His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu
85 90 95
Arg Thr Ile Ser Phe Lys Asp Asp Gly Lys Tyr Lys Thr Arg Ala Val
100 105 110
Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly
115 120 125
Thr Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr
130 135 140
Asn Phe Asn Ser His Asn Val Tyr Ile Thr Ala Asn Lys Gln Lys Asn
145 150 155 160
Gly Ile Lys Ala Asn Phe Thr Val Arg His Asn Val Glu Asp Gly Ser
165 170 175
Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly
180 185 190
Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Thr Val Leu
195 200 205
Ser Lys Asp Pro Asn Glu Lys
210 215

Claims (2)

1. A method of visualizing an internalization process, said method comprising the steps of:
(a) Providing a biological imaging system;
wherein the biometric imaging system comprises:
a conjugate conjugated to a first GFP fragment;
a cell expressing a second GFP fragment;
the first GFP fragment and the second GFP fragment can be assembled to form a functional GFP;
the conjugates include a peptide consisting of SEQ ID NO:1 an endocytic motif consisting of an amino acid sequence;
the conjugate further comprises a moiety for translocation into a cell, the moiety for translocation into a cell being a cell penetrating peptide;
the cell expresses a polypeptide consisting of SEQ ID NO:1 amino acid sequence of clathrin-related adaptor AP2 complex interacting with an endocytic motif;
and
(b) Contacting the conjugate with the cell.
2. A method of internalizing a drug into a cell for non-diagnostic and non-therapeutic purposes, said method comprising the steps of:
(a) Providing a conjugate and a cell; and
(b) Contacting the conjugate with the cell;
wherein the conjugate comprises a polypeptide consisting of SEQ ID NO:1 an endocytic motif consisting of an amino acid sequence;
the conjugate further comprises a moiety for translocation into a cell, the moiety for translocation into a cell being a cell penetrating peptide;
the conjugates also include a pharmaceutically or biologically active compound;
the cell expresses a polypeptide consisting of SEQ ID NO:1 amino acid sequence consisting of a clathrin-related adaptor AP2 complex with an interaction of endocytic motifs;
the cell is selected from the group consisting of a plant cell, a yeast cell, a fungus, an algae, or a cultured mammalian cell.
CN201780065902.5A 2016-10-24 2017-10-24 Compounds and methods for targeting molecules to specific cellular locations Active CN110036021B (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
SG10201608928QA SG10201608928QA (en) 2016-10-24 2016-10-24 Compounds and methods to target a molecule to a specific cellular location
SG10201608928Q 2016-10-24
PCT/SG2017/050533 WO2018080396A2 (en) 2016-10-24 2017-10-24 Compounds and methods to target a molecule to a specific cellular location

Publications (2)

Publication Number Publication Date
CN110036021A CN110036021A (en) 2019-07-19
CN110036021B true CN110036021B (en) 2023-04-11

Family

ID=62025316

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201780065902.5A Active CN110036021B (en) 2016-10-24 2017-10-24 Compounds and methods for targeting molecules to specific cellular locations

Country Status (3)

Country Link
CN (1) CN110036021B (en)
SG (1) SG10201608928QA (en)
WO (1) WO2018080396A2 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10254167A1 (en) * 2002-11-20 2004-06-09 Icon Genetics Ag Process for the control of cellular processes in plants
US8053638B2 (en) * 2006-08-07 2011-11-08 The Samuel Roberts Noble Foundation Method for agrobacterium-mediated transformation of plants

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Direct visualization of Agrobacterium-delivered VirE2 in recipient cells;Xiaoyang Li et al.;《The Plant Journal》;20140116;第77卷(第3期);摘要，第487页左栏第1段，第488页右栏第1段至第493页左栏第5段，图1-4 *
The carboxy-terminus of VirE2 from Agrobacterium tumefaciens is required for its transport to host cells by the virB-encoded type IV transport system;Mark Simone et al.;《Molecular Microbiology》;20010930;第41卷(第6期);第1283页摘要，第1286页左栏第1段至右栏第2段，第1288页左栏第1段至第1289页左栏第2段，第1291页左栏第2-3段，表1-2 *
Type IV secretion system single-stranded DNA-binding protein VirE2 [Agrobacterium tumefaciens]，GENBANK ACCESSION NO.: WP_012478091;无;《GENBANK》;20150526;FEATURE部分 *
无.Type IV secretion system single-stranded DNA-binding protein VirE2 [Agrobacterium tumefaciens]，GENBANK ACCESSION NO.: WP_012478091.《GENBANK》.2015, *

Also Published As

Publication number Publication date
CN110036021A (en) 2019-07-19
WO2018080396A3 (en) 2018-09-27
SG10201608928QA (en) 2018-05-30
WO2018080396A2 (en) 2018-05-03

Similar Documents

Publication Publication Date Title
Pitzschke et al. New insights into an old story: Agrobacterium‐induced tumour formation in plants by plant transformation
Li et al. Agrobacterium delivers VirE2 protein into host cells via clathrin-mediated endocytosis
Zaltsman et al. Agrobacterium induces expression of a host F-box protein required for tumorigenicity
JP6337771B2 (en) Methods for introducing nucleic acids into plant cells
Li et al. Direct visualization of A grobacterium‐delivered V ir E 2 in recipient cells
KR20110009197A (en) Bacterial toxin vaccine
US11279941B2 (en) Method for introducing protein into plant cell
AU2010360293B2 (en) Molecular interaction between Xa10 and AvrXa10
Li et al. Agrobacterium delivers anchorage protein VirE3 for companion VirE2 to aggregate at host entry sites for T-DNA protection
Tu et al. Real-time trafficking of Agrobacterium virulence protein VirE2 inside host cells
CN110036021B (en) Compounds and methods for targeting molecules to specific cellular locations
CN107936099B (en) LHAP1 protein and application of encoding gene thereof in regulation and control of plant photosynthesis
KR102000454B1 (en) Promoter recognition site by Xanthomonas oryzae pv. oryzae and uses thereof
US10526611B2 (en) Gene targeting using mutant Agrobacterium strains
US20160369286A1 (en) Compositions and methods for galls fl and galls ct mediated transformation of plants
CN110462045B (en) Marker, method and kit for observing influence of compound or drug on cells in real time and application of marker
CN110628807A (en) Salicornia europaea SePSS protein and coding gene and application thereof
Pant Cytoplasmic Sorting and Transport of Agrobacterium-Delivered Vire2 Inside Plant Cells
Tiwari et al. A tau class Glutathione-S-Transferase (OsGSTU5) acts as a negative regulator of VirE2 interaction with T-DNA during Agrobacterium infection in rice
JP4595631B2 (en) Method for producing transgenic cell, tissue or plant in which influence of selection marker gene is excluded
MacMillan Plant organelle targeting cell penetrating peptides
Roushan et al. Visualization of virulence protein translocation from Agrobacterium to yeast and plant cells using the split GFP approach
Roushan et al. Targeting Agrobacterium tumefaciens virulence proteins into the organelles of plant and yeast cells
XIAOYANG LIVE-TRACKING VIRE2 PROTEIN AND MOLECULAR ANALYSIS OF YEAST FACTOR PMP3P DURING AGROBACTERIUM-MEDIATED TRANSFORMATION
Khan et al. A GENERIC SPLIT-GFP-BASED REPORTER SYSTEM FOR AGROBACTERIUM-MEDIATED PROTEIN TRANSLOCATION IN PLANTS

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant