KR102000454B1 - Promoter recognition site by Xanthomonas oryzae pv. oryzae and uses thereof - Google Patents

Abstract

The present invention relates to a method for producing Xanthomonas oryzae pv. oryzae ( Xoo )) and its use. More particularly, the present invention relates to an OsbZIP73 ( Oryza sativa basic-leucine zipper 73) promoter fragment which binds to the TAL effector Xoo2279 gene of rice blast fungus, the OsbZIP73 promoter fragment and the promoter fragment , A recombinant vector for recognizing the TAL effector Xoo2279 gene sequence comprising the marker gene or the fluorescent protein gene linked to the promoter fragment, the recombinant vector for recognizing the TAL effector Xoo2279 gene sequence, the OsbZIP73 promoter fragment , A method for producing a transgenic plant having increased resistance to blight of blight of bark with the use of the recombinant vector, and a transgenic plant having improved blight resistance against blight of blight produced by the above-described method .
The OsbZIP73 promoter fragment that binds to the TAL effector Xoo2279 gene of the blight of rice blast fungus according to the present invention, that is, a mutation such as deletion, insertion or substitution of the promoter recognition site by the rice blast fungus, the present invention can be used not only to develop rice blight blight-resistant crops through mutation, but also to use OsbZIP73 promoter fragment that binds to the TAL effector Xoo2279 gene, to select a blight-resistant rice blight-resistant crop.

Description

Promoter recognition site by rice blast fungus and its use {Promoter recognition site by Xanthomonas oryzae pv. oryzae and uses thereof}

The present invention relates to a method for producing Xanthomonas oryzae pv. oryzae ( Xoo )) and its use. More particularly, the present invention relates to an OsbZIP73 ( Oryza sativa basic-leucine zipper 73) promoter fragment which binds to the TAL effector Xoo2279 gene of rice blast fungus, the OsbZIP73 promoter fragment and the promoter fragment , A recombinant vector for recognizing the TAL effector Xoo2279 gene sequence comprising the marker gene or the fluorescent protein gene linked to the promoter fragment, the recombinant vector for recognizing the TAL effector Xoo2279 gene sequence, the OsbZIP73 promoter fragment , A method for producing a transgenic plant having increased resistance to blight of blight of bark with the use of the recombinant vector, and a transgenic plant having improved blight resistance against blight of blight produced by the above-described method .

Plants are known to have a complex mechanism for activating the perception of the pathogen attack or the internal immune response. Plants and pathogens have been coevolutioned through the relationship between adaptability and infectivity. This phenomenon is due to the relationship between the nonpathogenic gene ( avr gene) and the resistance gene (R gene) in the attack and defense of pathogens and host plants. Pathogens should break down the double defenses of plants to ensure successful multiplication and efficient parasitism in host plants through infection. Through the primary defense system, plants recognize microbe-associated molecular patterns (MAMP) of pathogens using PRRs (Patterns recognition receptors) that induce basic defense systems. However, this primary defense system is disrupted by secretory effectors, and this secretory effector is then recognized by the R protein in the plant. The R gene, a plant resistance gene, mainly encodes a receptor protein and binds directly or indirectly to a bacterial effector, an infectious Avr gene product.

Generally, rice blast fungus ( Xanthomonas oryzae pv. ( Oryza sativa L.) blight caused by oryzae , Xoo ) causes serious damage to most rice producing countries, especially in equatorial regions. Bacterial blight is caused by gram-negative bacillus Xanthomonas oryzae pv. It is one of the major diseases of rice caused by oryzae ( Xoo ). It penetrates through the hand and wounds of rice leaves and propagates along the ducts. The rice blast fungus ( Xoo ) sprays a number of effector proteins including a transcription activator-like effector through T3SS (Type III Secretion System) ( Annu Rev Microbiol . , 54: 735-774, 2000 ; Biochim Biophys Acta . , 1694 (1-3): 181-206, 2004).

TALs (transcription activator-like effectors, TALEs) are a structurally and functionally distinct class of proteins of plant pathogenic bacteria, including Xanthomonas It is found in most of the genus bacteria that each Xanthomonas The bacteria have varying numbers of TAL effectors. The TAL effector acts as a transcription factor and specifically binds to a specific gene promoter region of the host cell to regulate the expression of the gene. The interaction of the TAL effector with the plant activates the host gene promoting virulence or activates a defense mechanism against the TAL effector ( Mol Plant Microbe Interact. , 13 (12): 1322-1329, 2000).

The TAL effector has the N-terminus required for T3SS, nuclear localization signals (NLSs) at the C-terminus, and transcription factor-specific AAD (acid activation domain). The TAL effector has a central region that differs mainly in the domains of 33 to 34 amino acids in length. In particular, polymorphism occurs in the 12, 13 residues of the domains, which is called repeat-variable di-residue (RVD).

Promoting the transcription of Os8N3 gene in rice by TAL effector PthXo1, which is a major pathogenic factor of rice blast fungus ( Xoo ), plays an important role in promoting bacterial proliferation and promoting the development of blight of blight, and activation of rice Os11N3 gene by TAL effector AvrXa7 ( Current Opinion in Plant Biology , 13: 394-401, 2010). It has been reported that rice is susceptible to rice blast fungus ( Xoo ). Korea ( Nucleic acid research , 33: 577-586, 2005), Japan ( Jpn Agric Res Q., 39: 275-287, 2005), Philippines (BMC genomics, 9:. 204 , 2008) was the base sequence of the separated strain Xoo reported surprisingly Xoo The TAL effector strain of the strain was completely different depending on the country in which the RVD sequence was isolated. The TAL effector study of Korean strains is important because the co-evolution of each country's strains has been done differently depending on the rice cultivars cultivated.

Under these circumstances, the inventors of the present invention have made efforts to develop a rice blight-resistant blight-resistant crop and to easily select a resistant crop. As a result, it was confirmed that OsbZIP73 gene derived from rice was activated by KACC10331, a Korean strain of rice blast fungus, , The present inventors completed the present invention by deriving the recognition site of the OsbZIP73 promoter that specifically binds to the TAL effector Xoo2279 of rice blast fungus.

Annu Rev Microbiol., 54: 735-774, 2000 Biochim Biophys Acta., 1694 (1-3): 181-206, 2004 Mol Plant Microbe Interact., 13 (12): 1322-1329, 2000 Current Opinion in Plant Biology, 13: 394-401, 2010 Nucleic acid research, 33: 577-586, 2005 Jpn Agric Res Q., 39: 275-287, 2005 BMC genomics., 9: 204, 2008

It is an object of the present invention to provide a process for producing Xanthomonas oryzae pv. oryzae, Xoo) of TAL effector Xoo2279 (Transcription activator-like effector Xoo2279 ) consisting of a nucleotide sequence shown in SEQ ID NO: 14, in combination with gene OsbZIP73 (Oryza sativa basic-leucine zipper 73) promoter (promoter) to provide short will be.

Another object of the present invention is to provide a recombinant vector for recognizing the TAL effector Xoo2279 gene sequence comprising the OsbZIP73 promoter fragment and the marker gene or fluorescent protein gene linked to the promoter fragment.

It is still another object of the present invention to provide a method of producing a rice blight-resistant blight or a blight-resistant blight-resistant blight-inducing plant by introducing a recombinant vector for recognizing the TAL effector Xoo2279 gene sequence into rice blight-resistant blight- b) infecting a rice blight-resistant blight-resistant strain or rice blight blight-resistant candidate plant into which a recombinant vector for recognizing the TAL effector Xoo2279 gene sequence has been introduced; And c) evaluating the OsbZIP73 promoter activity of the candidate rice blotch blight-resistant candidate plant as a control, using the rice blight-resistant blight-resistant rice varieties as a control, and to provide a method for screening rice blight-resistant blight-resistant plants.

It is still another object of the present invention to provide a recombinant vector for promoting resistance to blight of blight of rice blast, which comprises OsbZIP73 promoter fragment having a specific base mutated in the nucleotide sequence of SEQ ID NO: 14.

It is still another object of the present invention to provide a method for producing a transgenic plant having enhanced resistance to blight of blight of white blossom, comprising the step of transforming the recombinant vector into a plant using Agrobacterium, and a method for producing blight- And to provide transgenic plants with enhanced resistance.

In some embodiments for achieving the above object, the present invention is shown in SEQ ID NO: 14, in combination with rice huinip blight fungus TAL effector Xoo2279 (Transcription activator-like effector Xoo2279 ) of (Xanthomonas oryzae pv. Oryzae, Xoo) gene A promoter fragment of OsbZIP73 ( Oryza sativa basic-leucine zipper73) comprising the nucleotide sequence is provided.

In another embodiment, the present invention provides a recombinant vector for recognizing a TAL effector Xoo2279 gene sequence, which comprises the OsbZIP73 promoter fragment and a marker gene or a fluorescent protein gene linked to the promoter fragment.

In another aspect, the present invention provides a method for producing a rice blast fungus, comprising the steps of: a) introducing a recombinant vector for recognition of the TAL effector Xoo2279 gene sequence into a rice blight blight resistant variety or a rice blight blight resistance candidate plant; b) infecting a rice blight-resistant blight-resistant strain or rice blight blight-resistant candidate plant into which a recombinant vector for recognizing the TAL effector Xoo2279 gene sequence has been introduced; And c) evaluating the OsbZIP73 promoter activity of the candidate rice blotch blight-resistant candidate plant as a control group, wherein the rice blotch blight-resistant varieties are used as a control, to provide a method for screening rice blight-resistant blight-resistant plants.

In yet another embodiment, the present invention provides a recombinant vector for promoting blossom blight resistance in a bladder comprising a OsbZIP73 promoter fragment having a specific base mutated within the nucleotide sequence of SEQ ID NO: 14.

In another aspect, the present invention provides a method for producing a transgenic plant having enhanced blast resistance to rice blast foliage, comprising the step of transforming the recombinant vector into a plant using Agrobacterium, The present invention provides a transgenic plant having enhanced resistance to rice blight.

The OsbZIP73 promoter fragment that binds to the TAL effector Xoo2279 gene of the blight of rice blast fungus according to the present invention, that is, a mutation such as deletion, insertion or substitution of the promoter recognition site by the rice blast fungus, the present invention can be used not only to develop rice blight blight-resistant crops through mutation, but also to use OsbZIP73 promoter fragment that binds to the TAL effector Xoo2279 gene, to select a blight-resistant rice blight-resistant crop.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a graph showing the expression pattern of OsbZIP73 by KACC10331 according to one embodiment of the present invention.
2 is a diagram showing a gene sequence of Xoo2279 isolated by a transcription activator-like effector of a rice blast fungus strain KACC10331 according to an embodiment of the present invention. Here, the yellow box designation is the nucleotide sequence before the start of the repeat sequence, and the green box designation is the nucleotide sequence at which the repeat sequence starts.
FIG. 3 is a diagram showing the amino acid sequence of Xoo2279 isolated by a transcription activator-like effector of KACC10331 according to an embodiment of the present invention. Here, the yellow box designation is the repeated amino acid sequence and the green box designation is the amino acid sequence of the transcriptional activation domain.
FIG. 4 is a diagram showing RVD (repeat variable diresidues) sequence, which is a DNA binding site of the TAL effector Xoo2279 of rice blotter blight-killer strain KACC10331 according to a temporary example of the present invention.
FIG. 5 is a diagram schematically showing a vector map for plant transformation of the TAL effector Xoo2279 of rice blast fungus strain KACC10331 according to an embodiment of the present invention. Here, P35S is Cauliflower mosaic virus (CaMV) 35S promoter, and DsRed :: His is a promoter of Discosoma sp. red fluorescent protein :: 6 × histidine, Tnos is a nopaline synthase terminator, Bar is a bialaphos resistance gene, and T35S is a CaMV 35S terminator.
6 shows a nucleotide sequence (SEQ ID NO: 13) of the isolated OsbZIP73 promoter ( Oryza sativa basic-leucine zipper 73 promoter) according to an embodiment of the present invention. Here, the red marking area indicates the binding site with the TAL effector Xoo2279 of KACC10331.
FIG. 7 is a diagram schematically showing a pOsbZIP73 :: GFP-GUS reporter vector map prepared by isolating the OsbZIP73 promoter according to an embodiment of the present invention. Here, pOsbZIP73 is a 1.0 kb Oryza sativa basic-leucine zipper 73 promoter region, GFP is a Green Fluorescent Protein, GUS is a Beta-glucuronidase reporter gene, P35S is a Cauliflower mosaic virus (CaMV) 35S promoter, Bar is a bialaphos resistance gene, and T35S is a CaMV 35S terminator.
8 is a graph showing the results of a promoter transient assay in which the activity of the OsbZIP73 promoter according to the binding of the effector binding element (EBE) region, which is a recognition site of the OsBZIP73 promoter, with the TAL effector Xoo2279 according to an embodiment of the present invention.

The present invention relates to a method for producing Xanthomonas oryzae pv. oryzae ( Xoo )) and a use thereof, and more particularly, to a promoter recognition site by OsbZIP73 ( Oryza sativa basic-leucine (Xoo)), which binds to a transcription activator-like effector Xoo2279 gene of a rice blotter- zipper 73) promoter fragment, a OsbZIP73 promoter fragment and a marker gene or a fluorescent protein gene linked to the promoter fragment, a recombinant vector for recognizing the TAL effector Xoo2279 gene sequence, and a recombinant vector for recognizing the TAL effector Xoo2279 gene sequence A method for screening a rice blight-resistant blight-resistant plant, a recombinant vector for promoting rice blight blight resistance resistance including the OsbZIP73 promoter fragment having a specific base mutation, a method for producing a transgenic plant having enhanced blast resistance to rice blight using the recombinant vector, The resistance to blight of rice blast prepared by the method To an enhanced transgenic plant.

In one embodiment, the present invention relates to a method for producing Xanthomonas oryzae pv. It provides oryzae, TAL effector Xoo2279 (Transcription activator-like effector Xoo2279 ), SEQ ID NO: 14 OsbZIP73 (Oryza sativa basic-leucine zipper 73) promoter (promoter) fragment consisting of a nucleotide sequence shown in binding to the gene of Xoo).

In the present invention, the term " Xanthomonas oryzae pv. oryzae , Xoo ) "is a gram-negative bacterium, which is a host-specific pathogen that is pathogenic only to rice. It infects rice and causes bacterial blight (BB), invades through the hand and wounds of rice leaves The rice blast fungus sprouts a number of effector proteins including the TAL effector (TALE) through the T3SS (type III secretion system).

In the present invention, the above-mentioned Xanthomonas oryzae pv. oryzae , Xoo ) is a Korean strain KACC10331, which is known to have 15 effector proteins.

The term "transcription activator-like effector (TALE)" in the present invention is a structurally and functionally distinct type of protein of plant pathogenic bacteria. It is found in most of the bacterium belonging to the genus Xanthomonas . Each Xanthomonas strain has a variety of TAL effectors Lt; / RTI > The TAL effector has an N-terminal, a nuclear localization signals (NLSs) and a transcription factor-specific AAD (acid activation domain) at the C-terminus necessary for T3SS (type III secretion system) do. It moves from the plant cell to the nucleus and binds to the TAL effector-specific DNA sequence and participates in the expression of the sub-gene. The interaction with the plant activates the host gene promoting the pathogenesis, or acts as a defense mechanism against the TAL effector do.

In the present invention, the term " transcription activator-like effector Xoo2279 "refers to a mutant of Xanthomonas oryzae pv. oryzae , Xoo ) is a TAL effector derived from KACC10331 , also known as TALE 2, and induces transcripts such as MLA6 protein, Cationic peroxidase 1, OsbZIP30, and OsbZIP67.

TALE 2 is made up of 23 repeat variable dinucleotides (RVD), and the 'RVD sequence' is a combination of TAL effectors Is understood to be a contiguous sequence of RVD in the domain, in which case the sequence is specified in the NC-direction, i.e. from the N-terminus to the C-terminus, unless otherwise specified.

The term "OsbZIP73 ( Oryza sativa basic-leucine zipper 73)" in the present invention refers to a family of ABRE (ABA -responsive element) / ABF (ABRE binding factor) family controlling the growth, development, Derived transcription factor gene belonging to the rice.

The term "promoter" in the present invention refers to a gene which is located upstream (5 ') in relation to the transcription direction of a transcription start site of a gene (transcription start time is represented by a position +1 of a sequence, Is expressed using a negative number), a binding site for a DNA-dependent RNA polymerase, a transcription initiation site, a transcription factor binding site, an inhibitor and an activator protein binding site, and a direct or indirect control of the amount of transcription from the promoter , Which is structurally identified by the presence of any other DNA domain (cis-acting sequence), including, but not limited to, any other nucleotide sequence known to those skilled in the art ≪ / RTI > Examples of eukaryotic cysfunction sequences upstream of the transcription start point (+1) include TATA boxes, CAAT boxes, 5 'enhancers or silencing factor elements.

The term "OsbZIP73 (promoter) of Oryza sativa basic-leucine zipper 73" in the present invention is a rice-derived transcription factor OsbZIP73 gene promoter, consisting of the nucleotide sequence of SEQ ID NO: 13, and Xanthomonas oryzae pv. oryzae ) KACC10331.

The term "inducible promoter " means a promoter that is physiologically (for example, external action of a specific compound) or embryologically controlled.

The term "OsbZIP73 promoter fragment" in the present invention refers to a region of the OsbZIP73 promoter to which transcription factors bind, and includes an EBE (effector) specifically binding to the TAL effector Xoo2279 of rice blast fungi, binding element. The OsbZIP73 promoter fragment is contained in the upstream (-300) to (-100) sites based on the transcription start site (+1) of the OsbZIP73 gene and consists of the nucleotide sequence of 'TATAAAAGGCCCTCACCAACCCAT' (SEQ ID NO: 14) .

In one embodiment of the present invention, a bacterium belonging to the genus Xanthomonas oryzae pv. oryzae ) KACC10331 significantly increased the expression of the OsbZIP73 gene, and it was confirmed that the OsbZIP73 promoter fragment specifically binds to the TAL effector Xoo2279 derived from the rice blast fungus KACC10331 to induce the promoter activity (FIGS. 1 and 8 ).

In another embodiment, the present invention provides a recombinant vector comprising an OsbZIP73 ( Oryza sativa basic-leucine zipper73) promoter fragment comprising the nucleotide sequence shown in SEQ ID NO: 14 and a marker gene or a fluorescent protein gene linked to the promoter fragment. Provides a recombinant vector for recognizing the TAL effector Xoo2279 gene sequence.

The term "recombinant" in the present invention refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been re-introduced into the cell by an artificial means as modified.

The term "vector" in the present invention is used to refer to a DNA fragment (s), a nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "expression vector" is often used interchangeably with a "recombinant vector ". The term "recombinant vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

In accordance with one embodiment of the present invention, a rice blast fungus ( Xanthomonas oryzae pv. oryzae ) The plant-derived pathogen-inducible expression vector comprising the OsbZIP73 inducible promoter activated by KACC10331 may comprise the construction of a conventional plant expression vector and may contain known components essential for plant expression vectors . For example, the plant-derived pathogen-inducible expression vector may include an enhancer, a pathogen-inducible promoter of the present invention, a cloning site, a transcription termination site, and a selection marker. In addition, the plant pathogen-inducible expression vector may be obtained by replacing a promoter with a promoter of the present invention in a conventional vector. Examples of the conventional vector include pUC family vectors such as pBR322, pBI121, pCAMBIA vector series, Gateway a bacterium, a bacterium vector, a Ti-plasmid, and the like.

A preferred example of a plant expression vector is a Ti-plasmid vector which is capable of transferring a so-called T-region into a plant cell when present in a suitable host such as Agrobacterium tumefaciens . Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences to plant cells or protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that may be used to introduce the DNA according to the present invention into a plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e.g., CaMV), single-stranded viruses, For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as Kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, Resistant genes, but are not limited thereto.

In the plant expression vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto. The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In an expression vector according to an embodiment of the present invention, the terminator can be a conventional terminator, such as nopaline synthase (NOS), rice alpha-amylase (alpha-Amy1A) terminator, phaseoline, Terminator, and the terminator of the Octopine gene of agrobacterium tumefaciens, but is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells.

When the vector of the present invention is transformed into eukaryotic cells, yeast ( Saccharomyce cerevisiae ), insect cells, animal cells (such as CHO (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines), plant cells, and the like. The host cell is preferably a plant cell.

"Plant cell" used for transformation of a plant may be any plant cell. The plant cell may be any of a cultured cell, a cultured tissue, a culture or whole plant, preferably a cultured cell, a cultured tissue or culture medium, and more preferably a cultured cell.

The method of delivering the vector of the present invention into a host cell can be carried out by injecting a vector into a host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment and gene bombardment .

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens, FA et al. , 1982, Nature 296, 72-74; Negrutiu I. et al ., June 1987, Plant Mol . Biol . 8, 363-373) (Shillito RD et al. , 1985 Bio / Technol . 3, 1099-1102), microinjection into plant elements (Crossway A. et al. , 1986, Mol . Gen. Genet. 202,179-185 (Klein et al. , 1987, Nature 327, 70), the infiltration of plants or the transformation of Agrobacterium tumefaciens Infection by viruses (non-integrative) in virus-mediated gene transfer (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EP A 120 516 and U.S. Pat. No. 4,940,838.

In the recombinant expression vector according to the present invention, the marker gene may be, but not limited to, GUS (β-glucuronidase).

In addition, in the recombinant expression vector according to the present invention, the fluorescent protein may be, but is not limited to, green fluorescent protein (GFP), luciferase, or cyan fluorescent protein (CFP).

The recombinant expression vector according to the present invention may include all of the marker gene and the fluorescent protein gene, but not limited thereto, and may optionally include a marker gene or a fluorescent protein gene.

The recombinant vector for recognizing the TAL effector Xoo2279 gene sequence according to the present invention may comprise the OsbZIP73 promoter fragment consisting of the nucleotide sequence of 'TATAAAAGGCCCTCACCAACCCAT' (SEQ ID NO: 14), that is, the OsbZIP73 promoter recognition site, and the OsbZIP73 promoter recognition And a OsbZIP73 promoter comprising the nucleotide sequence of SEQ ID NO: 13, wherein the promoter region (SEQ ID NO: 14) is included. The OsbZIP73 promoter gene contained in the recombinant vector for recognizing the TAL effector Xoo2279 gene sequence is not limited to a specific base sequence, as long as it essentially includes the OsbZIP73 promoter recognition site comprising the nucleotide sequence of 'TATAAAAGGCCCTCACCAACCCAT' (SEQ ID NO: 14).

In one embodiment of the present invention, a TAL effector vector and an OsbZIP73 gene promoter region designated as 35S :: Xoo2279-DsRed (SEQ ID NO: 13; OsbZIP73 promoter region, designated as 35S :: Xoo2279-DsRed) containing the TAL effector Xoo2279 of rice blotter- A reporter vector named OsbZIP73 :: GFP-GUS containing the recognition site (SEQ ID NO: 14) was prepared and introduced into Agrobacterium LBA4404 ( Agrobacterium LBA4404) Nicotiana benthamiana and subjected to a promoter transient assay to measure the activity of the OsbZIP73 promoter according to the binding of the effector binding element (EBE) region, which is the recognition site of the TAL effector Xoo2279 and OsbZIP73 promoter, that is, the marker gene GUS As a result of observing the color development reaction of the genes, recognition sites of the TAL effector Xoo2279 derived from rice blast fungus KACC10331 and the rice-derived OsbZIP73 promoter were specifically (Fig. 5, Fig. 7 and Fig. 8).

Thus, using the reporter vector designated as OsbZIP73 :: GFP-GUS containing the fragment of the OsbZIP73 gene promoter of the present invention (SEQ ID NO: 14), the TAL effector Xoo2279 of the rice blotter blight disease strain KACC10331 When the gene sequence is recognized, it is possible to judge whether or not the KACC10331 strain of rice blast fungus, KACC10331, is infected depending on whether or not the marker gene or the fluorescent protein gene is expressed.

In the present invention, the activity of the promoter may be analyzed by, for example, but not limited to, a system for producing a transgenic plant through an Agrobacterium-mediated transformation method inducing a stable gene expression, and a system for producing Agrobacterium- ) Can be used to perform a quick and easy analysis through temporary expression analysis. Preferably, the promoter activity can be analyzed by transient expression analysis using Agroinfiltration using Agrobacterium.

Transgenic plants produced by the transformation method using Agrobacterium may be somewhat wasteful in terms of cost, labor, and time, depending on the cultivation conditions of plant species. However, the temporary expression system using Agroinfiltration method is more labor saving , Resulting in cost savings and time savings in analysis. In addition, tobacco can be used in a variety of plant species including tomato, as well as Arabidopsis thaliana, and may be through agroinfiltration how to perform a more even expression as well as the promoter activity demonstrated experiments of specific genes economic (Yang et al. (2000) The Plant J. 22 (6): 543-551).

In another aspect, the present invention provides a method for producing a rice blast fungus, comprising the steps of: a) introducing a recombinant vector for recognition of the TAL effector Xoo2279 gene sequence into a rice blight blight resistant variety or a rice blight blight resistance candidate plant; b) a rice blotter-resistant cultivar or a rice blight-resistant blight-resistant plant to which the recombinant vector for recognizing the TAL effector Xoo2279 gene sequence has been introduced, in which Xanthomonas oryzae pv. oryzae , Xoo ); And c) evaluating the degree of OsbZIP73 ( Oryza sativa basic-leucine zipper 73) promoter activity of a candidate rice blight-resistant blight-resistant plant using a rice blight-resistant blight-resistant variety as a control group. ≪ / RTI >

In the present invention, the recombinant vector for recognizing the TAL effector Xoo2279 gene sequence is the recombinant vector comprising the OsbZIP73 promoter fragment consisting of the nucleotide sequence shown in SEQ ID NO: 14 and the fluorescent protein gene linked to the promoter fragment.

In one embodiment of the present invention, the recombinant vector for recognizing the TAL effector Xoo2279 gene sequence comprises a fragment (SEQ ID NO: 14) of the OsbZIP73 gene promoter that specifically binds to the TAL effector Xoo2279 gene sequence of rice blotch bacterium KACC10331 as a target sequence A promoter (SEQ ID NO: 13) of about 1.0 kb from the initiation codon of OsbZIP73 was isolated and introduced to produce a recombinant vector named OsbZIP73 :: GFP-GUS (Fig. 7).

In step a), the rice blight-resistant blight varieties may be, but are not limited to, rice blossom resistant varieties of rice blossom blight, shiny pear, shinbyeo rice paddy, rice paddy, sowan rice, or rice paddy.

A promoter fragment of OsbZIP73 ( Oryza sativa basic-leucine zipper 73) consisting of the nucleotide sequence shown in SEQ ID NO: 14 in step a) and a TAL effector Xoo2279 gene sequence comprising a marker gene or a fluorescent protein gene linked to the promoter fragment The method for introducing the recombinant vector for recognition can be carried out by a transformation technique known to a person skilled in the art, without limitation thereto. For example, microprojectile bombardment, particle gun bombardment, silicon carbide whiskers, sonication, electroporation, PEG-mediated fusion PEG-mediated fusion, microinjection, liposome-mediated method, In planta transformation, Vacuum infiltration method, floral meristem dipping method, Agrobacterium sp. mediated method, and the like, but the present invention is not limited thereto. In addition, the method of the present invention comprises regenerating a transgenic plant from the transformed plant cell. Any of the methods known in the art can be used for regeneration of transgenic plants from transgenic plant cells.

The term "transformation" means genetically changing the characteristics of an individual or a cell by DNA, which is a genetic material given from the outside.

In step (b) above, the above-mentioned rice blight-resistant bacterium ( Xanthomonas oryzae pv. oryzae , Xoo ) may be, but is not limited to, KACC10331 strain of rice blast fungus, and the KACC10331 strain of rice blotch sprouts the TAL effector-like effector Xoo2279 protein, also known as TALE 2 .

Meanwhile, a recombinant vector for recognizing the TAL effector Xoo2279 gene sequence comprising the OsbZIP73 promoter fragment consisting of the nucleotide sequence shown in SEQ ID NO: 14 introduced in step a) and the marker gene or the fluorescent protein gene linked to the promoter fragment, b), the expression of the marker gene or the fluorescent protein is induced by the interaction with the TAL effector Xoo2279 derived from KACC10331, that is, the transcriptional promoting activity through specific binding between the OsbZIP73 promoter fragment and the TAL effector Xoo2279.

Thus, in the step c), the degree of promoter activity of OsbZIP73 ( Oryza sativa basic-leucine zipper 73) promoter was evaluated by measuring the expression level of the marker gene or fluorescent protein, that is, the degree of chromogenic response or the fluorescence intensity Therefore, it is possible to select the resistance of rice blight blight-resistant plants by judging the degree of resistance of rice blight-resistant blight-susceptible plants to rice blight-susceptible bacteria. For example, when the degree of chromogenic response or fluorescence intensity is similar to that of rice blight-resistant blight-resistant varieties, candidate blight-resistant blight-resistant plants can be judged to be rice blight-resistant blight-resistant varieties.

In another embodiment, the present invention provides a recombinant vector for promoting rice blight blight resistance resistance comprising a promoter fragment of OsbZIP73 ( Oryza sativa basic-leucine zipper 73) having a specific base mutated in the nucleotide sequence of SEQ ID NO: Lt; / RTI >

As described above, the "OsbZIP73 promoter fragment" is a partial region of the OsbZIP73 promoter to which the transcription factor binds. As described above, the " OsbZIP73 promoter fragment " The OsbZIP73 promoter fragment is contained in the upstream region (-300) to (-100) of the OsbZIP73 gene based on the transcription start site (+1) of the OsbZIP73 gene, and the 'TATAAAAGG CCCTCA CCAACCCAT' (SEQ ID NO: 14).

In the present invention, the term "a specific base is mutated" includes, but is not limited to, deletion, insertion or deletion of a specific base in the nucleotide sequence of the OsbZIP73 promoter fragment comprising the nucleotide sequence shown in SEQ ID NO: Or may be substituted. On the other hand, the "mutation" may be that the TATA box is not mutated within the nucleotide sequence of SEQ ID NO: 14.

The recombinant vector comprising the OsbZIP73 promoter fragment having a specific base mutation within the nucleotide sequence of SEQ ID NO: 14 according to the present invention comprises the nucleotide sequence shown in SEQ ID NO: 14 OsbZIP73 promoter fragment, that is, the OsOsbZIP73 promoter recognition site and the binding to the TAL effector Xoo2279 of rice blast fungus can be inhibited or blocked by a specific base mutation in the nucleotide sequence of the OsbZIP73 promoter fragment. Thus, the transcription activity of the OsbZIP73 promoter induced by the rice blast fungus can be inhibited and the plant resistance to the rice blast fungus can be enhanced.

In one embodiment of the present invention, an OsbZIP73 promoter region (in the nucleotide sequence of SEQ ID NO: 14) of a bacterial culture broth in which Agrobacterium LBA4404 in which an effect vector containing a TAL effector Xoo2279 gene is introduced and a mutant strain TBA effector Xoo2279 and OsbZIP73 promoter were transfected using a 1: 1 mixture of bacterial culture in which Agrobacterium LBA4404 with reporter vector containing specific base mutation (underlined); TATAAAAGG ATTGTG CCAACCCAT The activity of the OsbZIP73 promoter according to the binding of the effector binding element (EBE) region, which is a recognition site of the OsbZIP73 promoter, was measured by a promoter transient assay.

As a result, it was found that the binding of the OsbZIP73 promoter to the recognition site of the TAL effector Xoo2279 and the recognition site of the OsbZIP73 promoter was blocked by the recognition site mutation, and OsbZIP73 promoter specifically binding to the TAL effector Xoo2279 derived from the rice blast fungus strain KACC10331 The mutation of the recognition site of the TAL effector and the interaction with the plant could be controlled.

In another embodiment, the present invention provides a recombinant vector comprising an OsbZIP73 ( Oryza sativa basic-leucine zipper 73) promoter fragment in which a specific base is mutated in the nucleotide sequence of SEQ ID NO: 14 using Agrobacterium A method for producing a transgenic plant having increased resistance to blight of blight of white blossom, comprising the step of transforming a plant.

The above-mentioned "recombinant vector comprising the OsbZIP73 promoter fragment in which a specific base is mutated within the nucleotide sequence of SEQ ID NO: 14" is as described above.

 The term "transformed" in the present invention refers to introducing and integrating a nucleic acid encoding a heterologous gene to be introduced into a host cell of a plant or a vector containing the nucleic acid into a host cell to produce a genetically stable genome, "Transgenic plant" means a plant in which the heterologous gene has been introduced and genetically stably integrated to obtain the desired phenotype.

With regard to producing transgenic plants, methods of genetic engineering of plants are well known in the art. Numerous methods for plant transformation have been developed, including, for example, biological and physiological transformation protocols for dicotyledonous plants as well as dicotyledonous plants (see, for example, Goto-Fumiyuki et al ., Nature Biotech 17: CRC Press, Inc., Boca Raton, pp. 67-88 (1993)], which is incorporated herein by reference in its entirety); [Miki et al ., Methods in Plant Molecular Biology and Biotechnology , Glick, BR and Thompson, JE Eds. ). In addition, vector and in vitro culture methods for plant cell or tissue transformation and regeneration of plants are available, for example, in the following references: Gruber et al ., Methods in Plant Molecular Biology and Biotechnology , Glick, BR and Thompson, JE Eds., CRC Press, Inc., Boca Raton, pp. 89-119 (1993)].

For example, a number of techniques are available for transforming desired genes into plant host cells. These techniques include, but are not limited to, transformation with non-arm T-DNA using Agrobacterium tumefaciens or Agrobacterium rejugens as a transformation agonist, calcium phosphate transfection, polybrene transformation, protoplast fusion, , Ultrasound method (e.g., sonophoresis), liposome transformation, microinjection, intact DNA, plasmid vectors, viral vectors, biolistics (ultrafine particle impact), silicon carbide WHISKERS mediated transformation, aerosol beading , Or PEG transformation as well as other possible methods.

In addition, the present invention provides a transgenic plant improved in resistance to blight of blight of blight prepared by the method for producing a transgenic plant according to the present invention.

The plant may be a food crop selected from the group consisting of rice, wheat, barley, corn, soybean, potato, wheat, red bean, oats and millet, preferably rice.

Hereinafter, the constitution and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example  1: rice Blight of white blight On KACC10331  by OsbZIP73  Expression pattern analysis

Sunflower seeds were germinated for 3 days and 3 weeks after sowing, greenhouse was secured. In addition, rice blast fungus ( Xanthomonas oryzae pv. oryzae KACC10331 was cultivated in PSA medium (1.0% bacto-peptone, 1.0% sucrose, 0.1% monosodium glutamate, 1.5% agar) for 2 days Suspended in 10 mM MgCl ₂ , adjusted to 0.5 at OD ₆₀₀ , and inoculated with rice toothpick. Total RNA was then isolated from rice leaves using a Trizol reagent kit (Invitrogen, USA), and oligo dT primer and MMLV reverse transcriptase (Promega, USA) ) Was used to synthesize cDNA. (SEQ ID NO: 1) and OsbZIP73 qRT-PCR primer-R (5'-catctggtaggcgtcatctg-3 '; SEQ ID NO: 2), as well as OsbZIP73 qRT-PCR (Quantitative real-time PCR) primer-F (5'-tcccactaccacagcaacat- (5'-ATCCTTGTATGCTAGCGGTCGA-3 '; SEQ ID NO: 3) and Osactin qRT-PCR primer-R (5'-ATCCAACCGGAGGATAGCATG-3'; SEQ ID NO: 4) for the control actin The qPCR used was performed using MyIQ (BioRad, USA).

As a result of analysis of the expression pattern of OsbZIP73 ( Oryza sativa basic-leucine zipper 73) in rice by the rice blast fungus KACC10331 by carrying out qRT-PCR, as shown in the following Fig. 1, it was found that 3 hours after inoculation with rice blast fungus strain KACC10331 , OsbZIP73 expression was induced, and it was confirmed that it was significantly increased.

Primer set for OsbZIP73 expression analysis SEQ ID NO: primer  designation primer  direction The sequence (5 '- > 3') One OsbZIP73 qRT-PCR-F Forward 5'-aaaaagcaggcttgATGGCGGCGGCGGCGTTG-3 ' 2 OsbZIP73 qRT-PCR-R Reverse 5'-agaaagctgggtaGCTTGAAGTGCATCCTAC-3 ' 3 Osactin qRT-PCR-F Forward 5'-ATCCTTGTATGCTAGCGGTCGA-3 ' 4 Osactin qRT-PCR-R Reverse 5'-ATCCAACCGGAGGATAGCATG-3 '

From the above results, it was found that the OsbZIP73 promoter gene showed susceptibility to rice blast fungus.

Example  2: OsbZIP73  Promoter Binding Effects  Navigation and separation

In Example 1, the expression of OsbZIP73 in rice was increased by KACC10331, a blight of rice blotter.

In order to investigate effectors that increase the expression of OsbZIP73, a TAL effector nucleotide targeter 2.0 was used to derive a web program (https://tale-nt.cac.cornell.edu).

As a result, as shown in the following Table 2, it was confirmed that Xoo2279 among the TAL effector (transcription activator-like effector) of KACC10331 isolated from Korea was likely to bind OsbZIP73 promoter.

TAL effector score effector  binding element sequence SEQ ID NO: Xoo2279 15.94 TATAAAAGG CCCTCA CCAACCCAT 14

From the above results, it can be concluded that Xanthomonas oryzae pv. The effector binding element region of OsbZIP73 promoter derived from rice was specifically bound to the TAL effector Xoo2279 derived from KACC10331, and it was found that there was a possibility of controlling the blight of rice blast.

Example  3: TAL Effects On Xoo2279  Including the recognition site for OsbZIP73  Activation of the promoter

In Example 1 above, Xanthomonas sp. oryzae pv. oryzae KACC10331 significantly increased the expression of the OsbZIP73 promoter. In Example 2, it was confirmed that the effector binding element (EBE) region of the OsbZIP73 promoter and the TAL effector Xoo2279 could bind to each other.

Therefore, we investigated whether rice blotch blight disease can be controlled by specific binding of the TAC effector Xoo2279 derived from rice blast fungus strain KACC10331 and the EBE (effector binding element) region of the OsbZIP73 promoter.

To this end, the TAL effector Xoo2279 was isolated to construct an expression vector 35S :: Xoo2279-DsRed for plant transformation, OsbZIP73 promoter containing EBE (effector binding element) region of the OsbZIP73 promoter was isolated, and pOsbZIP73 :: GFP-GUS A reporter vector was constructed. The promoter transient assay was performed using the vector prepared above, and the OsbZIP73 promoter activity was confirmed by binding of the effector binding element (EBE) region, which is a recognition site of the TAL effector Xoo2279 and the OsbZIP73 promoter.

Example  3-1: TAL Effects Xoo2279  Creation of vector for isolation and plant expression

Huinip rice blight bacterium (Xanthomonas oryzae pv. Oryzae) by separating the genomic DNA (genomic DNA) from KACC10331 separate the 2 ~ 4kb region was cleaved with BamHI and cloned (cloning) by pBluscript. Thereafter, it was confirmed to be Xoo2279 by sequencing. At this time, BamHI Since the C-terminal domain of the fragment was deleted, PCR amplification (PCR) using genomic Polymerase Chain Reaction (PCR) using the primer set (SEQ ID NO: 5 and SEQ ID NO: 6) The PCR product was digested with BamHI And introduced using a site.

The gene sequence (SEQ ID NO: 11) and amino acid sequence (SEQ ID NO: 12) of the TAL effector (transcription activator-like effector) Xoo2279 of rice blotchybaceae strain KACC10331 identified by nucleotide sequence determination are shown in FIGS. 2 and 3 Respectively.

Meanwhile, RVD (repeat variable diresidue) sequence, which is the DNA binding site of the TAL effector Xoo2279 of rice blast fungus strain KACC10331, is shown in FIG.

To prepare a plant expression vector, it was digested with EcoRV and SacI and ligated to the SmaI and SacI site of pCambia3300 to create an intermediate vector. A C-terminal portion was obtained by SacI cleavage of Xoo2279 to obtain a middle vector And introduced into SacI site to finally produce an expression vector for plant transformation of TAL effector Xoo2279 designated as 35S :: Xoo2279-DsRed (FIG. 5).

SEQ ID NO: primer  designation primer  direction The sequence (5 '- > 3') 5 Xoo2279 C genomic PCR-F Forward 5'-aggcgtctttgcatgcattcgccgattcgct-3 ' 6 Xoo2279 C genomic PCR-R Reverse 5'-tcagatcgtccctccgactgagcctgact-3 '

Example  3-2: OsbZIP73  Separate promoter and create reporter vector

According to the gateway cloning method, a promoter of about 1.0 kb from the initiation codon of OsbZIP73 (Os09g29820) (SEQ ID NO: 13 and FIG. 6) was isolated to construct a reporter vector named pOsbZIP73 :: GFP-GUS. On the other hand, as a control group, a reporter vector containing a mutant OsbZIP73 promoter region (SEQ ID NO: 14) was prepared.

Specifically, PCR was performed using OsbZIP73 promoter primer-F (5'-aaaaagcaggctCCACAATTAGGAATTGCAGG-3 '; SEQ ID NO: 7) and OsbZIP73 promoter primer-R (5'-agaaagctgggtagGCTGTTTTCGCTTGCTTAG-3' Respectively. At this time, PCR was performed at 95 ° C for denaturation, annealing and extension at 57 ° C and 72 ° C for 30 cycles, respectively.

PCR products amplified by PCR were amplified using attB1 primer-F (5'-GGGGACAAGTTTGTACAAAAAAAAGCAGGCT-3 '; SEQ ID NO: 9) and attB2 primer-R (5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3' PCR was repeated. OsBZIP73 PCR products for attB1 and attB2 adapter primer-attached promoter vectors were cloned into pDNOR221 vector through BP clonase reaction to produce entry clones. From the entry clone, pOsbZIP73 :: GFP-GUS reporter vector for plant promoter activity assay was prepared by the LR reaction ((LR clonase reaction) to pBGWFS7, which is a destination vector for plant promoter cloning (Fig.

SEQ ID NO: primer  designation primer  direction The sequence (5 '- > 3') 7 OsbZIP73 promoter primer-F Forward 5'-aaaaagcaggctCCACAATTAGGAATTGCAGG-3 ' 8 OsbZIP73 promoter primer-R Reverse 5'-agaaagctgggtAGGCTGTTTTCGCTTGCTTAG-3 ' 9 AttB1 primer-F Forward 5'-GGGGACAAGTTTGTACAAAAAAAGCAGGCT-3 ' 10 AttB2 primer-R Reverse 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3 '

Example  3-3: Using Agrobacterium OsbZIP73  Promoter activity measurement

(Expression vector 35S :: Xoo2279-DsRed for plant transformation of TAL effector Xoo2279) prepared in Example 3-1 and the reporter vector (OsbZIP73 :: GFP-GUS) prepared in Example 3-2 And then introduced into Agrobacterium LBA4404 ( Agrobacterium LBA4404) and then cultured. Bacterial cultures in which Agrobacterium LBA4404 in which each vector was introduced were mixed with 1: 1 and infiltrated into Nicotiana benthamiana grown for 6 weeks or more. The tobacco leaves were harvested for 24 hours, cut into discs, stained with X-glu (5-bromo-4-chloro-3-indolyl-β-glucuronide) and discolored with 70% alcohol.

On the other hand, only the bacterial culture broth in which Agrobacterium LBA4404 in which the reporter vector containing the native OsbZIP73 promoter region (SEQ ID NO: 13; OsbZIP73 promoter recognition site (SEQ ID NO: 14) was included) was infiltrated Tobacco plants, tobacco plants infested with only the bacterial culture of Agrobacterium LBA4404 containing the reporter vector containing the OsbZIP73 promoter region of the mutant, and tobacco plants infected with the effector vector containing the TAL effector Xoo2279 gene A tobacco plant infected with a bacterial culture in which Agrobacterium LBA4404 was cultured and a culture broth of Agrobacterium LBA4404 in which a reporter vector containing the OsbZIP73 promoter region of the mutant was introduced was mixed at a ratio of 1: Respectively.

Using the Agrobacterium transformed with the vectors prepared in Examples 3-1 and 3-2, the OsbZIP73 promoter according to the binding of the effector binding element (EBE) region, which is the recognition site of the TAL effector Xoo2279 and the OsbZIP73 promoter, results the activity was measured by following the promoter transient assay, to 8, the rice huinip blight bacterium (Xanthomonas oryzae pv. oryzae) KACC10331 combined derived the recognition site of the TAL effector Xoo2279 and rice-derived OsbZIP73 promoter specific Respectively. On the other hand, no activity was observed in the control group.

From the above results, it can be concluded that Xanthomonas oryzae pv. oryzae ), the OsbZIP73 promoter was activated for the rice blast fungus by the specific recognition site of the TAL effector Xoo2279 derived from KACC10331 and the OsbZIP73 promoter derived from rice. The OsbZIP73 promoter was recognized by the mutation of the recognition site of the TAL effector Xoo2279 Binding of the effector binding element (EBE) region, which is a recognition site of the OsbZIP73 promoter, was blocked.

Accordingly, mutation of the recognition site of the OsbZIP73 promoter that specifically binds to the TAL effector Xoo2279 derived from rice blast fungus KACC10331 can be mutated to regulate the interaction between the TAL effector and the plant to develop a blight-resistant rice blight blight In addition, the recognition site of the OsbZIP73 promoter can be used to easily screen rice blight-resistant crops against the TAL effector Xoo2279.

<110> Republic of Korea <120> Promoter recognition site by Xanthomonas oryzae pv. oryzae and          uses thereof <130> P17R12C0752 <160> 14 <170> KoPatentin 3.0 <210> 1 <211> 32 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > OsbZIP73 qRT-PCR-F <400> 1 aaaaagcagg cttgatggcg gcggcggcgt tg 32 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > OsbZIP73 qRT-PCR-R <400> 2 agaaagctgg gtagcttgaa gtgcatccta c 31 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > Osactin qRT-PCR-F <400> 3 atccttgtat gctagcggtc ga 22 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Osactin qRT-PCR-R <400> 4 atccaaccgg aggatagcat g 21 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Xoo2279 C genomic PCR-F <400> 5 aggcgtcttt gcatgcattc gccgattcgc t 31 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Xoo2279 C genomic PCR-R <400> 6 tcagatcgtc cctccgactg agcctgact 29 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > OsbZIP73 promoter primer-F <400> 7 aaaaagcagg ctccacaatt aggaattgca gg 32 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> OsbZIP73 promoter primer-R <400> 8 agaaagctgg gtaggctgtt ttcgcttgct tag 33 <210> 9 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> AttB1 primer-F <400> 9 ggggacaagt ttgtacaaaa aagcaggct 29 <210> 10 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> AttB2 primer-R <400> 10 ggggaccact ttgtacaaga aagctgggt 29 <210> 11 <211> 4500 <212> DNA <213> Artificial Sequence <220> <223> Xoo2279 <400> 11 ttgggccggt tttggttttc agggacatcg attcttcaca ccagaaaatt acgacatcga 60 gccctgcggc atgcggtact gggcgctgac ctgcgccatc gcacgggagt ggtcgctgat 120 gatgtccgaa gaacgcaata cgcgctcggc gaccccgcga acgcctactg ccaccaggtc 180 tccgggggcg cgtttgtctc aaggcgcaga aatgatctac ctgcgggacg tactcgaggg 240 ttggcaggga ttcgtataaa aaaacagcca aaagtgggtt cactcgctgt cagcacagaa 300 atttttcaca accttctgcc gatcctccat gcgggtccgg gatcgccttc atgtctgcgc 360 ctcaccctgg tcgtcgaggg ttgccaggat cacccgaagt tgtgtactgc catgcggcct 420 cggaagctat gtagggacca cagaccgcta gtctggaggc aaccatgtaa agaggtatgc 480 ctgatggatc ccattcgttc acgcacgcca agtcctgccc gcgagcttct gcccggcccc 540 caaccggata gggttcagcc gactgcagat cggggggggg ctccgcctgc tggcggcccc 600 ctggatggct tgcccgctcg gcggacgatg tcccggaccc ggctgccatc tccccctgcg 660 ccctcgcctg cgttctcggc gggcagcttc agcgatctgc tccgtcagtt cgatccgtcg 720 cttcttgata catcgcttct tgattcgatg cctgccgtcg gcacgccgca tacagcggct 780 gccccagcag agtgcgatga ggtgcaatcg ggtctgcgtg cagccgatga cccgccaccc 840 accgtgcgtg tcgctgtcac tgccgcgcgg ccgccgcgcg ccaagccggc cccgcgacgg 900 cgtgcggcgc aaccctccga cgcttcgccg gccgcgcagg tggatctacg cacgctcggc 960 tacagtcagc agcagcaaga gaagatcaaa ccgaaggtgc gttcgacagt ggcgcagcac 1020 cacgaggcac tggtgggcca tgggtttaca cacgcgcaca tcgttgcgct cagccaacac 1080 ccggcagcgt tagggaccgt tgctgtcacg tatcaggaca taatcagggc gttgccagag 1140 gcgacacacg aagacatcgt tggcgtcggc aaacagtggt ccggcgcacg cgccctggag 1200 gccttgctca cggaggcgag ggagttgaga ggtccgccgt tacagttgga cacaggccaa 1260 cttctcaaga ttgcaaaacg tggcggcgtg accgcagtgg aggcagtgca tgcatggcgc 1320 aatgcactga cgggtgcccc cctgaacctg accccggacc aagtggtggc catcgccagc 1380 aatattggcg gcaaccaggc gctggagacg gtacagcggc tgttgccggt actgtgccag 1440 gaccatggcc tgaccccgga ccaggtcgtg gccatcgcca gccatggcgg caagcaggcg 1500 ctggagacgg tgcagcggct gttgccggtg ctgtgccagg accatggcct gaccccggac 1560 caggtggtgg ccatcgccag caatattggc ggcaagcagg cgctggagac ggtgcagcgg 1620 ctgttgccgg tgctgtgcca ggcccatggc ctgaccccgg cccaggtggt ggccatcgcc 1680 agcaataacg gcggcaagca ggcgctggag acggtgcagc ggctgttgcc ggtgctgtgc 1740 caggcccatg gcctgacccc ggcccaggtg gtggctatcg ccagcaataa cggcggcaag 1800 caggcgctgg agacggtgca acggctgttg ccggtgctgt gccaggccca tggcctgacc 1860 ccggaccaag tggtggccat cgccaacaat aacggcggca agcaggcgct ggagacggtg 1920 cagcggctgt tgccggtgct gtgccaggac catggcctga gtccggacca ggtggtggcc 1980 atcgccaaca ataacggcgg caagcaggcg ctggagacgc tgcagcggct gttgccggtg 2040 ctgtgccaga cccatgccct gaccccggac caggtggtgg ccatcgccaa caataacggc 2100 ggcaagcagg cgctggagac ggtgcagcgg ctgttgccgg tgctgtgcca ggaccatggc 2160 ctgaccccgg accaggtggt ggccatcgcc agccacgatg gcggcaagca ggcgctggag 2220 acggtgcagc ggctgttgcc ggtgctgtgc caggaccatg gcctgacccc ggaccaggtg 2280 gtggccatcg ccagcaatat tggcggcaag caggcgctgg agacggtgca gcggctgttg 2340 ccggtgctgt gccaggacca tggcctgacc ccggaccagg tggtggccat cgccagcaat 2400 agtggcggca agcaggcgct ggagacggtg cagcggctgt tgccggtgct gtgccaggac 2460 catggcctga ccccggccca ggtggtggcc atcgccagcc atggcggcgg caagcaggcg 2520 ctggagacgg tgcagcggct gttgccggtg ctgtgccagg cccatggcct gaccccagac 2580 caggtcgtgg ccatcgccag ccacgatggc ggcaagcagg cgctggagac ggtgcagcgg 2640 ctgttgccgg tgctgtgcca ggcccatggc ctgaccccga accaggtggt ggccatcgcc 2700 agcaatattg gcggcaagca ggcgctggag acggtgcaac ggctgttgcc ggtgctgtgc 2760 caggaccatg gcctgacccc ggcccaggtg gtggccatcg ccagcaatgg cggcaagcag 2820 gcgctggaga cggtgcagcg gctgttgccg gtgctgtgcc aggctcatgg cctgaccccg 2880 gaccaagtgg tggccatcgc cagtaatagt ggcggcaagc aggcgctgga gacggtgcag 2940 cggctgttgc cggtgctgtg ccaggaccat ggcctgaccc cgaaccaagt ggtggccatc 3000 gccagcaata ttggcggcaa gcaggcgctg gagacggtgc agcggctgtt gccggtgcta 3060 tgccaggacc atggcctgac cccggaccag gtggtggcca tcgccagcaa tattggcggc 3120 aagcaggcgc tggagacggt gcagcggctg ttgccggtgc tgtgccagga ccatggcctg 3180 accctggacc aggtggtggc catcgccagc cacgatggcg gcaaacaggc gctggagacg 3240 gtgcaacggc tgttgccggt gctgtgccag gcccatggcc tgaccccgta ccaggtggtg 3300 gccatcgcca gcaatggcgg caagcaggcg ctggagacgg tgcagcggct gttgccggtg 3360 ctgtgccagg cccatggcct gaccccgaac caggtggtgg ccatcgccag caatagtggc 3420 ggcaagcagg cgctggagac ggtgcagcgg ctgttgccgg tgctgtgcca ggaccatggc 3480 ctgaccccga accaggtggt ggccatcgcc agcaatattg gcggcaagca ggcgctggag 3540 acggtgcagc ggctgttgcc ggtgctgtgc caggaccatg gcctgacccc gaaccaggtg 3600 gtggccatcg ccagcaatgg cggcaagcag gcgctggaga gcattgttgc ccagttatct 3660 cgccctgatc cggcgttggc cgcgttgacc aacgaccacc tcgtcgcctt ggcctgcctc 3720 ggcggacgtc ctgccctgga tgcagtgaaa aagggattgc cgcacgcgcc ggaattgatc 3780 agaagaatca atcgccgtat tcccgaacgc acgtcccatc gcgttcccga cctcgcgcac 3840 gtggttcgcg tgcttggttt tttccagagc cactcccacc cagcgcaagc attcgatgac 3900 gccatgacgc agttcgggat gagcaggcac ggcttggtac agctctttcg cagagtgggc 3960 gtcaccgaat tcgaagcccg ctacggaacg ctccccccag cctcgcagcg ttgggaccgt 4020 atcctccagg catcagggat gaaaagggcc aaaccgtccc ctacttcagc tcaaacaccg 4080 gatcaggcgt ctttgcatgc attcgccgat tcgctggagc gtgaccttga tgcgctcagc 4140 ccaatgcacg agggagatca gacgcgggca agcagccgta aacggtcccg atcggatcgt 4200 gctgtcaccg gcccctccgc acagcaatct ttcgaggtgc gcgttcccga acagcgcgat 4260 gcgctgcatt tgcccctcag ctggagggta aaacgcccgc gtaccaggat cgggggcggc 4320 ctcccggatc ctggtacgcc catcgctgcc gacctggcag cgtccagcac cgtgatgtgg 4380 gaacaagatg cggccccctt cgcaggggca gcggatgatt tcccggcatt caacgaagag 4440 gaactcgcat ggttgatgga gctattgcct cagtcaggct cagtcggagg gacgatctga 4500                                                                         4500 <210> 12 <211> 1499 <212> PRT <213> Artificial Sequence <220> <223> Xoo2279 amino acid <400> 12 Met Gly Arg Phe Trp Phe Ser Gly Thr Ser Ile Leu His Thr Arg Lys   1 5 10 15 Leu Arg His Arg Ala Leu Arg His Ala Val Leu Gly Ala Asp Leu Arg              20 25 30 His Arg Thr Gly Val Val Ala Asp Val Val Arg Arg Thr Gln Tyr Ala          35 40 45 Leu Gly Asp Pro Ala Asn Ala Tyr Cys His Gln Val Ser Gly Gly Ala      50 55 60 Phe Val Ser Arg Arg Asn Asp Leu Pro Ala Gly Arg Thr Arg Gly  65 70 75 80 Leu Ala Gly Ile Arg Ile Lys Lys Gln Pro Lys Val Gly Ser Leu Ala                  85 90 95 Val Ser Thr Glu Ile Phe His Asn Leu Leu Pro Ile Leu His Ala Gly             100 105 110 Pro Gly Ser Pro Ser Cys Leu Arg Leu Thr Leu Val Val Glu Gly Cys         115 120 125 Gln Asp His Pro Lys Leu Cys Thr Ala Met Arg Pro Arg Lys Leu Cys     130 135 140 Arg Asp His Arg Pro Leu Val Trp Arg Gln Pro Cys Lys Glu Val Cys 145 150 155 160 Leu Met Asp Pro Ile Arg Ser Ser Thr Ser Ser Ala Arg Glu Leu                 165 170 175 Leu Pro Gly Pro Gln Pro Asp Arg Val Gln Pro Thr Ala Asp Arg Gly             180 185 190 Gly Ala Pro Pro Ala Gly Gly Pro Leu Asp Gly Leu Pro Ala Arg Arg         195 200 205 Thr Met Ser Arg Thr Arg Leu Pro Ser Pro Pro Ala Pro Ser Pro Ala     210 215 220 Phe Ser Ala Gly Ser Phe Ser Asp Leu Leu Arg Gln Phe Asp Pro Ser 225 230 235 240 Leu Leu Asp Thr Ser Leu Leu Asp Ser Met Pro Ala Val Gly Thr Pro                 245 250 255 His Thr Ala Ala Pro Ala Glu Cys Asp Glu Val Gln Ser Gly Leu             260 265 270 Arg Ala Ala Asp Asp Pro Pro Thr Val Arg Ala Val Thr Ala         275 280 285 Ala Arg Pro Pro Arg Ala Lys Pro Ala Pro Arg Arg Arg Ala Ala Gln     290 295 300 Pro Ser Asp Ala Ser Pro Ala Ala Gln Val Asp Leu Arg Thr Leu Gly 305 310 315 320 Tyr Ser Gln Gln Gln Gln Glu Lys Ile Lys Pro Lys Val Arg Ser Thr                 325 330 335 Val Ala Gln His His Glu Ala Leu Val Gly His Gly Phe Thr His Ala             340 345 350 His Ile Val Ala Leu Ser Gln His Pro Ala Ala Leu Gly Thr Val Ala         355 360 365 Val Thr Tyr Gln Asp Ile Ile Arg Ala Leu Pro Glu Ala Thr His Glu     370 375 380 Asp Ile Val Gly Val Gly Lys Gln Trp Ser Gly Ala Arg Ala Leu Glu 385 390 395 400 Ala Leu Leu Thr Glu Ala Arg Glu Leu Arg Gly Pro Pro Leu Gln Leu                 405 410 415 Asp Thr Gly Gln Leu Leu Lys Ile Ala Lys Arg Gly Gly Val Thr Ala             420 425 430 Val Glu Ala Val Ala Trp Arg Asn Ala Leu Thr Gly Ala Pro Leu         435 440 445 Asn Leu Thr Pro Asp Gly Val Val Ala Ile Ala Ser Asn Ile Gly Gly     450 455 460 Asn Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln 465 470 475 480 Asp His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser His Gly                 485 490 495 Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys             500 505 510 Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn         515 520 525 Ile Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val     530 535 540 Leu Cys Gln Ala His Gly Leu Thr Pro Ala Gln Val Val Ala Ile Ala 545 550 555 560 Ser Asn Asn Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu                 565 570 575 Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Ala Gln Val Val Ala             580 585 590 Ile Ala Ser Asn Asn Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg         595 600 605 Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Asp Gln Val     610 615 620 Val Ala Ile Ala Asn Asn Asn Gly Gly Lys Gln Ala Leu Glu Thr Val 625 630 635 640 Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Ser Pro Asp                 645 650 655 Gln Val Val Ala Ile Ala Asn Asn Asn Gly Gly Lys Gln Ala Leu Glu             660 665 670 Thr Leu Gln Arg Leu Leu Pro Val Leu Cys Gln Thr His Ala Leu Thr         675 680 685 Pro Asp Gln Val Val Ala Ile Ala Asn Asn Asn Gly Gly Lys Gln Ala     690 695 700 Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly 705 710 715 720 Leu Thr Pro Asp Gly Val Val Ala Ile Ala Ser His Asp Gly Gly Lys                 725 730 735 Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp             740 745 750 His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn Ile Gly         755 760 765 Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys     770 775 780 Gln Asp His Gly Leu Thr Pro Asp Gln Val Val Ala Ile Ala Ser Asn 785 790 795 800 Ser Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val                 805 810 815 Leu Cys Gln Asp His Gly Leu Thr Pro Ala Gln Val Val Ala Ile Ala             820 825 830 Ser His Gly Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu         835 840 845 Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Asp Gln Val Val Ala     850 855 860 Ile Ala Ser His Asp Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg 865 870 875 880 Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro Asn Gln Val                 885 890 895 Val Ala Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu Thr Val             900 905 910 Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Ala         915 920 925 Gln Val Val Ala Ile Ala Ser Asn Gly Gly Lys Gln Ala Leu Glu Thr     930 935 940 Val Gln Arg Leu Leu Pro Val Leu Cys Gln Ala His Gly Leu Thr Pro 945 950 955 960 Asp Gln Val Val Ala Ile Ala Ser Asn Ser Gly Gly Lys Gln Ala Leu                 965 970 975 Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu             980 985 990 Thr Pro Asn Gln Val Val Ala Ile Ala Ser Asn Ile Gly Gly Lys Gln         995 1000 1005 Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln Asp His    1010 1015 1020 Gly Leu Thr Pro Asp Gly Val Val Ala Ile Ala Ser Asn Ile Gly Gly 1025 1030 1035 1040 Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu Cys Gln                1045 1050 1055 Asp His Gly Leu Thr Leu Asp Gln Val Val Ala Ile Ala Ser His Asp            1060 1065 1070 Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val Leu        1075 1080 1085 Cys Gln Ala His Gly Leu Thr Pro Tyr Gln Val Val Ala Ile Ala Ser    1090 1095 1100 Asn Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu Pro Val 1105 1110 1115 1120 Leu Cys Gln Ala His Gly Leu Thr Pro Asn Gln Val Val Ala Ile Ala                1125 1130 1135 Ser Asn Ser Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg Leu Leu            1140 1145 1150 Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Asn Gln Val Val Ala        1155 1160 1165 Ile Ala Ser Asn Ile Gly Gly Lys Gln Ala Leu Glu Thr Val Gln Arg    1170 1175 1180 Leu Leu Pro Val Leu Cys Gln Asp His Gly Leu Thr Pro Asn Gln Val 1185 1190 1195 1200 Val Ala Ile Ala Ser Asn Gly Gly Lys Gln Ala Leu Glu Ser Ile Val                1205 1210 1215 Ala Gln Leu Ser Arg Pro Asp Pro Ala Leu Ala Ala Leu Thr Asn Asp            1220 1225 1230 His Leu Val Ala Leu Ala Cys Leu Gly Gly Arg Pro Ala Leu Asp Ala        1235 1240 1245 Val Lys Lys Gly Leu Pro His Ala Pro Glu Leu Ile Arg Arg Ile Asn    1250 1255 1260 Arg Arg Ile Pro Glu Arg Thr Ser His Arg Val Pro Asp Leu Ala His 1265 1270 1275 1280 Val Val Arg Val Leu Gly Phe Phe Gln Ser His Ser His Ala Gln                1285 1290 1295 Ala Phe Asp Asp Ala Met Thr Gln Phe Gly Met Ser Arg His Gly Leu            1300 1305 1310 Val Gln Leu Phe Arg Arg Val Gly Val Thr Glu Phe Glu Ala Arg Tyr        1315 1320 1325 Gly Thr Leu Pro Pro Ala Ser Gln Arg Trp Asp Arg Ile Leu Gln Ala    1330 1335 1340 Ser Gly Met Lys Arg Ala Lys Pro Ser Pro Thr Ser Ala Gln Thr Pro 1345 1350 1355 1360 Asp Gln Ala Ser Leu His Ala Phe Ala Asp Ser Leu Glu Arg Asp Leu                1365 1370 1375 Asp Ala Leu Ser Pro Met His Glu Gly Asp Gln Thr Arg Ala Ser Ser            1380 1385 1390 Arg Lys Arg Ser Ser Ser Asp Arg Ala Val Thr Gly Pro Ser Ala Gln        1395 1400 1405 Gln Ser Phe Glu Val Arg Val Pro Glu Gln Arg Asp Ala Leu His Leu    1410 1415 1420 Pro Leu Ser Trp Arg Val Lys Arg Pro Arg Thr Arg Ile Gly Gly Gly 1425 1430 1435 1440 Leu Pro Asp Pro Gly Thr Pro Ile Ala Ala Asp Leu Ala Ala Ser Ser                1445 1450 1455 Thr Val Met Trp Glu Gln Asp Ala Ala Pro Phe Ala Gly Ala Ala Asp            1460 1465 1470 Asp Phe Pro Ala Phe Asn Glu Glu Glu Leu Ala Trp Leu Met Glu Leu        1475 1480 1485 Leu Pro Gln Ser Gly Ser Val Gly Gly Thr Ile    1490 1495 <210> 13 <211> 989 <212> DNA <213> Artificial Sequence <220> <223> OsbZIP73 <400> 13 gaagcacacc actaattctt tttggaactg ctcaagtaag atgaaaattg ttctgtctta 60 acctgctttc atattaattg ttaaagttgt catcatccaa attgttatag caacacgcca 120 tgcctttata tttcaaaata gaaaggcagg ggatacacac attaatctat ctcttaggtg 180 ccatacctct atgctagaga tgaaaagctg attactgacc acttgtgaac aaacccttag 240 gtgtcttgct tccacagtgc gtgctgccat atgtaatcta aattgtcatg cccaatctga 300 tctacttcat tctctagtgg cctaacaatc tctgttcgtt tattcccaca gtggctacca 360 gtaggtaaag ctgtgtgttt atccagagat ttcatgccac tctaaccagg tacaagattt 420 taataagtaa actagcttga gtgatgagaa aagccaaaaa caaaggccga gcatctttga 480 ggggagaatg cattacaagg taaaaagcaa ggtttggcat ggatgaactg gaataaattt 540 accttagaca agactactcg cgcaagtcaa gtcatggatg caaacgaagg gaaaagaaaa 600 tgacaaatgt tctctaaaaa aataaaagca aagataggga ggtagtagaa gattaatgag 660 ccacaactat tgtaggcata tattgtttgg atattgttgg cgaaaagctc accgtcatgg 720 ccatgtacca aatcgacaaa attaaagcta ccaaattcta caaaaacaag gaggggtgga 780 gagggagaga aagaaggtgg tctctctcta gtctctagcc ataggcaatc aaaagcacct 840 tttctcaccc tataaaaggc cctcaccaac ccatcgcctc ctccgctcag agagagcaaa 900 ttcttcagta agcagaatca aagcagatta accctcatct acttctggcc ctctaagagt 960 tctccactaa gcaagcgaaa acagccatg 989 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Xoo2279 EBE <400> 14 tataaaaggc cctcaccaac ccat 24

Claims (12)

delete delete delete delete delete delete And a OsbZIP73 promoter fragment in which the 10th to 15th bases in the nucleotide sequence of SEQ ID NO: 14 are substituted with 'ATCCGTG' from 'CCCTCA', to increase resistance to rice blossom blight resistance.
delete 8. The recombinant vector of claim 7, wherein the mutation is not mutated within the nucleotide sequence of SEQ ID NO: 14 in the TATA box (TATAAA).
The method of claim 7, wherein the rice huinip blight resistance that by the base substitution rice huinip blight bacterium (Xanthomonas oryzae pv. Oryzae, Xoo) of TAL effector Xoo2279 (Transcription activator-like effector Xoo2279 ) that inhibit binding of the protein Promoting recombinant vector.
A method for producing a transgenic plant having enhanced resistance to blight of blight of blight, comprising the step of transforming the recombinant vector of any one of claims 7, 9 and 10 into a plant using Agrobacterium.
11. A transgenic plant produced by the method according to claim 11 which has enhanced blight resistance to rice blast.

Images