CN110036021A - Make the Compounds and methods for of molecular targeted specific cells position - Google Patents

Abstract

The present invention relates to peptides comprising is made up of: the amino acid sequence or (ii) of (i) SEQ ID NO:1 has the amino acid sequence with amino acid sequence at least 80% sequence identity of SEQ ID NO:1 over the whole length.The invention further relates to conjugate, host cell, biological imaging systems, the method for visualizing internalization process, the method for being internalized by drug into cell and conjugates of the invention to be used as the purposes of drug or conjugate of the invention as investigational agent.

Description

Make the Compounds and methods for of molecular targeted specific cells position

Technical field

The present invention relates to peptides comprising or be made up of: the amino acid sequence or (ii) of (i) SEQ ID NO:1 is at it There is the amino acid sequence with amino acid sequence at least 80% sequence identity of SEQ ID NO:1 in whole length.The present invention It further relates to conjugate, host cell, biological imaging systems, the method for visualizing internalization process, be internalized by drug into cell Method and conjugate of the invention are used as drug or investigational agent.

Background technique

Oncogenicity T-DNA and being transferred in plant cell in various plants by Agrobacterium tumefaciems (A.tumefacien) On cause crown gall nodule (1-3).In laboratory conditions, which can be transferred to T-DNA in other eukaryon species, including ferment The human cell (8) of female (4,5), fungi (6), algae (7) and culture.It has been developed as DNA delivery vector, DNA delivering Carrier is widely used as genetic engineering (10) of the main force for plant (9) and non-plant organisms.

It is thin by being made of VirB/VirD4 during conversion (AMT) that Agrobacterium (Agrobacterium) is mediated Bacterium IV type excretory system (T4SS), Agrobacterium tumefaciems into host cell (11,12) by T-DNA and bacterial virulence protein delivery. Agrobacterium VirBA/VirD4T4SS is the typical case of T4SS race, is widely used by bacterium with by DNA (13,14) and protein Macromolecular (15) transposition is to various bacteria and eukaryocyte (16).Agrobacterium T4SS device is made of 12 kinds of bacterial virulence albumen, Including VirB1-11 and VirD4, they form the more subunit's transmembrane channels (17) being delivered to macromolecular in host cell.

Agrobacterium T4SS will at least 5 kinds of protein substrates be delivered in host cell；These include VirD2, VirD5, VirE2, VirE3 and VirF (18-20).Evidence suggests these bacterium effectors are exported dependent on its C-terminal electrical signals Into host cell (19).In delivering, these effector albumens act synergistically in host cell, and promote conversion process. Have shown that host factor and these effectors interact, and most important (21) to successful conversion.

T-DNA is generated by the VirD2 albumen for playing endonuclease in bacterial cell, as from Ti-plasmids Single-stranded (ss) DNA molecular (22-24).VirD2 keeps covalently being associated with the 5 ' ends of T-DNA, and passes through T4SS for this side Formula imports in host cell (23).In host cell matter, then by the VirE2 of T4SS delivering, (it is exposed T-DNA SsDNA binding protein) coating, it is formed T compound (25-27).VirD2 and VirE2 includes and host's input albumen α albumen phase Functional core positioning signal (NLS) sequence (28) of interaction.They can act synergistically for T compound in host cell Core input.

As a kind of effector albumen abundant being secreted into recipient cell, VirE2 during conversion process for being permitted Other more processes are also vital.It is special that in vitro study shows that VirE2 forms valtage-gated and ssDNA on artificial membrane Anisotropic channel shows that it may promote T-DNA to enter host cell (29).Due in the host cell matter VirE2 to cooperate Mode and T chain combination, thus it can protect T-DNA from molten core degraded (nucleolytic degradation) (30, 31).As the main component of T compound, VirE2 transports the destiny that will affect T chain.

Verified VirE2 participate in two different ways the core target of T-DNA to.Firstly, in VirE2 molecule Two independent NLS sequences are identified, are participated in direct mutual with arabidopsis (Arabidopsis) input albumen αisomer It acts on (28).Secondly, VirE2 can also interact (32) with plant transcription factor VIP1；The host protein undergoes MAPK3 to be situated between The phosphorylation and the core transposition infection induced by Agrobacterium led, this may cause the core input of VirE2, so as to cause T chain Core inputs (33,34).

In host cell nuclear, VIP1 can interact with host's histone, and it is multiple that this interaction is advantageously possible for T Close object targeting host's chromatin (34).In addition, VirE2 can interact with another host protein VIP2, VIP2 is a kind of The transcription inhibitory factor of presumption is located at plant nucleolus (35).Stable conversion to the needs of VIP2 show VirE2 and VIP2 it Between interaction T chain may be promoted to be integrated into host genome (35).

Therefore, in drug development and life science, molecule or drug targeting to intracellular specific position is made to be It is important and challenging.In the presence of the constant demand to technology, these technologies are conducive to introduce molecule or drug passes through cell Plasma membrane enters in cell, and is introduced into specific desired position.

Detailed description of the invention

When in conjunction with non-limiting example and attached drawing to consider, the present invention is better understood with reference to detailed description.

Fig. 1 shows VirE2 and the host plasma membrane of Agrobacterium delivering and being associated with for endocytosis film bubble.(A) between different time Every the intracellular VirE2 of detection Ben Saimushi tobacco (N.benthamiana).Agrobacterium tumefaciems EHA105virE2::GFP11 quilt It penetrates into transgenosis Ben Saimushi tobacco (Nb308A) leaf of expression GFP1-10 and DsRed.32 hours after agroinfiltration The Z image series of projection were obtained with 48 hours.(B) cytoplasm of the VirE2 in the tobacco cell contacted with Agrobacterium tumefaciens cell It is accumulated at side.The Agrobacterium tumefaciens strain EHA105virE2::GFP11 (pGFP 1-10 and pVBA-RFP) marked with DsRed (it can also deliver VirE2-GFP11 and express the T-DNA of GFP1-10) penetrates into wild type Ben Saimushi Tobacco Leaf.In agriculture bar 2 days acquisition images after bacterium is penetrated into.(C) VirE2 of Agrobacterium delivering is accumulated at host plasma membrane.With mixed uniformly crown gall agriculture bar Bacteria strain EHA105virE2::GFP11 (pGFP1-10) (it can deliver VirE2-GFP11 and express the T-DNA of GFP1-10) And (it can deliver VirE2-GFP11 and express the T- of plasma membrane (PM) tracker EHA105virE2::GFP11 (pm-rb) DNA wild type Ben Saimushi Tobacco Leaf) is penetrated into.2 days acquisition images after agroinfiltration.(D) agriculture bar in Tobacco Epidermis The plasma membrane (above) of VirE2 and the FM4-64 label of bacterium delivering or the common location of endocytosis film bubble (following figure).With Agrobacterium tumefaciems bacterium Strain EHA105virE2::GFP11 (pGFP 1-10) penetrates into wild type Ben Saimushi Tobacco Leaf, is then dyed with FM4-64.In agriculture 2 days acquisition images after bacillus is penetrated into.Scale bar, 10 μm.

Fig. 2 shows that Agrobacterium accumulates at the space between cells of the leaf epidermal cell of infiltration.(A) crown gall marked with GFP The Z series of the projection of Ben Saimushi tobacco (Nb308A) leaf that agrobatcerium cell EHA105 (pVB-GFP) penetrates into.With Olympic Under the Laser Scanning Confocal Microscope of Bath UAPO N 340 40 × N.A.1.15 water immersion objective, schemed within 2 days after agroinfiltration Picture.White line is added in image, indicates the boundary between leaf epidermal cell.(B) the crown gall agriculture marked with mixed uniformly GFP The wild type that the Agrobacterium tumefaciens cell EHA105 (pVB-RFP) of bacilli-cell EHA105 (pVB-GFP) and DsRed label penetrates into The Z series of the projection of Ben Saimushi Tobacco Leaf.Scale bar, 20 μm.

Fig. 3 shows total movement of the endocytosis film bubble of VirE2 and FM4-64 label in Ben Saimushi Tobacco Epidermis. Wild type Ben Saimushi Tobacco Leaf is penetrated into Agrobacterium tumefaciens cell EHA105virE2::GFP11 (pGFP1-10), is then carried out FM4-64 dyeing.2 days acquisition images after agroinfiltration.Scale bar, 20 μm.

Fig. 4 shows that the interference to host's endocytosis compromises VirE2 and transports and reduce its virulence.(A) defective The expression of clathrin Hub compromise VirE2 and leave plasma membrane.With Agrobacterium tumefaciens strain EHA105virE2::GFP11 (pXY01) or EHA105virE2::GFP11 (pXY01-Hub) (its can deliver VirE2-GFP11 and express Hub T-DNA) Penetrate into Ben Saimushi tobacco (Nb308A) leaf.The Z image series of projection are obtained within 4 days after agroinfiltration.Scale bar, 20 μm. (B) VirE2-GFP for being retained in host cell boundary is measured in each image_CompoundThe intensity of signal, n: the image of measurement Quantity.(C) ES1 processing reduces the core accumulation of VirE2 in plant epidermis cell.Individually with EHA105virE2::GFP11 or with ES1 penetrates into Ben Saimushi tobacco (Nb308A) leaf together.Amplify blocked areas to protrude nucleus.2 days after agroinfiltration Obtain the Z image series of projection.Scale bar, 20 μm.(D) VirE2-GFP is measured in each host cell nuclear_CompoundSignal it is strong Degree, n: the nucleus amount of measurement.(E) ES1 or tyrphostin A23 processing reduces swollen on arabidopsis root Tumor occurs.Chemically treated arabidopsis root and agrobacterium strains A348 are co-cultured, and are used for tumour.(F) tumour forms frequency Quantify.P < 0.01 * (non-matching T inspection).

Fig. 5 shows that the expression of Hub compromises FM4-64 in Ben Saimushi Tobacco Epidermis and absorbs.(A) crown gall agriculture is used Bacilli-cell EHA105 (pXY01) or EHA105 (pXY01-Hub) penetrates into wild type Ben Saimushi Tobacco Leaf, then in Agrobacterium Progress FM4-64 dyeing in 2nd day or the 4th day after infiltration.5 hours after dyeing, with Olympus UAPO N 34040 × Under the Laser Scanning Confocal Microscope of N.A.1.15 water immersion objective, the Z image series of projection are obtained.Scale bar, 20 μm.(B) FM4-64 takes the photograph What is taken quantifies.The number (n=20) of the endocytosis film bubble of FM4-64 dyeing is calculated in each image.(the non-matching T inspection of p < 0.01 * It tests).

Fig. 6 shows that the expression of the clathrin Hub of dominant negative effect compromises VirE2 in Ben Saimushi Tobacco Epidermis Leave plasma membrane.(A) wild type Ben Saimushi tobacco is penetrated into Agrobacterium tumefaciens cell EHA105virE2::GFP11 (pXY01) Leaf.(B) wild type Ben Saimushi Tobacco Leaf is penetrated into Agrobacterium tumefaciens cell EHA105virE2::GFP11 (pXY01-Hub). Show the Z image series of projection.Scale bar, 20 μm.

Fig. 7 shows that ES1 processing influences early endosome and VirE2 transport.(A) ES1 processing leads to Ben Saimushi Tobacco Leaf The aggregation of inner body in epidermal cell comprising SYP61.Individually with Agrobacterium tumefaciens cell EHA105 (pXY01-SYP61-mC) or It is mixed with ES1 (25 μM) and penetrates into wild type Ben Saimushi Tobacco Leaf.In control, the SYP61-mCherry of transient expression is marked Round early endosome in Ben Saimushi Tobacco Epidermis.Aggregation (the arrow of inner body of the ES1 processing induction comprising SYP61 It is shown).(B) aggregation of the inner body comprising SYP61 limits the transport of the VirE2 in Ben Saimushi Tobacco Epidermis.With uniform Mixed Agrobacterium tumefaciens cell EHA105virE2::GFP11 (pGFP1-10) and EHA105virE2::GFP11 (pXY01- SYP61-mC wild type Ben Saimushi Tobacco Leaf) is penetrated into together with chemical effect object ES1.It obtains within the 2nd day after agroinfiltration The Z image series of projection.Scale bar, 20 μm.

Fig. 8 shows that the mutation at VirE2 endocytosis motif affects VirE2 and is internalized by and compromises turning for mediated by agriculture bacillus Change.(A) exemplary locations of the endocytosis motif of VirE2 presumption are reflected by the eukaryon linear motif resource of functional site in protein Fixed (www.ELM.eu.org).The constant amino acid tag of endocytosis motif is red.(B) in double endocytosis motifs of the end VirE2C The mutation at place influences VirE2 and is internalized by into host cell.With Agrobacterium tumefaciems EHA105virE2::GFP11 or include alanine The mutant strain of corresponding tyrosine is replaced to penetrate into Ben Saimushi tobacco (Nb308A) leaf.It obtains within the 2nd day after agroinfiltration The Z image series of projection.Scale bar, 20 μm.(C) percentage of the VirE2 rested at cell boundaries is expressed as, thin with host The relevant VirE2-GFP in born of the same parents boundary_CompoundIntensity divided by the overall strength in each image, n: the quantity of the image of measurement.(D) exist Mutation at double endocytosis motifs of the end VirE2C reduces instantaneous conversion efficiency.With Agrobacterium tumefaciems EHA105 or include binary The mutant strain of carrier pQH121-mC (the free mCherry of CaMV 35S promoter control in T-DNA) penetrates into wild type sheet Fill in Mu Shi Tobacco Leaf.Under the Laser Scanning Confocal Microscope with Olympus UPL SAPO N 10 × N.A.0.40 object lens, in agriculture bar Bacterium obtains the Z image series of projection for 2 days after penetrating into.The single opticator of light field is shown, with indicator cells shape (following figure). Scale bar, 50 μm.(E) intensity of the mCherry of transient expression, n: the quantity of the image of measurement are measured in each image.(F) Mutation at double endocytosis motifs of the end VirE2C reduces stable transformation efficiency.Agrobacterium tumefaciems A348 and mutant strain It is formed and is measured for tumour.(G) tumour forms quantifying for frequency.* p < 0.01 p < 0.05, * * (non-matching T inspection).

Fig. 9 shows that the mutation at the VirE2 endocytosis sorting motif of other presumptions does not influence the VirE2 in host cell Internalization.Ben Saimushi tobacco (Nb308A) leaf is penetrated into Agrobacterium tumefaciems EHA105virE2::GFP11 or VirE2 mutant, In corresponding tyrosine residue or leucine residue replaced by alanine.The Z series of drawing of projection is obtained within 2 days after agroinfiltration Picture.Scale bar, 20 μm.

Figure 10 shows the sequence alignment analysis of the VirE2 from different types of Ti-plasmids.Sequence alignment shows coming From the VirE2 albumen of different types of Ti-plasmids, the endocytosis motif of double tyrosine-baseds is conservative at C-terminal.

Figure 11 is shown to be weakened in the interaction of endocytosis motif and plant AP2M and ap2m mutation of the end VirE2C Tumour generation.(A) VirE2C terminal tail and AP2M interact.VirE2C terminal tail (the GST- that will be fused on GST VirE2C) for being pulled down (pull-down) test in vitro, AP2M loading (cargo) binding structural domain is fused on MBP (MBP-AP2MC).Input (following figure) part of (above) and 20% is pulled down by western blot analysis.Free MBP and MBP-AP2MC fusion protein adds asterisk.(B) double mutation at double endocytosis motifs eliminate VirE2C terminal tail and AP2M is carried Interaction between object binding structural domain.Input (following figure) portion of (above) and 20% is pulled down by western blot analysis Point.The fusion of MBP-AP2MC adds asterisk.(C) in root conversion test, arabidopsis ap2m-1 and ap2m-2 mutation reduce tumour hair It is raw.(D) tumour forms quantifying for frequency.P < 0.01 * (non-matching T inspection).PD: drop-down；IB: immunoblotting.

Specific embodiment

It is an object of the invention to meet the Compounds and methods for of molecular targeted specific cells position by providing Above-mentioned needs., it is surprising that inventor has found that the internalization of VirE2 is the particular sequence motif as described in SEQ ID NO:1 It mediates.The conjugation of the motif and other molecular radicals (such as drug) will mediate the internalization of conjugate.In addition, the motif allows It establishes visualization internalization and drug is internalized by the method into cell.

In a first aspect, present invention is accordingly directed to peptides comprising or be made up of: the amino acid of (i) SEQ ID NO:1 Sequence or (ii) have the amino with amino acid sequence at least 80% sequence identity of SEQ ID NO:1 over the whole length Acid sequence.

In the various embodiments of the present invention, the length of the peptide is 10 to 200 amino acid.In alternate embodiment In, peptide of the invention is by being no more than 500 amino acid, no more than 450 amino acid, no more than 400 amino acid, being no more than 350 amino acid are no more than 300 amino acid, are no more than 250 amino acid, are no more than 200 amino acid, are no more than 150 Amino acid is no more than 100 amino acid, is no more than 80 amino acid, is no more than 50 amino acid or is no more than 30 amino acid Composition.In other embodiments, the length of the peptide is 10 to 100 amino acid, length is 15 to 130 amino acid, length Degree is 20 to 170 amino acid or length is 30 to 210 amino acid.

The scope of the present invention further includes various embodiments, wherein amino acid sequence has and SEQ over the whole length The amino acid sequence of ID NO:1 at least 85%, at least 87%, at least 90%, at least 93%, at least 95%, at least 97% or extremely Few 99% sequence identity.

On the other hand, the present invention relates to conjugates comprising peptide of the invention, wherein the peptide further includes at least one Funtion part.

In the various embodiments of the present invention, the N-terminal of at least one described funtion part and the peptide is conjugated.

The scope of the present invention further includes various embodiments, wherein the end the C of at least one described funtion part and the peptide End conjugation.

In the various embodiments of above-mentioned aspect, at least one described funtion part does not include described in SEQ ID NO:2 Amino acid sequence or its C-terminal segment.

On the other hand, the present invention relates to conjugate of the invention, it is specified that at least one described funtion part does not include SEQ Amino acid sequence described in ID NO:3 or its N-terminal segment.

In the various embodiments of the present invention, wherein funtion part is pharmaceutically or biologically active ingredient Object.

The scope of the present invention further includes various embodiments, and wherein funtion part further includes or green fluorescent protein (GFP) or its segment.

In the various embodiments of the present invention, the conjugate further includes at least one for translocating to the portion in cell Point.In a more preferred embodiment, the part for translocating in cell is the C-terminal sequence of VirE2.Even more In preferred embodiment, the part for translocating in cell includes R-X₍₇₎The sequence of-R-X-R-X-R-X-X or by R-X₍₇₎The sequence of-R-X-R-X-R-X-X forms, and wherein X is any Proteinogenic amino acids, and R is arginine.In addition preferred In embodiment, the part for translocating in cell is cell-penetrating peptides or reagent.

In the third aspect, the present invention relates to a kind of carriers comprising encodes the nucleotide sequence of peptide of the invention.

On the other hand, the present invention relates to a kind of host cells comprising carrier of the invention.

At the 5th aspect, the present invention relates to the biological imaging systems for visualizing internalization comprising (a) is of the invention to be sewed Object is closed, is conjugated with the first GFP segment；(b) cell expresses the 2nd GFP segment, wherein the first GFP segment and the 2nd GFP Segment can assemble to form functional GFP.

In the various embodiments of the present invention, the conjugate of (a) (a) is conjugated with according to the peptide of SEQ ID NO:5；With/ Or (b) cell expresses the peptide according to SEQ ID NO:6.

The scope of the present invention further includes various embodiments, wherein cell be selected from by plant cell, yeast cells, fungi, The group of the mammalian cell of algae or culture composition.In preferred embodiments, cell is plant cell.

In the various embodiments of above-mentioned aspect, it is multiple that cell expresses relevant adapter (adaptor) AP2 of clathrin Fit (AP2M).

On the other hand, the present invention relates to a kind of methods for visualizing internalization process comprising: it (a) provides of the invention Biological imaging systems；(b) conjugate is made to be in contact with cell.

At the 7th aspect, the present invention relates to be internalized by drug to intracellular method comprising: it (a) provides of the invention Conjugate and cell；(b) conjugate is made to be in contact with cell.

At the 18th aspect, the present invention relates to conjugates of the invention to be used as drug.

Purposes in terms of the last one, the present invention relates to conjugate of the invention as investigational agent.

As used herein, "at least one" is related to one or more, and particularly 1,2,3,4,5,6,7,8,9,10 or more It is a.

Example

Material and method

Bacterial strain, plasmid and growth conditions

Bacterium bacterial strain used in this research and plasmid are listed in table 1.Agrobacterium tumefaciens strain is at 28 DEG C in LB (Luria-Bertani) it is grown in culture medium.When necessary, 100 μ g ml are supplemented in the medium^-1Carbenicillin or 50 μ g ml^-1Kanamycins.

Vegetable material

Arabidopsis (environmental, Colombia -0) wild type and mutant plant are used in root conversion test.AP2M insertion Mutant, ap2m-1 (SALK_083693) and ap2m-2 (CS807972) obtained from Ohio State University arabidopsis Biological Resource Center.

Ben Saimushi benthamiana wild-type and transgenosis system Nb308A (expression GFP1-10 are used in agroinfiltration test And DsRed) (36).

Construct

GFP1-10 construct

In order to construct the binary vector (pXY01) for expression of target gene in plant cell, with 5 '-CTAGTCT of primer sets AGACCCGGGCTCGAGCCATGGGGATCCGAGCTCGAATTTCCCCGATCGTTCAAACATTTGGCA ATAAAGTTT-3’ Binary vector skeleton is expanded from plasmid er-gb (37) with 5 '-CTAGTCTAGAGCTAGCTCCGGACTTAAGA, to generate DNA piece Section, wherein ER marker box is replaced by multiple cloning sites sequence；Then PCR product is digested with XbaI, and self connection is to generate Binary vector pXY01.

With primer 5 '-CTAGTCTAGAATGGTTTCGAAAGGCGAGGA-3 ' and 5 '-CGCGGATCCTTATTTCTCGTT TGGGTCTTTGC-3 ' expands GFP1-10 coded sequence from pQH308A (36), and is inserted into pXY01 to generate pGFP1-10.

The construct of Agrobacterium label

With primer sets 5 '-ACGCGTCGACCTCGAGGGGGG-3 ' and 5 '- ACGCGTCGACTCTCAGTAAAGCGCTGGCTG-3 ' expands skeleton (59) from pCB301；Then PCR product is digested with SalI, And self connection, to generate pXY301, pXY301 lacks T-DNA right border sequence.With 5 '-ACGCGTCGACATGGGTTT of primer ACAGACAGCGTAATCTC-3 ' and 5 '-ACCTTATCTCCTTAGCTCGCAAC-3 ' expands virB promoter from plasmid pTiA6 Area, and be cloned into pXY301 to generate pVB.With primer 5 '-CGGGGTACCATGGCCTCCTCCGAGGACG-3 ' and 5 '- CGGGGTACCTTACAGGAACAGGTGGTGGCG-3 ' expands DsRed coded sequence, and is cloned into pVB to generate pVB- RFP.With primer 5 '-CGGGGTACCATGTCTAAAGGTGAAGAATTATTCACTG-3 ' and 5 '-CGGGGTACCTTATTTGTA CAATTCATCCATACCATG-3 ' expands GFP coded sequence, and is cloned into pVB to generate pVB-GFP.Then primer 5 '-is used ATGCAATCATGATTCAAATATGTATCCGCTCAAGAGA-3 ' and 5 '-ATGCAATCATGACTCACGTTAAGGGATTTTG GACAT-3 ' expands amicillin resistance box from pACT2 (Clontech), and is inserted into pVB-RFP and replaces kanamycins anti- Property box is to generate pVBA-RFP.

Hub construct

With primer 5 '-TCCCCCCGGGATGAAGAAGTTTAACTTAAATGTTCAGGCTG-3 ' and 5 '- C of the CGCGGATCCTTAGTAGCCGCCCATCGGT-3 ' from full arabidopsis cDNA prepared product amplification coding CHC1 (At3g1130) The 1860bp DNA fragmentation of end section.PCR fragment is cloned into generate pXY01-Hub in carrier pXY01, wherein at Hub Under the control of CaMV 35S promoter.

SYP61 construct

In order to mark early endosome, with primer 5 '-CTAGTCTAGAATGTCTTCAGCTCAAGATCCATTCT-3 ' and 5 '- Overall length base of the CCGCTCGAGGGTCAAGAAGACAAGAACGAATAGG-3 ' from arabidopsis thaliana genomic dna amplification arabidopsis SYP61 It because of a group sequence (Atlg28490), and is cloned into binary vector pXY01, so that SYP61 is in the control of CaMV 35S promoter Under.Then use primer 5 '-CCGCTCGAGGGAGGTGGCTCTGGCGGGGGATCAATGGTGAGCAAGGGCGAGGA-3 ' and 5 '- CGCGGATCCTTACTTGTACAGCTCGTCCATGCCG-3 ' expands mCherry coded sequence, by PCR fragment at C-terminal gram It is grand to generate pXY01-SYP61-mC.

Instantaneous mCherry expression construct

With primer 5 '-CCGCTCGAGATGGTGAGCAAGGGCGAGGA-3 ' and 5 '-CGGGGTACCTTACTTGTACAGC TCGTCCATGCCG-3 ' expands mCherry coded sequence, and is cloned into binary vector pQH121 to generate pQH121-mC, Wherein mCherry is under the control of CaMV 35S promoter.

Pull down construct

With primer 5 '-CGCGGATCCTCACCATTTTCATCGAAGCCA-3 ' and 5 '-CTAGTCTAGATCAGCATCTGA 295 amino acid C-terminal loading binding structural domains of the TCTCGTAAGATCCC-3 ' from arabidopsis cDNA amplification μ 2- subunit Coded sequence (AP2M)；PCR fragment is cloned into carrier pMAL-c2x (knob Great Britain biotechnology) to generate pMBP-AP2MC.

With primer 5 '-CGCGGATCCATCGTCGCCGATCGCAA-3 ' and 5 '- 76 amino acid C-terminals of the CCGCTCGAGTCAAAAGCTGTTGACGCTTTG-3 ' from pTibo542 (EHA105) amplification VirE2 The coded sequence of tail portion；PCR fragment is cloned into vector pGEX -4T-1 (General Electric's Medical Group) to generate pGST- VirE2C。

Agroinfiltration method

Agrobacterium tumefaciens cell is grown overnight in LB；Then culture is diluted in LB culture medium to 50 times, go forward side by side one One-step growth 5-6 hours.Unless otherwise stated, collecting bacterium and being resuspended in water to OD₆₀₀=1.0.It will be thin using syringe Bacterium suspension penetrates into the downside of complete depletion of Ben Saimushi Tobacco Leaf.Then the plant of infiltration was placed in 22 DEG C at 16 hours Under the dark photoperiod of illumination/8 hour.

The VirE2 of Agrobacterium delivering is detected in Ben Saimushi tobacco

Use the VirE2 (36) of the division GFP system detection Agrobacterium delivering.Use the Agrobacterium tumefaciems bacterium of label Strain EHA105virE2::GFP11 expresses VirE2-GFP11 fusion in bacterium.Use transgenosis system Nb308A or use Agrobacterium tumefaciens strain comprising binary plasmid pGFP1-10 carries out transient expression to express GFP1-10 in plant cell.

Detect plasmalemma of plant and early endosome

By separately including binary matter with the transient expression detection plasma membrane or early endosome, the bacterial strain of Agrobacterium tumefaciens strain Grain pm-rb (37), binary plasmid pm-rb include the T-DNA or pXY01-SYP61-mC of coding plasma membrane markers object, pXY01- SYP61-mC includes the T-DNA of coding early endosome marker SYP61.

FM4-64 dyeing

By in distilled water the FM4-64 (hero's life technology Co., Ltd, the U.S.) of 25 μM of concentration penetrate into Ben Saimushi In the downside of Tobacco Leaf.1 hour shooting image after infiltration.

Transient transformation assay

By Agrobacterium tumefaciems EHA105 or comprising the mutant strain of pQH121-mC, with low concentration (OD₆₀₀=0.005) it penetrates into Into wild type Ben Saimushi Tobacco Leaf, pQH121-mC includes the T-DNA of coding mCherry.It obtains within 2 days after agroinfiltration Image is obtained, and is used for Strength co-mputation.

Stable conversion test

Surface sterilizing is carried out to arabidopsis wild type or mutation seed (Colombia -0) using 15% bleaching agent solution, and It is incubated for 2 days at 4 DEG C.Then seed is placed on cured 1/2 × MS culture medium and (is supplemented with 1% sucrose and 0.5g L^-1MES, PH 5.8) on, and be incubated for 10-12 days under the dark photoperiod of 16 hours illumination/8 hour in 22 DEG C.Single seedling will be come from Root be cut into 3-5mm sections, and with 1ml concentration 1 × 10⁸Cell/ml Agrobacterium tumefaciens cell (A348 or mutant) mixing, and It is layered on cured 1/2 × MS plate.Then plate is incubated for 36 hours at 22 DEG C.Root segment is being included into 100 μ g ml^-1Head It compares, and is maintained at 22 DEG C 5-6 weeks on 1/2 × MS culture medium flat plate of spore thiophene oxime.

Chemical treatment

Agrobacterium tumefaciens cell is grown in water, and cell concentration is adjusted to OD₆₀₀=0.5；ES1 is added to cell In suspension, until final concentration of 25 μM.Then mixture is penetrated into Ben Saimushi Tobacco Leaf.As control, by crown gall agriculture bar The suspension of bacterium cell in water individually penetrates into Ben Saimushi Tobacco Leaf.Then the plant of infiltration is placed in 22 DEG C small 16 Under the dark photoperiod of Shi Guangzhao/8 hour.

During stable conversion test, the arabidopsis root from single seedling is cut into 3-5mm sections, and with ES1 or junket Propylhomoserin phosphorylation inhibitor A23 (Sigma) mixing, until ultimate density in water is respectively 60 μM or 50 μM, it then will mixing Object is kept 3 hours in the dark.As control, water process root segment is only used.Then root segment is mixed with Agrobacterium tumefaciems, for such as The upper root conversion test.

External drop-down test

Fusion protein is generated using BL21 (DE3) coli strain.The single colonie of cell is inoculated into LB meat soup, Overnight growth at 37 DEG C.Then cell culture is diluted in fresh LB meat soup to OD₆₀₀=0.1, and in 28 DEG C of regrowths 1.5 hours, until OD₆₀₀=0.6.Then with the thio galactolipin glucosides (IPTG) of isopropyl ss-D-1- of ultimate density 1mM 28 Induced fusion protein expression 6 hours at DEG C.

By at 4 DEG C with 5000g be centrifuged 5 minutes harvest bacterial cells, and with pull down lysis buffer (50mM TrisHCl, 50mM NaCl, pH 7.5) it washed once.Then cell is resuspended in comprising protease inhibitor cocktail In the drop-down lysis buffer of (Nacalai Tesque), and carry out simple ultrasonic (20 seconds 12 times, 40% power).By 15 minutes removal cell fragments are centrifuged with 12000g at 4 DEG C.

On rotator, by the supernatant of bait protein (protein of MBP or MBP label) with 150 μ l amylose trees Rouge (knob Great Britain biotechnology) is incubated for 3 hours at 4 DEG C.Then with drop-down washing buffer (50mM TrisHCl, 50mM NaCl, 0.5%Triton X-100, pH 7.5) column scrubber 5 times.

The supernatant for preying on albumen (prey protein) (protein of GST label) is added to comprising fixed MBP mark In the column of the bait protein of note, and it is incubated overnight on rotator in 4 DEG C.Then it with drop-down washing buffer column scrubber 5 times, uses The protein of drop-down lysis buffer elution capture comprising 10mM maltose.

Immunoblotting is carried out with anti-MBP antibody (sc-809, Santa Cruz biotechnology) to detect the albumen of MBP label Matter, and immunoblotting is carried out with anti-GST antibody (sc-459, Santa Cruz biotechnology) to detect the protein of GST label.

Laser Scanning Confocal Microscope

PerkinElmer over the horizon roating plate system (Ultra View Vox Spinning with EM-CCD camera Disk system) it is used for Laser Scanning Confocal Microscope.Unless otherwise stated, 2 days observation agroinfiltrations after agroinfiltration Ben Saimushi Tobacco Leaf.In order to observe leaf epidermis, the leaf texture of agroinfiltration is separated from Ben Saimushi tobacco plant, And in the water immersed on the glass slide with coverslip.All images by3D rendering is analyzed at software 6.2.1 Reason.Unless otherwise stated, all images are in being total to Olympus UPLSAPO 60 × N.A.1.20 water immersion objective It is obtained under focusing microscope.

Fluorescence intensity quantifies

Fluorescence intensity (http://rsbweb.nih.gov/ij/) is measured using ImageJ.

Statistical analysis

Quantitative data is indicated with the average value ± SEM from least three independent experiments.Where appropriate, being examined using non-matching T Test the statistical difference between analysis group.Think that difference is significant when P < 0.05.

1., table experiments bacterial strain and plasmid used

Example 1: VirE2 and host plasma membrane is associated with when delivering

In order to make VirE2 delivering visualization, VirE2-GFP11 fusion is expressed in Agrobacterium tumefaciems, and thin in plant GFP1-10 is expressed in born of the same parents.It, will be complementary by VirE2-GFP11 and GFP1-10 after VirE2-GFP11 is delivered in plant cell The VirE2-GFP of generation_CompoundFluorescence signal visualizes (36).

Firstly, observing that VirE2 is delivered in tobacco cell in early stage；Come using the bacterial strain EHA105 of no T-DNA Avoid any potential complication caused by transporting due to T-DNA.Generate the Agrobacterium tumefaciems of VirE2-GFP11 EHA105virE2::GFP11 is penetrated into transgenosis Ben Saimushi tobacco (Nb308A) leaf of expression GFP1-10 and DsRed.? Under Laser Scanning Confocal Microscope, VirE2 is detected in different time points and is delivered in tobacco cell.As shown in Figure 1A, in agroinfiltration 32 hours afterwards, a small amount of VirE2 began to appear in tobacco cell boundary (above).Over time, in cell boundaries Observe more VirE2 in place；VirE2 signal becomes Filamentous.48 hours after agroinfiltration, most of tobacco cells are thin VirE2 accumulation (Figure 1A following figure) is shown in karyon.Statistics indicate that VirE2 primarily occur ins tobacco cell boundary, then move It is dynamic to enter in nucleus.

It is then determined that the extensive positioning of Agrobacterium tumefaciens cell within plant tissue.Construct bacterial cell, with GFP is expressed under the control of virB promoter, therefore they are fluorescently labeled naturally during agroinfiltration.It is marked in GFP Agrobacterium tumefaciens cell EHA105 (pAT-GFP) penetrate into Ben Saimushi Tobacco Leaf in after, observe that most of bacterial cells exist (Fig. 2A) is arranged at the space between cells of the tobacco cell of agroinfiltration.Then the bacterial cell of GFP label and DsRed are marked Bacterial cell uniformly mix；Mixture is penetrated into Ben Saimushi Tobacco Leaf；Observe bacterial cell at space between cells with Separated individual cells close-packed arrays (Fig. 2 B).These show that the limited space between cells of Ben Saimushi Tobacco Epidermis is only capable of holding Receive single bacterial cell, and space limitation may only allow the side of bacterium and host cell to be in close contact.

Then the relative positioning of Agrobacterium tumefaciens cell with the VirE2 being delivered in plant cell is determined.It is marked with DsRed (it can also deliver VirE2- to the Agrobacterium tumefaciens strain EHA105virE2::GFP11 (pGFP1-10 and pVBA-RFP) of note The T-DNA of GFP11 and expression GFP1-10) penetrate into wild type Ben Saimushi Tobacco Leaf.48 hours after agroinfiltration, VirE2 (Figure 1B) is accumulated in the cytoplasm side for the tobacco cell being in close contact with Agrobacterium tumefaciens cell.It is interesting that VirE2 is from bacterium The two sides of cell are delivered in plant cell.This shows that VirE2 can be delivered to two adjacent hosts simultaneously by single bacterium In cell.

In order to determine subcellular location of the VirE2 in host cell of Agrobacterium delivering, by by with delivering VirE2- The T-DNA of the identical bacterial cell delivering of GFP11, the expression specificity plasmalemma of plant tracker (37) in plant cell.It was found that The VirE2 of Agrobacterium delivering and the plasma membrane tracker common location (Fig. 1 C) of transient expression show that VirE2 and plant are thin in delivering Cytoplasmic membrane is associated.

Example 2: the VirE2 of Agrobacterium delivering is associated with endocytosis film bubble

In order to study how the VirE2 of film combination is moved in cytoplasm, marked using fluorescence styryl dye FM4-64 Remember film, then monitoring dynamic (38).This dyestuff is lipophilic；In the place of its application, it can be with label film, but own Film cannot be penetrated.The transportational process that the attribute will allow us to monitor the film of VirE2 combination.By Agrobacterium tumefaciems EHA105virE2::GFP11 cell penetrates into Ben Saimushi Tobacco Leaf, to start VirE2 delivering；After 48 hours, then will FM4-64 dyestuff penetrates into same area.As shown in figure iD, the plasma membrane common location (above) of VirE2 and FM4-64 label, mode Similar to using plasma membrane tracker (Fig. 1 C).It is interesting that the endocytosis film bubble common location that VirE2 is also marked with FM4-64, from Plasma membrane pinch off (Fig. 1 D following figure).

In addition, even if when FM4-64 label film bubble moved in cytoplasm when, VirE2 and FM4-64 label endocytosis film The common location of bubble continues to (Fig. 3).Movement speed range is 0.4 to 2.1 μm/second, this and the inner body reported in previous research Dynamics is consistent (39).Statistics indicate that the VirE2 being delivered on host plasma membrane can carry out cell internalizing using host's endocytosis And Cytoplasm Activity.

Example 3: effective VirE2 transport needs endocytosis

Then, whether the internalization for having checked VirE2 albumen needs host's process of endocytosis.It is reported that plant endocytosis is made It is that (40) are mediated by clathrin triskelion with process；The overexpression meeting of the C-terminal part of clathrin heavy chain (Hub) Cause to act on clathrin-mediated endocytosis (CME) strong dominant negative interaction, clathrin heavy chain and clathrin light-chain In conjunction with and consume clathrin light-chain (41-43).

Then we test the influence of the overexpression Hub in Ben Saimushi Tobacco Leaf；It is supervised using FM4-64 dyestuff Survey general process of endocytosis.It was found that the transient expression of Hub significantly reduces FM4-64 dyestuff under CaMV 35S promoter Internalization (Fig. 5).This shows that the endocytosis in Ben Saimushi Tobacco Epidermis can be influenced really using the dominant negative strategy of Hub Mechanism.It is interesting that discovery Hub is overexpressed the accumulation (Fig. 4 A and B) for improving VirE2 at cell boundaries.Time course Experiment shows that compared with the control, in the tobacco cell for being overexpressed Hub, VirE2 residence time at cell boundaries is longer (Fig. 6).These show that VirE2 leaves plant cell membrane and needs functional clathrin and active CME process.

In order to confirm that host's endocytosis is important VirE2 transport, chemical inhibitor inscribe peptide is used (endosidin) 1 (ES1) interferes process of endocytosis, because ES1 influences endocytosis approach and leads to early stage in arabidopsis The aggregation (44) of inner body.Highly dynamic round early endosome (44,45) is marked using SYP61-mCherry；It is with ES1 Transient expression in the Ben Saimushi Tobacco Epidermis of processing.It was found that ES1 processing leads to the exception of SYP61-mCherry marker Assemble (Fig. 7 A), shows the aggregation of early endosome in leaf epidermal cell.It is interesting that ES1 processing cause it is different in host cell matter Normal VirE2 transport；Inner body aggregation cylinder accumulation (Fig. 7 B) that VirE2 is induced in ES1.This shows that ES1 interference host's endocytosis is made With and to limit VirE2 mobile.

Then test ES1 to VirE2 core target to influence because have shown that before Agrobacterium delivering VirE2 with Nuclear localization signal (NLS) dependence mode is effectively targeted to plant nucleolus (36).As shown in Fig. 4 C and D, the significant drop of ES1 processing The core accumulation of VirE2 in low tobacco cell, and VirE2 is gathered at cell boundaries or in cytoplasm.This shows that ES1 influences VirE2 is transported rather than the delivering of VirE2 or oligomerization.In short, these discoveries show that host's endocytosis is transported in cytoplasm And the core target of VirE2 plays an important role in subsequent plant cell.

Example 4:AMT process needs endocytosis

In order to confirm the importance of endocytosis, chemical inhibitor is had studied to the shadow of Agrobacterium-medialed transformation (AMT) It rings, because conversion process needs functionality VirE2.Using ES1 or tyrphostin A23, (it is also arabidopsis CME inhibitor) processing arabidopsis root carry out tumour occur test (46).As shown in Fig. 4 E and F, with ES1 or tyrosine phosphatase Change inhibitor A23 processing and is obviously reduced tumour generation.These the result shows that interference host's endocytosis can to weaken plant thin The stable conversion of born of the same parents, this may be because the endocytosis blocked affects the movement of VirE2, to affect it in AMT Effect.

Example 5:VirE2 transport needs double endocytosis motifs of the C-terminal tail of VirE2

Then, the loading VirE2 for how being selected as internalization process had studied.It is typically chosen the matter for internalization process The relevant loading albumen of film depend on the cytoplasm side of loading protein by various host's adapters identify endocytosis signal (47, 48).After being delivered in host plant cell by T4SS, VirE2 may be with a kind of phase of host's adaptor protein at plasma membrane Interaction.Sequence is analysis shows the endocytosis that VirE2 (accession number AAZ50538) includes 5 presumptions sorts motif (Fig. 8 A).

In order to test the importance that the motif of these presumptions transports VirE2, each two leucine base or tyrosine The potential crucial leucine of the motif (49) of base or tyrosine residue sport alanine.In addition, constructing double-mutant, it is used for The motif (Fig. 8 A) of two tyrosine-baseds of spatial proximity at C-terminal.Then the Agrobacterium delivering of every kind of mutant is tested VirE2 cellular localization and distribution.The single mutation of the motif of double C-terminal tyrosine-baseds and double mutation do not affect VirE2 to Host cell membrane delivers (Fig. 8 B and C)；However, double mutation lead to the significantly higher levels of VirE2 accumulation (figure at film site 8C).Mutation at the endocytosis motif of other presumptions of VirE2 does not influence VirE2 delivering or internalization process (Fig. 9).The result shows that The motif of double C-terminal tyrosine-baseds of presumption is important VirE2 transport.

Example 6:AMT needs double endocytosis motifs of the C-terminal tail of VirE2

In order to determine whether VirE2 function needs the motif of double C-terminal tyrosine-baseds, after AMT, on T-DNA The transient expression of mCherry under the control of CaMV35S promoter is tested.It is expressed based on Fluorescence Intensity Assays mCherry, Due to the VirE2 mutation at double C-terminal endocytosis signals.As shown in Fig. 8 D and E, single mutation at double C-terminal endocytosis signals and double Mutation significantly reduces instantaneous AMT efficiency, although the influence of double mutation (Y488A/Y494A) is than single mutation Y494A, (it compares Y488A can more influence function) it is more significant.These show that VirE2 function needs double C-terminal endocytosis signals, and the end VirE2 The last one endocytosis signal is even more important.

Sequence alignment analysis shows the endocytosis motif of double C-terminal tyrosine-baseds in the VirE2 albumen from different Ti-plasmids On be it is conservative, show they in different agrobacterium strains guard effects (Figure 10).In addition, from virulent strain A348's The mutation of these upper conserved motifs of VirE2 also reduces the formation (Fig. 8 F and G) of tumour on arabidopsis root segment.The result shows that being located at The endocytosis signal of double tyrosine-baseds of the end VirE2C is all critically important for the VirE2 function of instantaneous and stable AMT process.

The endocytosis motif and plant AP2M of the end example 7:VirE2C interact

The above results make we assume that the endocytosis motif of double C-terminal tyrosine-baseds of VirE2 may be by clathrin correlation Sorting protein identification because clathrin-mediated endocytosis mechanism is by being known as " the relevant sorting protein of clathrin " One group of host's adapter promotes, and is responsible for endocytosis signal identification and loading combines (47,48).Wherein, adaptor protein 2 (AP-2) The endocytosis signal of compound identification tyrosine-based is simultaneously (50) in connection by the C-terminal structural domain of μ-subunit (AP2M).

It potentially interacts to test VirE2 and AP-2 compound, has carried out external drop-down with its fusion protein and tried It tests.As shown in Figure 11 A, when the C-terminal tail of VirE2 is fused on GST (GST-VirE2C), it with merge on MBP The loading binding structural domain (MBP-AP2MC) of AP2M interacts.However, double mutation at the endocytosis signal of double tyrosine-baseds Eliminate the interaction (Figure 11 B).These are the result shows that the sorting motif that AP2M passes through double tyrosine-baseds is identified and combined VirE2C terminal tail.

Example 8:ap2m mutation weakens tumour

In order to further confirm importance of host AP-2 compound during AMT, the two of arabidopsis AP2M are tested A insertion mutation body is used for tumour.As shown in Figure 11 C and D, compared with wild type control, two insertion mutations of AP-2M Body all shows the tumour being obviously reduced and is formed.These demonstrate that host's AP-2 compound is strictly plant cell mediated by agriculture bacillus Conversion required for.

The present invention widely and universally describes herein.Fall into the relatively narrow type of each of general disclosure and Subgenus group also constitutes a part of the invention.This includes universal description of the invention, is limited with collateral condition or negative, Any theme is removed from the kind, regardless of whether specifically describing the material being removed herein.Other embodiments In following following claims.In addition, in the case where describing features or aspect of the invention according to marlcush group, art technology Personnel are it will be recognized that therefore the present invention can also be described in the form of any single member of marlcush group or member subgroup.

The person skilled in the art will easily understand the present invention is very suitable for realizing the purpose, and mentioned by acquisition Result and advantage and those are wherein intrinsic.In addition, it will be apparent to one skilled in the art that not In the case where departing from the scope of the present invention and being spiritual, various substitutions and modifications can be carried out to invention disclosed herein.This paper institute Composition, method, program, processing, molecule and the specific compound stated are presently preferred the representative of embodiment, preferred real The scheme of applying is exemplary and is not intended as limitation of the scope of the invention.In the sheet as defined by the scope of the claims In the scope of invention, those skilled in the art will expect variation therein and other purposes.In the present specification, previously public The a part or common knowledge for being not construed as recognizing that this document is the prior art are listed or discussed to the file of cloth.

The present invention being described in detail herein suitably can lack any element not specifically disclosed herein, the feelings of limitation Implement under condition.Thus, for example, term " includes ", "include", "comprise" etc. should be widely understood and unrestricted.Therefore, word The variant of " comprising " or such as "comprising" or "comprising" will accordingly appreciate that imply to include described whole or whole group, but not arrange Except any other whole or whole group.In addition, terms used herein and expression are used with the description of term, and not restrictive, And it is not intended to any equivalent or part thereof shown in excluded using these terms and expressions with described feature, but is recognized It arrives, in scope of the present invention, various modifications can be carried out.It should therefore be understood that although having passed through example Property embodiment and optional feature specifically disclose the present invention, but those skilled in the art can be using disclosed herein hair Bright modifications and variations, and these modifications and variations are considered as within the scope of the invention.

All references recited herein and the content of patent document are integrally incorporated by reference.

Bibliography

1.M.D.Chilton, M.H.Drummond, D.J.Merio, D.Sciaky, A.L.Montoya, M.P.Gordon, E.W.Nester, Stable incorporation of plasmid DNA into higher plant cells:the 11,263 (1977) of molecular basis of crown gall tumorigenesis.Cell

2.P.Zambryski.M.Holsters, K.Kruger, A.Depicker, J.Schell, M.Van Montagu, H.M.Goodman, Tumor DNA structure in plant cells transformed by 209,1385 (1980) of A.tumefaciens.Science

3.L.M.Albright, M.F.Yanofsky, B.Leroux, D.Q.Ma, E.W.Nester, Processing of The T-DNA of Agrobacterium tumefaciens generates border nicks and linear, Single-stranded T-DNA.J.Bacteriol.169,1046 (1987)

4.P.Bundock, A.den Dulk-Ras, A.Beijersbergen, P.J.Hooykaas, Trans-kingdom T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces Cerevisiae.EMBO J.14,3206 (1995)

5.K.L.Piers.J.D.Heath, X.Liang, K.M.Stephens, E.W.Nester, Agrobacterium Tumefaciens-mediated transformation of yeast.Proc.Natl.Acad.Sci.U.S.A.93,1613 (1996).

6.M.J.de Groot, P.Bundock, P.J.Hooykaas, A.G.Beijersbergen, Agrobacterium Tumefaciens-mediated transformation of filamentous fungi.Nat.Biotechnol.16, 839(1998).

7.S.Kathiresan, A.Chandrashekar, G.A.Ravishankar, R.Sarada, Agrobacterium-Mediated Transformation in the Green Alga Haematococcus Pluvialis (Chlorophyceae, Volvocales) (1) .J.Phycol.45,642 (2009)

8.T.Kunik, T.Tzfira, Y.Kapulnik, Y.Gafni, C.Dingwall, V.Citovsky, Genetic Transformation of HeLa cells by Agrobacterium.Proc.Natl.Acad.Sci.U.S.A.98, 1871(2001).

9.T.Tzfira, V.Citovsky, Agrobacterium-mediated genetic transformation Of plants:biology and biotechnology.Curr.Opin.Biotechnol.17,147 (2006)

10.C.B.Michielse, P.J.Hooykaas, C.A.van den Hondel, A.F.Ram, Agrobacterium-mediated transformation as a tool for functional genomics in Fungi.Curr.Genet.48,1 (2005)

11.K.J.Fullner, J.C.Lara, E.W.Nester, Pilus assembly by Agrobacterium T- 273,1107 (1996) of DNA transfer genes.Science

12.E.Cascales, P.J.Christie, Definition of a bacterial type IV 304,1170 (2004) of secretion pathway for a DNA substrate.Science

13.A.Beijersbergen, A.D.Dulk-Ras, R.A.Schilperoort, P.J.Hooykaas, Conjugative Transfer by the Virulence System of Agrobacterium 256,1324 (1992) of tumefaciens.Science

14.H.H.Low, F.Gubellini, A.Rivera-Calzada, N.Braun, S.Connery, A.Dujeancourt, F.Lu, A.Redzej, R.Fronzes, E.V.Orlova, G.Waksman, Structure of a 508,550 (2014) of type IV secretion system.Nature

15.E.Cascales, P.J.Christie, The versatile bacterial type IV secretion Systems.Nat.Rev.Microbiol.1,137 (2003)

16.V.Chandran Darbari, G.Waksman, Structural Biology of Bacterial Type IV Secretion Systems.Annu.Rev.Biochem.84,603 (2015)

17.P.J.Christie, K.Atmakuri, V.Krishnamoorthy, S.Jakubowski, E.Cascales, Biogenesis, architecture, and function of bacterial type IV secretion Systems.Annu.Rev.Microbiol.59,451 (2005)

18.A.C.Vergunst.B.Schrammeijer, A.den Dulk-Ras, C.M.de Vlaam, T.J.Regensburg-Tuink, P.J.Hooykaas, VirB/D4-dependent protein translocation 290,979 (2000) of from Agrobacterium into plant cells.Science

19.A.C.Vergunst, M.C.van Lier, A.den Dulk-Ras, T.A.Stuve, A.Ouwehand, P.J.Hooykaas, Positive charge is an important feature of the C-terminal transport signal of the VirB/D4-translocated proteins of Agrobacterium.Proc. Natl.Acad.Sci.U.S.A.102,832 (2005)

20.B.Schrammeijer, A.den Dulk-Ras, A.C.Vergunst, E.Jurado Jacome, P.J.Hooykaas, Analysis of Vir protein translocation from Agrobacterium Tumefaciens using Saccharomyces cerevisiae as a model:evidence for transport Of a novel effector protein VirE3.Nucleic Acids Res.31,860 (2003)

21.S.B.Gelvin, Plant proteins involved in Agrobacterium-mediated Genetic transformation.Annu.Rev.Phytopathol.48,45 (2010)

25 bp of 22.K.Wang, L.Herrera-Estrella.M.Van Montagu, P.Zambryski, Right terminus sequence of the nopaline T-DNA is essential for and determines Direction of DNA transfefr from Agrobacterium to the plant genome.Cell 38,455 (1984).

23.M.F.Yanofsky, S.G.Porter, C.Young, L.M.Albright, M.P.Gordon.E.W.Nester, The virD operon of Agrobacterium tumefaciens encodes a 47,471 (1986) of site-specific endonuclease.Cell

24.P.Scheiffele, W.Pansegrau, E.Lanka, Initiation of Agrobacterium tumefaciens T-DNA processing.Purified proteins VirDl and VirD2 catalyze site- and strand-specific cleavage of superhelical T-border DNA in Vitro.J.Biol.Chem.270,1269 (1995)

25.P.J.Christie, J.E.Ward, S.C.Winans, E.W.Nester, The Agrobacterium tumefaciens virE2 gene product is a single-stranded-DNA-binding protein that Associates with T-DNA.J.Bacteriol.170,2659 (1988)

26.V.Citovsky, M.L.Wong, P.Zambryski, Cooperative interaction of Agrobacterium VirE2 protein with single-stranded DNA:implications for the T- DNA transfer process.Proc.Natl.Acad.Sci.U.S.A.86,1193 (1989)

27.P.Sen, G.J.Pazour, D.Anderson, A.Das, Cooperative binding of Agrobacterium tumefaciens VirE2protein to single-stranded DNA.J.Bacteriol.171,2573 (1989)

28.S.Bhattacharjee, L.Y.Lee, H.Oltmanns, H.Cao, Veena, J.Cuperus, S.B.Gelvin, IMPa-4, an Arabidopsis importin alpha isoform, is preferentially Involved in Agrobacterium-mediated plant transformation.Plant Cell 20,2661 (2008).

29.F.Dumas, M.Duckely, P.Pelczar, P.Van Gelder, B.Hohn, An Agrobacterium VirE2 channel for transferred-DNA transport into plant cells.Proc.Natl.Acad. Sci.U.S.A.98,485 (2001)

30.L.Rossi, B.Hohn, B.Tinland, Integration of complete transferred DNA units is dependent on the activity of virulence E2protein of Agrobacterium t Umefaciens.Proc.Natl.Acad.Sci.U.S.A.93,126 (1996)

31.V.M.Yusibov, T.R.Steck, V.Gupta, S.B.Gelvin, Association of single- stranded transferred DNA from Agrobacterium tumefaciens with tobacco cells.P Roc.Natl.Acad.Sci.U.S.A.91,2994 (1994)

32.T.Tzfira, M.Vaidya, V.Citovsky, VIP1, an Arabidopsis protein that Interacts with Agrobacterium VirE2, is involved in VirE2 nuclear import and Agrobacterium infectivity.EMBO J.20,3596 (2001)

33.A.Djamei, A.Pitzschke, H.Nakagami, I.Rajh, H.Hirt, Trojan horse Strategy in Agrobacterium transformation:abusing MAPK defense 318,453 (2007) of signaling.Science

34.J.Li, A.Krichevsky, M.Vaidya, T.Tzfira, V.Citovsky, Uncoupling of the functions of the Arabidopsis VIP1 protein in transient and stable plant Genetic transformation by Agrobacterium.Proc.Natl.Acad.Sci.U.S.A.102,5733 (2005).

35.A.Anand, A.Krichevsky, S.Schornack, T.Lahaye, T.Tzfira, Y.Tang, V.Citovsky, K.S.Mysore, Arabidopsis VIRE2 INTERACTING PROTEIN2 is required for 19,1695 (2007) of Agrobacterium T-DNA integration in plants.Plant Cell

36.X.Li, Q.Yang, H.Tu, Z.Lim, S.Q.Pan, Direct visualization of Agrobacterium-delivered VirE2 in recipient cells.Plant J.77,487 (2014)

37.B.K.Nelson, X.Cai, A.Nebenfuhr, A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other Plants.Plant J.51,1126 (2007)

38.N.Geldner, N.Anders, H.Wolters, J.Keicher, W.Komberger, P.Muller, A.Delbarre, T.Ueda.A.Nakano, G.Jurgens, The Arabidopsis GNOM ARF-GEF mediates Endosomal recycling, auxin transport, and auxin-dependent plant growth.Cell 112,219 (2003)

39.A.Maizel, D.von Wangenheim, F.Federici, J.Haseloff.E.H.Stelzer, High- resolution live imaging of plant growth in near physiological bright Conditions using light sheet fluorescence microscopy.Plant J.68,377 (2011)

40.H.T.McMahon, E.Boucrot, Molecular mechanism and physiological Functions of clathrin-mediated endocytosis.Nat.Rev.Mol.Cell Biol.12,517 (2011).

41.S.H.Liu, M.L.Wong, C.S.Craik, F.M.Brodsky, Regulation of clathrin Assembly and trimerization defined using recombinant triskelion hubs.Cell 83, 257(1995).

42.S.Kitakura, S.Vanneste, S.Robert, C.Lofke, T.Teichmann, H.Tanaka, J.Friml, Clathrin mediates endocytosis and polar distribution of PIN auxin 23,1920 (2011) of transporters in Arabidopsis.Plant Cell

43.P.Dhonukshe, F.Aniento, I.Hwang, D.G.Robinson, J.Mravec, Y.D.Stierhof, J.Friml, Clathrin-mediated constitutive endocytosis of PIN auxin efflux Carriers in Arabidopsis.Curr.Biol.17,520 (2007)

44.S.Robert, S.N.Chary, G.Drakakaki, S.Li, Z.Yang, N.V.Raikhel, G.R.Hicks, Endosidinl defines a compartment involved in endocytosis of the brassinosteroid receptor BRI1 and the auxin transporters PIN2 and AUX1.Proc. Natl.Acad.Sci.U.S.A.105,8464 (2008)

45.O.Foresti, J.Denecke, Intermediate organeiles of the plant secretory 9,1599 (2008) of pathway:identity and function.Trafffic

46.D.N.Banbury, J.D.Oakley, R.B.Sessions, G.Banting, Tyrphostin A23 inhibits internalization of the transferrin receptor by perturbing the interaction between tyrosine motifs and the medium chain subunit of the AP-2 Adaptor complex.J.Biol.Chem.278,12022 (2003)

47.J.S.Bonifacino, L.M.Traub, Signals for sorting of transmembrane Proteins to endosomes and lysosomes.Annu.Rev.Biochem.72,395 (2003)

48.L.M.Traub, Tickets to ride:selecting cargo for clathrin-regulated Internalization.Nat.Rev.Mol.Cell Biol.10,583 (2009)

49.L.M.Traub, J.S.Bonifacino, Cargo recognition in clathrin-mediated Endocytosis.Cold Spring Harb.Perspect.Biol.5, a016790 (2013)

50.L.P.Jackson.B.T.Kelly, A.J.McCoy, T.Gaffry, L.C.James, B.M.Collins, S.Honing, P.R.Evans, D.J.Owen, A large-scale conformational change couples membrane recruitment to cargo binding in the AP2 clathrin adaptor 141,1220 (2010) of complex.Cell

51.M.De Cleene, J.De Ley, The host range of crown gall.The Botanical 42,389 (1976) of Review

52.B.Lacroix, T.Tzfira, A.Vainstein.V.Citovsky, A case of promiscuity: Agrobacterium ' s endless hunt for new partners.Trends Genet.22,29 (2006)

53.L.Otten.H.De Greve, J.Leemans, R.Hain, P.Hooykaas, J.Schell, Restoration of virulence of Vir region mutants of Agrobacterium tumefaciens strain B6S3 by coinfection with normal and mutant Agrobacterium strains.Mol Gen Genet.195,159-163 (1984)

54.J.Aguilar, J.Zupan, T.A.Cameron, P.C.Zambryski, Agrobacterium type IV secretion system and its substrates form helical arrays around the Circumference of virulence-induced cells.Proc.Natl.Acad.Sci.U.S.A.107,3758 (2010).

55.L.G.Wu, E.Hamid, W.Shin, H.C.Chiang, Exocytosis and endocytosis:modes, Functions, and coupling mechanisms.Annu.Rev.Physiol.76,301 (2014)

56.J.Mercer.M.Schelhaas, A.Helenius, Virus entry by Endocytosis.Annu.Rev.Biochem.79,803 (2010)

57.M.Bar, A.Avni, Endosomal trafficking and signaling in plant defense Responses.Curr.Opin.Plant Biol.22,86 (2014)

58.X.Chen, N.G.Irani, J.Friml, Clathrin-mediated endocytosis:the gateway into plant cells.Curr.Opin.Plant Biol.14,674(2011).

59.C.Xiang, P.Han, I.Lutziger, K.Wang, D.J.Oliver, A mini binary vector Series for plant transformation.Plant Mol.Biol.40,711-717 (1999)

60.E.E.Hood, S.B.Gelvin, L.S.Melchers, A.Hoekema, New Agrobacterium Helper plasmids for gene transfer to plants.Transgenic Res.2,208-218 (1993)

61.V.C.Knauf, E.W.Nester, Wide host range cloning vectors:a cosmid Clone bank of an Agrobacterium Ti plasmid.Plasmid 8,45-54 (1982)

62.P.Y.Chen, C.K.Wang, S.C.Soong, K.Y.To, Complete sequence of the binary vector pBI121 and its application in cloning T-DNA insertion from transgenic Plants.Mol.Breed.11,287-293 (2003)

Sequence table

<110>National University of Singapore (National University of Singapore)

<120>make the Compounds and methods for of molecular targeted specific cells position

<130> 2016-202-01

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 10

<212> PRT

<213>artificial sequence

<220>

<223>internalization signal of VirE2

<400> 1

Tyr Thr Ser Val Ala Glu Tyr Glu Arg Leu

1 5 10

<210> 2

<211> 487

<212> PRT

<213>artificial sequence

<220>

<223>N-terminal of VirE2

<400> 2

Met Asp Pro Ser Ser Asn Glu Asn Val Tyr Val Gly Arg Gly His Asn

1 5 10 15

Ile Glu Asn Asp Asp Asp Thr Asp Pro Arg Arg Trp Lys Lys Ala Asn

20 25 30

Ile Ser Ser Asn Thr Ile Ser Asp Ile Gln Met Thr Asn Gly Glu Asp

35 40 45

Val Gln Ser Gly Ser Pro Thr Arg Thr Glu Val Val Ser Pro Arg Leu

50 55 60

Asp Tyr Gly Ser Val Asp Ser Ser Ser Ser Leu Tyr Ser Gly Ser Glu

65 70 75 80

His Gly Asn Gln Ala Glu Ile Gln Lys Glu Leu Ser Val Leu Phe Ser

85 90 95

Asn Met Ser Leu Pro Gly Asn Asp Arg Arg Pro Asp Glu Tyr Ile Leu

100 105 110

Val His Gln Thr Gly Gln Asp Ala Phe Thr Gly Ile Ala Lys Gly Asn

115 120 125

Leu Asp Gln Met Pro Thr Lys Ala Glu Phe Asn Ala Cys Cys Arg Leu

130 135 140

Tyr Arg Asp Gly Ala Gly Asn Tyr Tyr Pro Pro Pro Leu Ala Phe Asp

145 150 155 160

Lys Ile Ser Val Pro Glu Gln Leu Glu Glu Lys Trp Gly Met Met Glu

165 170 175

Ala Lys Glu Arg Asn Lys Leu Arg Phe Gln Tyr Lys Leu Asp Val Trp

180 185 190

Asn His Ala His Ala Asp Met Gly Ile Thr Gly Thr Glu Ile Phe Tyr

195 200 205

Gln Thr Asp Lys Asn Ile Lys Leu Asp Arg Asn Tyr Lys Leu Arg Pro

210 215 220

Glu Asp Arg Tyr Val Gln Thr Glu Lys Tyr Gly Arg Arg Glu Ile Gln

225 230 235 240

Lys Arg Tyr Gln His Glu Leu Gln Ala Gly Ser Leu Leu Pro Asp Ile

245 250 255

Met Ile Lys Thr Pro Gln Asn Asp Ile His Phe Val Tyr Arg Phe Ala

260 265 270

Gly Asp Asn Tyr Ala Asn Lys Gln Phe Ser Glu Phe Glu His Thr Val

275 280 285

Lys Arg Arg Tyr Gly Asp Glu Thr Glu Ile Lys Leu Lys Ser Lys Ser

290 295 300

Gly Ile Met His Asp Ser Lys Tyr Leu Glu Ser Trp Glu Arg Gly Ser

305 310 315 320

Ala Asp Ile Arg Phe Ala Glu Phe Val Gly Glu Asn Arg Ala His Asn

325 330 335

Arg Gln Phe Pro Thr Ala Thr Val Asn Met Gly Gln Gln Pro Asp Gly

340 345 350

Gln Gly Gly Leu Thr Arg Asp Arg His Val Ser Val Asp Phe Leu Met

355 360 365

Gln Ser Ala Pro Asn Ser Pro Trp Ala Gln Ala Leu Lys Lys Gly Glu

370 375 380

Leu Trp Asp Arg Val Gln Leu Leu Ala Arg Asp Gly Asn Arg Tyr Leu

385 390 395 400

Ser Pro Pro Arg Leu Glu Tyr Ser Asp Pro Ala His Phe Thr Glu Leu

405 410 415

Met Asn Arg Val Gly Leu Pro Ala Ser Met Gly Arg Gln Ser His Ala

420 425 430

Ala Ser Ile Lys Phe Glu Lys Phe Asp Ala Gln Ala Ala Val Ile Val

435 440 445

Leu Asn Gly Pro Glu Leu Arg Asp Ile His Asp Leu Ser Pro Glu Lys

450 455 460

Leu Gln Asn Leu Ser Thr Lys Asp Val Ile Val Ala Asp Arg Asn Glu

465 470 475 480

Asn Gly Gln Arg Thr Gly Thr

485

<210> 3

<211> 52

<212> PRT

<213>artificial sequence

<220>

<223>C-terminal of VirE2

<400> 3

Gln Leu Arg Leu Pro Pro Asp Ala Ala Gly Val Leu Gly Glu Ala Thr

1 5 10 15

Asp Lys Tyr Ser Arg Asp Phe Val Arg Pro Glu Pro Ala Ser Arg Pro

20 25 30

Ile Ser Asp Ser Arg Arg Ile Tyr Glu Ser Arg Pro Arg Ser Gln Ser

35 40 45

Val Asn Ser Phe

50

<210> 4

<211> 549

<212> PRT

<213>Agrobacterium tumefaciems (Agrobacterium tumefaciens)

<400> 4

Met Asp Pro Ser Ser Asn Glu Asn Val Tyr Val Gly Arg Gly His Asn

1 5 10 15

Ile Glu Asn Asp Asp Asp Thr Asp Pro Arg Arg Trp Lys Lys Ala Asn

20 25 30

Ile Ser Ser Asn Thr Ile Ser Asp Ile Gln Met Thr Asn Gly Glu Asp

35 40 45

Val Gln Ser Gly Ser Pro Thr Arg Thr Glu Val Val Ser Pro Arg Leu

50 55 60

Asp Tyr Gly Ser Val Asp Ser Ser Ser Ser Leu Tyr Ser Gly Ser Glu

65 70 75 80

His Gly Asn Gln Ala Glu Ile Gln Lys Glu Leu Ser Val Leu Phe Ser

85 90 95

Asn Met Ser Leu Pro Gly Asn Asp Arg Arg Pro Asp Glu Tyr Ile Leu

100 105 110

Val His Gln Thr Gly Gln Asp Ala Phe Thr Gly Ile Ala Lys Gly Asn

115 120 125

Leu Asp Gln Met Pro Thr Lys Ala Glu Phe Asn Ala Cys Cys Arg Leu

130 135 140

Tyr Arg Asp Gly Ala Gly Asn Tyr Tyr Pro Pro Pro Leu Ala Phe Asp

145 150 155 160

Lys Ile Ser Val Pro Glu Gln Leu Glu Glu Lys Trp Gly Met Met Glu

165 170 175

Ala Lys Glu Arg Asn Lys Leu Arg Phe Gln Tyr Lys Leu Asp Val Trp

180 185 190

Asn His Ala His Ala Asp Met Gly Ile Thr Gly Thr Glu Ile Phe Tyr

195 200 205

Gln Thr Asp Lys Asn Ile Lys Leu Asp Arg Asn Tyr Lys Leu Arg Pro

210 215 220

Glu Asp Arg Tyr Val Gln Thr Glu Lys Tyr Gly Arg Arg Glu Ile Gln

225 230 235 240

Lys Arg Tyr Gln His Glu Leu Gln Ala Gly Ser Leu Leu Pro Asp Ile

245 250 255

Met Ile Lys Thr Pro Gln Asn Asp Ile His Phe Val Tyr Arg Phe Ala

260 265 270

Gly Asp Asn Tyr Ala Asn Lys Gln Phe Ser Glu Phe Glu His Thr Val

275 280 285

Lys Arg Arg Tyr Gly Asp Glu Thr Glu Ile Lys Leu Lys Ser Lys Ser

290 295 300

Gly Ile Met His Asp Ser Lys Tyr Leu Glu Ser Trp Glu Arg Gly Ser

305 310 315 320

Ala Asp Ile Arg Phe Ala Glu Phe Val Gly Glu Asn Arg Ala His Asn

325 330 335

Arg Gln Phe Pro Thr Ala Thr Val Asn Met Gly Gln Gln Pro Asp Gly

340 345 350

Gln Gly Gly Leu Thr Arg Asp Arg His Val Ser Val Asp Phe Leu Met

355 360 365

Gln Ser Ala Pro Asn Ser Pro Trp Ala Gln Ala Leu Lys Lys Gly Glu

370 375 380

Leu Trp Asp Arg Val Gln Leu Leu Ala Arg Asp Gly Asn Arg Tyr Leu

385 390 395 400

Ser Pro Pro Arg Leu Glu Tyr Ser Asp Pro Ala His Phe Thr Glu Leu

405 410 415

Met Asn Arg Val Gly Leu Pro Ala Ser Met Gly Arg Gln Ser His Ala

420 425 430

Ala Ser Ile Lys Phe Glu Lys Phe Asp Ala Gln Ala Ala Val Ile Val

435 440 445

Leu Asn Gly Pro Glu Leu Arg Asp Ile His Asp Leu Ser Pro Glu Lys

450 455 460

Leu Gln Asn Leu Ser Thr Lys Asp Val Ile Val Ala Asp Arg Asn Glu

465 470 475 480

Asn Gly Gln Arg Thr Gly Thr Tyr Thr Ser Val Ala Glu Tyr Glu Arg

485 490 495

Leu Gln Leu Arg Leu Pro Pro Asp Ala Ala Gly Val Leu Gly Glu Ala

500 505 510

Thr Asp Lys Tyr Ser Arg Asp Phe Val Arg Pro Glu Pro Ala Ser Arg

515 520 525

Pro Ile Ser Asp Ser Arg Arg Ile Tyr Glu Ser Arg Pro Arg Ser Gln

530 535 540

Ser Val Asn Ser Phe

545

<210> 5

<211> 16

<212> PRT

<213>artificial sequence

<220>

<223> GFP11

<400> 5

Arg Asp His Met Val Leu His Glu Tyr Val Asn Ala Ala Gly Ile Thr

1 5 10 15

<210> 6

<211> 215

<212> PRT

<213>artificial sequence

<220>

<223> GFP1-10

<400> 6

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Arg Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Ile Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Leu Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys

65 70 75 80

Arg His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Ser Phe Lys Asp Asp Gly Lys Tyr Lys Thr Arg Ala Val

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Thr Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Phe Asn Ser His Asn Val Tyr Ile Thr Ala Asn Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Ala Asn Phe Thr Val Arg His Asn Val Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Thr Val Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys

210 215

Claims (23)

1. peptide, the peptide includes or is made up of: the amino acid sequence or (ii) of (i) SEQ ID NO:1 is in its whole length The upper amino acid sequence with amino acid sequence at least 80% sequence identity of SEQ ID NO:1.

2. peptide according to claim 1, wherein the length of the peptide is 10 to 200 amino acid.

3. conjugate, the conjugate includes peptide according to claim 1 or 2, wherein the peptide further includes at least one Funtion part.

4. conjugate according to claim 3, wherein the N-terminal of at least one described funtion part and the peptide is conjugated.

5. conjugate according to claim 3, wherein the C-terminal of at least one described funtion part and the peptide is conjugated.

6. conjugate according to claim 4 is not, it is specified that at least one described funtion part includes described in SEQ ID NO:2 Amino acid sequence or its C-terminal segment.

7. conjugate according to claim 5 is not, it is specified that at least one described funtion part includes described in SEQ ID NO:3 Amino acid sequence or its N-terminal segment.

8. the conjugate according to any one of claim 3 to 7, wherein the funtion part be pharmaceutically or biology On reactive compound.

9. the conjugate according to any one of claim 3 to 8, wherein the funtion part further includes or green fluorescence Albumen (GFP) or its segment.

10. the conjugate according to any one of claim 3 to 9, wherein the conjugate further includes that at least one is used for Translocate to the part in cell.

11. conjugate according to claim 10, wherein the part for translocating in cell is the end C of VirE2 Terminal sequence.

12. conjugate according to claim 10, wherein the part for translocating in cell is cell-penetrating peptides Or reagent.

13. a kind of carrier, the carrier includes a nucleotide sequence, it is described it is nucleotide sequence coded according to claim 1 or 2 institutes The peptide stated.

14. a kind of host cell, the host cell includes carrier according to claim 13.

15. a kind of for visualizing the biological imaging systems of internalization process comprising:

(a) conjugate according to any one of claim 3 to 12 is conjugated with the first GFP segment；With

(b) cell expresses the 2nd GFP segment,

Wherein the first GFP segment and the 2nd GFP segment can assemble to form functional GFP.

16. biological imaging systems according to claim 15, wherein

(a) conjugate described in (a) is conjugated with according to the peptide of SEQ ID NO:5；And/or

(b) cell expresses the peptide according to SEQ ID NO:6.

17. biological imaging systems according to claim 15 or 16, wherein the cell is selected from by plant cell, yeast The group that cell, fungi, algae or the mammalian cell of culture are constituted.

18. biological imaging systems according to claim 17, wherein the cell is plant cell.

19. biological imaging systems described in any one of 5 to 18 according to claim 1, wherein the cell expresses clathrin Relevant adapter AP2 complex (AP2M).

20. a kind of method for visualizing internalization process comprising:

According to claim 1, biological imaging systems described in any one of 5 to 19 are provided；With

Conjugate described in claim 16 (a) is set to be in contact with cell described in claim 16 (b).

21. a kind of make drug internalization to intracellular method comprising:

The conjugate according to any one of claim 8 to 12 and cell are provided；With

The conjugate is set to be in contact with the cell.

22. the conjugate according to any one of claim 8 to 12 is used as drug.

23. purposes of the conjugate according to any one of claim 8 to 12 as investigational agent.