CN110016501A

CN110016501A - Marker, detection method and its application of unexplained fever

Info

Publication number: CN110016501A
Application number: CN201810019985.0A
Authority: CN
Inventors: 张辰宇; 王成; 张春妮
Original assignee: Jiangsu Micromedmark Biotech Co Ltd
Current assignee: Jiangsu Micromedmark Biotech Co Ltd
Priority date: 2018-01-09
Filing date: 2018-01-09
Publication date: 2019-07-16

Abstract

The present invention provides a kind of marker of unexplained fever, detection method and its applications.Specifically, the present invention provides a kind of FUO specific marker object and its purposes of detection reagent, it is used to prepare diagnostic reagent or diagnostic kit, the diagnostic reagent or kit are used for (i) and judge whether test object suffers from unexplained fever, and/or (ii) judges that the risk (neurological susceptibility) of unexplained fever occurs for test object.The present invention also provides the reagent of detection unexplained fever and kit and the methods of acatalepsia reason fever.

Description

Marker, detection method and its application of unexplained fever

Technical field

The present invention relates to biomedicine field, relate more specifically to the marker of unexplained fever, detection method and its Using.

Background technique

Unexplained fever (fever of unknown origin, FUO), refers to that heating continuing time is more than 3 weeks, body Temperature cannot still clarify a diagnosis repeatedly at 38.3 DEG C or more through detailed medical history-taking, physical examination and Routine Test Lab inspection.It is Clinically more common symptom or sufferer, all age group can occur, and be common with afternoon or breaking-out at dusk.Unknown cause The diagnosis key of fever is finding out the cause of disease, fever is clinically divided into 4 classes from diagnostics angle: i.e. infectious diseases, pernicious disease Disease, connective tissue disease and inflammatory vascular diseases and other can cause the disease of fever.It is wherein most commonly seen with infectious diseases, It can account for the 60-70% or so of all unexplained fever.In addition tumour and autoimmunity disease respectively account for 10-15% or so；It dislikes Property tumour is difficult to diagnose sometimes, and such as chronic leukemia, lymthoma, clear-cell carcinoma, metastatic carcinoma, they can cause unknown cause to be sent out Heat.Some patient finally is also difficult to clarify a diagnosis to account for 10-20%.Autoimmunity disease medium vessels inflammation is the most common；Tumour In lymthoma is common before 65 years old, gastroenteric tumor is common after 65 years old.

Human cytomegalovirus (human cytomegalovirus, HCMV) belongs to herpetoviridae cytomegalovirus category, is Maximum a kind of virus in nerpes vinrus hominis's group, genome length 256kb, 165 genes of codified.HCMV basic structure Main includes (being wrapped in icosahedron nucleocapsid as inhereditary material double-stranded linear DNA core, being cladded with multiple protein matrix structure At inner membrance) and as protective lipid phospholipid bilayer outer membrane (covering a variety of glycoprotein on film), mature HCMV disease Malicious particle diameter is up to 200-300nm.HCMV can cause HCMV infections.Under normal conditions, many normal person On it is all latent have a cytomegalovirus, latency site is often in salivary gland, mammary gland, kidney, cervix, testis, leucocyte and other In body of gland, virus can be long-term or be intermittently discharged from saliva, milk, urine, sperm and cervical discharge.

In human body, it includes monocyte, macrophage, T lymphocyte that HCMV, which can infect a variety of different type cells, Deng, and lead to a variety of various diseases.Epidemiological survey shows, 50%~90% crowd has an infection of HCMV, and with The age increase, HCMV infection rate also constantly rises.Under normal circumstances, any symptom is had no after human infection HCMV, still When human immune system is suppressed/disorder when, HCMV by abnormal activation and can cause a variety of diseases to occur.Having immunity energy In the Grown living of power, HCMV abnormal activation can caused by disease include mononucleosis syndrome, arthralgia and arthritis, Ulcerative colitis, pneumonia, hepatitis, aseptic meningitis and myocarditis etc.；HCMV infection can be led in embryonic period, embryonic phase and newborn Cause neonatal death, deafness, jaundice, hepatosplenomegaly, purpura, neurodevelopment abnormal etc.；(such as immune deficiency/suppressed individual HIV patient, Organ Transplantation Patients, candidate stem cell inhibit patient), HCMV infection and activation can lead to the retinitis, Digestive Inflammation, organ transplant unite unsuccessfully etc..

Due to it is immune by or immunocompromised crowd, fetus, in newborn, the infection of HCMV can lead to a variety of diseases, Therefore the HCMV infection activation situation detection and monitoring of this kind of crowd is very necessary for the determination of suitable clinical treatment 's.Therefore, finding is that the field urgently solves to the detection of unexplained fever, particularly HCMV infection disease and biomarker One of certainly the problem of.

Summary of the invention

The purpose of the present invention is to provide a kind of detection markers of unexplained fever especially HCMV infection disease.

It is a further object to provide a kind of for detecting unexplained fever especially HCMV infection disease The probe of marker.

A further object of the present invention is to provide the use of above-mentioned unexplained fever especially HCMV infection disease markers On the way, corresponding kit and biochip are prepared including.

It is a further object to provide the labels for detecting above-mentioned unexplained fever especially HCMV infection disease The method of object.

In the first aspect of the present invention, the purposes of a kind of FUO specific marker object and its detection reagent is provided, for making Standby diagnostic reagent or diagnostic kit, the diagnostic reagent or kit judge whether test object suffers from unknown original for (i) Because fever, and/or (ii) judge that the risk (neurological susceptibility) of unexplained fever occurs for test object, wherein the FUO is special Property marker is selected from the group A:

miR-US4-3p、miR-US29-3p、miR-UL70-5p、miR-US5-2-3p、miR-UL122-3p、miR-US4- 5p, miR-US25-2-3p, miR-US33-3p, miR-UL1148d, or combinations thereof.

In another preferred example, the FUO specific marker object include group A in any two kinds, three kinds, or more MiRNA (such as 4,5,6 kind or whole miRNA).

In another preferred example, the judgement includes judgement before auxiliary judgment and/or treatment.

In another preferred example, the judgement is the FUO specific marker object content of the sample of self-test in future object Compared with A1 FUO specific marker object content A0 corresponding with normal population, if A1 is significantly higher than A0, illustrate that test object is suffered from There is unexplained fever or the risk height of unexplained fever occurs.

In another preferred example, described " being significantly higher than " refers to A1/A0 >=2, preferably A1/A0 >=2.5, more preferably A1/A0 ≥3.0。

In another preferred example, the FUO specific marker object is miR-US4-3p and miR-UL70-5p, preferably, A1/A0≥4.5。

In another preferred example, the FUO specific marker object is miR-US29-3p, miR-UL122-3p and miR- US33-3p, preferably, A1/A0 >=2.5.

In another preferred example, the FUO specific marker object is miR-US5-2-3p, miR-US4-5p and miR- US25-2-3p, preferably, A1/A0 >=3.5.

In another preferred example, the FUO specific marker object is miR-UL1148d, preferably, A1/A0 >=2.

In another preferred example, the quantity of the normal population is at least 100 people；Preferably at least 300 people；More preferably At least 500 people, most preferably at least 1000 people.

In another preferred example, the diagnostic reagent or diagnostic kit for detect blood sample, plasma sample or Serum sample, preferably peripheral blood sample.

In another preferred example, the FUO refer to unexplained fever (fever of unknown origin, FUO)。

In another preferred example, the unexplained fever include infectious diseases, malignant disease, connective tissue disease, Caused by disease caused by inflammatory vascular diseases and non-infectious non-malignant non-connective tissue disease non-inflammation vascular diseases not Bright reason fever.

In another preferred example, the unexplained fever is fever caused by inflammatory vascular diseases.

In another preferred example, test object behaviour or non-human mammal.

In another preferred example, the test object is to have infected the people of human cytomegalovirus.

In another preferred example, the detection reagent includes nucleic acid chip or probe.

In another preferred example, the probe conjugate has or with detectable label.

In another preferred example, the detectable label is selected from the group: chromophore, chemiluminescent groups, fluorogen, same to position Element or enzyme.

In another preferred example, the FUO specific marker object is used as standard items.

In the second aspect of the present invention, a kind of marker combination for detecting unexplained fever, the label are provided Object combination includes two or more miRNA:miR-US4-3p, miR-US29-3p, miR-UL70-5p, miR- selected from the group below US5-2-3p, miR-UL122-3p, miR-US4-5p, miR-US25-2-3p, miR-US33-3p, miR-UL1148d or its group It closes.

In another preferred example, the miRNA be HCMV miRNA, preferably, the miRNA human serum/ It is stabilized in blood plasma.

In the third aspect of the present invention, a kind of diagnostic kit is provided, the kit contains:

(a) detection reagent of the combination of marker described in second aspect of the present invention is detected；With

(b) specification, the specification indicate the kit and judge whether test object suffers from unknown cause for (i) Fever, and/or (ii) judge that the risk (neurological susceptibility) of unexplained fever occurs for test object.

In another preferred example, the kit also includes that the combination of marker described in second aspect of the present invention is used as mark Quasi- product.

In another preferred example, the detection reagent includes nucleic acid chip or probe combinations.

In another preferred example, the kit further includes detecting matched sample pre-treatments reagent and operation instruction Book.

In another preferred example, the method that the specification describes detection method and judged according to A1 value.

In another preferred example, the kit further includes that FUO specific marker object is used as standard items.

In the fourth aspect of the present invention, a kind of probe combinations are provided, the probe combinations include two kinds or more of detection The probe of kind miRNA selected from the group below: miR-US4-3p, miR-US29-3p, miR-UL70-5p, miR-US5-2-3p, miR- UL122-3p, miR-US4-5p, miR-US25-2-3p, miR-US33-3p, miR-UL1148d, or combinations thereof.

In another preferred example, the probe is fluorescence probe.

In the fifth aspect of the invention, a kind of nucleic acid chip is provided, the nucleic acid chip includes present invention four directions Probe combinations described in face.

In the sixth aspect of the present invention, provides a kind of (i) and judge whether test object suffers from unexplained fever, and/ Or (ii) judges that the method for the risk (neurological susceptibility) of unexplained fever occurs for test object, comprising steps of

(a) sample of test object is provided；

(b) content for measuring FUO specific marker object in the sample is A1；With

(c) step (b) is compared with the FUO specific marker object content A0 of normal population sample, if A1 is significantly higher than A0 then illustrates that risk of the test object with unexplained fever or generation unexplained fever is high.

In another preferred example, test object behaviour or non-human mammal.

In another preferred example, the test sample is blood sample, plasma sample and/or serum sample.

In another preferred example, the method is non-diagnostic and non-therapeutic.

In another preferred example, in step (b), containing for FUO specific marker object is detected using the method for being selected in the following group Amount: inverse transcription polymerase chain reaction method, Fluorescent quantitative PCR method, flow cytomery side Method, biochip method, or combinations thereof.

In another preferred example, the detection method is RT-PCR method, preferably, the following steps are included:

1) the serum/plasma total serum IgE for extracting subject, obtains cDNA sample by RNA reverse transcription reaction；Or collect by The serum/plasma sample of examination person carries out reverse transcription reaction using serum/plasma as buffer to prepare cDNA sample；

2) PCR reaction is carried out with miRNA design primer；

3) agarose gel electrophoresis of PCR product is carried out；With

4) result is observed in the UV lamp after EB dyeing.

In another preferred example, the detection method is Real-time PCR method, preferably, the following steps are included:

2) miRNA design primer is used；

3) fluorescence probe is added and carries out PCR reaction；With

4) it detects and compares variation of the serum/plasma sample relative to the amount of miRNA in normal serum/blood plasma.

In the seventh aspect of the present invention, a kind of purposes of FUO specific marker object adjusting control agent is provided, it is unknown for treating Reason fever, wherein the FUO specific marker object be miRNA:miR-US4-3p, miR-US29-3p selected from the group below, miR-UL70-5p、miR-US5-2-3p、miR-UL122-3p、miR-US4-5p、miR-US25-2-3p、miR-US33-3p、 MiR-UL1148d, or combinations thereof.

In another preferred example, the adjusting control agent includes inhibitor and promotor.

In another preferred example, the miRNA promotes immune response, and adjusting control agent is promotor.

In another preferred example, the miRNA inhibits immune response, and adjusting control agent is inhibitor.

It should be understood that above-mentioned each technical characteristic of the invention and having in below (eg embodiment) within the scope of the present invention It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, exist This no longer tires out one by one states.

Detailed description of the invention

Fig. 1 shows normal control, vasculitis patient, HCMV miRNA's is exhausted in pyrexiaof unknown etiology person's serum/plasma To concentration.Wherein, normal control 10；Vasculitis (Vasculitis) patient 4；FUO represents unexplained fever patient, altogether 10.Wherein, each figure respectively illustrates normal control, vasculitis patient, hcmv- in pyrexiaof unknown etiology person's serum/plasma miR-UL36-3p、hcmv-miR-UL36-5p、hcmv-miR-UL112-5p、hcmv-miR-UL59、hcmv-miR-US4-3p、 The absolute concentration of hcmv-miR-US4-5p, hcmv-miR-US22-3p, hcmv-miR-US29-3p, hcmv-miR-US33-5P.

Fig. 2 shows unexplained fever patients blood plasma's HCMV miRNA expression of results.What ordinate indicated is recurring number Difference, general recurring number poor 1 indicates 2 times of variation.Wherein, Fig. 2A shows unexplained fever patients blood plasma hcmv-miR- The Ct value of UL1148D.Fig. 2 B shows the Ct value of unexplained fever patients blood plasma hcmv-miR-UL70-5p.Fig. 2 C is shown The Ct value of unexplained fever patients blood plasma hcmv-miR-UL22-5p.Fig. 2 D shows unexplained fever patients blood plasma The Ct value of hcmv-miR-UL36-3p.Fig. 2 E shows the Ct value of unexplained fever patients blood plasma hcmv-miR-US33-5p. Fig. 2 F shows the Ct value of unexplained fever patients blood plasma hcmv-miR-US4-5p.Fig. 2 G shows that unexplained fever is suffered from The Ct value of person's blood plasma hcmv-miR-UL122-3p.Fig. 2 H shows the Ct of unexplained fever patients blood plasma hcmv-miR-US5 Value.Fig. 2 I shows the Ct value of unexplained fever patients blood plasma hcmv-miR-UL122-5p.Fig. 2 J shows that unknown cause is sent out The Ct value of hot patients blood plasma hcmv-miR-US25-5p.

Fig. 3 shows the bioinformatics result of the potential source of people target gene of HCMV miRNA.Wherein, Fig. 3 A is shown The comparison result of hcmv-miR-UL36-3p and target gene BVES.Fig. 3 B shows hcmv-miR-UL59's and target gene BVES Comparison result.Fig. 3 C shows the comparison result of hcmv-miR-UL36-3p Yu target gene VAPA.Fig. 3 D shows hcmv-miR- The comparison result of US33-5p and target gene VAPA.Fig. 3 E shows the comparison knot of hcmv-miR-UL69 Yu target gene CEACM1 Fruit.Fig. 3 F shows the comparison result of hcmv-miR-UL59 Yu target gene CEACM1.

Fig. 4 shows age and the sick time statistical result of 109 unexplained fever patients.

Fig. 5 shows the expression of unexplained fever person, Normal group blood plasma HCMV miRNA relative to MIR2911 Amount.Normal group 38, unexplained fever person 43.

Fig. 6 shows the expression of unexplained fever person, Normal group blood plasma HCMV miRNA relative to MIR2911 Amount.Normal group 68, unexplained fever person 66.

Fig. 7 shows that FUO patient's difference HCMV miRNA positive number corresponds to the content of peripheral white blood cells.

Fig. 8 shows that FUO patient's difference HCMV miRNA positive number corresponds to the content of peripheral blood lymphocytes.

Fig. 9 shows that FUO patient's difference HCMV miRNA positive number corresponds to the content of peripheral blood c reactive protein.

Specific embodiment

The present inventor has found HCMV miRNA in unexplained fever patients serum by depth studying extensively for the first time Expression be significantly higher than normal control, participate in inflammatory reaction and adjust, escape host immune monitoring, maintain itself latent and duplication, Show that HCMV miRNA has the function of important physiological and pathological in serum, the diagnosis of HCMV infection disease, the state of an illness are monitored And study of incident mechanism is of great significance.

To find the unexplained fever especially detection marker of HCMV infection disease and accurately being detected to it, this Inventor studies the specific variations of HCMV miRNA in unexplained fever patients serum/blood plasma, proposes with serum/plasma Detection marker of the HCMV miRNA as unexplained fever establishes a kind of vitro detection serum/plasma HCMV miRNA's Method is diagnosed by detecting the specific variations of specific HCMV miRNA, and disease identification and course of disease monitoring are recurred and pre- Afterwards, the prediction that complication occurs.

Unexplained fever

The Medicine standard of unexplained fever (fever Unknown origin, FUO) are as follows: 1) heating continuing time >=3 Week；2) body temperature it is multiple > 38.3 DEG C；3) the complete medical history inquiry in warp >=1 week, physical examination and Routine Test Lab still cannot after checking It makes a definite diagnosis.

The diagnosis key of unexplained fever is finding out the cause of disease, and fever is clinically divided into 4 classes from diagnostics angle: being felt Infectious diseases, malignant disease, connective tissue disease and inflammatory vascular diseases and other can cause fever disease.Wherein with infection Property disease is most commonly seen, can account for the 60-70% or so of all unexplained fever；In relevant infectious diseases, tuberculosis (the especially outer tuberculosis of lung), peritoneal abscess and pelvic abscess are most commonly seen.Intraabdominal abscesses see the hollow organ after perforation (such as door screen Tail is scorching), diverticulitis, malignant tumour and wound, also see subacute bacterial endocarditis, sinusitis, osteomyelitis and abscess of mouth. In addition tumour and autoimmunity disease respectively account for 10-15% or so；Malignant tumour is difficult to diagnose sometimes, as chronic leukemia, lymthoma, Clear-cell carcinoma, metastatic carcinoma, they can cause unexplained fever.Some patient finally is also difficult to clarify a diagnosis to account for 10-20%.Autoimmunity disease medium vessels inflammation is the most common；Lymthoma is common before 65 years old in tumour, gastroenteric tumor after 65 years old It is common.More than 65 years old, old unexplained fever patient often suffered from multisystem inflammation, such as temporal arteritis or rheumatic, multiple flesh Disease.The complication of cirrhosis and hepatitis (Alcoholic, granulomatous and lupoides) may also cause unexplained fever.

Human cytomegalovirus

Known human cytomegalovirus (human cytomegalovirus, HCMV) can cause human cytomegalovirus to feel Dye；In human body, HCMV can infect a variety of different type cells, including monocyte, macrophage, T lymphocyte etc., and Lead to a variety of diseases.HCMV energy coding miRNA, HCMV miRNA play a significant role in host's pathological processes, participate in Inflammatory reaction adjusts, escapes host immune monitoring, maintains itself to hide and replicate etc..In the present embodiment, HCMV is ground Study carefully, show after HCMV infection, responding control can occur for miRNA level in serum/plasma.And utilize these responses miRNA Can auxiliary diagnosis infector, have higher diagnostic value.

HCMV miRNA

As used herein, term " HCMV miRNA ", " HCMV carrys out miRNAs ", " HCMV response miRNA " refer to that the mankind are huge The miRNA of cell virus coding, these miRNA act on messenger mrna during HCMV infection terminates its protein translation very To degradation.HCMV coding miRNA participates in inflammatory reaction and adjusts, escape host immune monitoring, maintain itself latent and duplication.

HCMV miRNA in serum/plasma include: hcmv-miR-UL22A-5p (HCMV miRNA ID: MIMAT0001574), hcmv-miR-UL22A-3p (HCMV miRNA ID:MIMAT0001575), hcmv-miR-UL36-5p (HCMV miRNA ID:MIMAT0001576), hcmv-miR-UL36-3p (HCMV miRNA ID:MIMAT0004754), Hcmv-miR-UL112-5p (HCMV miRNA ID:MIMAT0026552), hcmv-miR-UL112-3p (HCMV miRNA ID:MIMAT0001577), hcmv-miR-UL148D (HCMV miRNA ID:MIMAT0001578), hcmv-miR-US33-5p (HCMV miRNA ID:MIMAT0001584), hcmv-miR-US33-3p (HCMV miRNA ID:MIMAT0004756), Hcmv-miR-US5-1 (HCMV miRNA ID:MIMAT0001579), hcmv-miR-US25-1-5p (HCMV miRNA ID: MIMAT0001581), hcmv-miR-US25-1-3p (HCMV miRNA ID:MIMAT0004755), hcmv-miR-US25-2- 5p (HCMV miRNA ID:MIMAT0001582), hcmv-miR-US5-2-3p (HCMV miRNA ID:MIMAT0001580), Hcmv-miR-US5-2-5p (HCMV miRNA ID:MIMAT0026553), hcmv-miR-US25-2-3p (HCMV miRNA ID:MIMAT0001583), hcmv-miR-US4-3p (HCMV miRNA ID:MIMAT0026628), hcmv-miR-US4-5p (HCMV miRNA ID:MIMAT0003341), hcmv-miR-US29-5p (HCMV miRNA ID:MIMAT0028167), Hcmv-miR-US29-3p (HCMV miRNA ID:MIMAT0028168), hcmv-miR-US22-3p (HCMV miRNA ID: MIMAT0028166), hcmv-miR-US22-5p (HCMV miRNA ID:MIMAT0028165), hcmv-miR-UL70-5p (HCMV miRNA ID:MIMAT0003342), hcmv-miR-UL70-3p (HCMV miRNA ID:MIMAT0003343), Hcmv-miR-UL59 (HCMV miRNA ID:MIMAT0029122), hcmv-miR-UL69 (HCMV miRNA ID: MIMAT0029123)。

It in a preferred example, include: miR-US4-3p, miR- as the HCMV miRNA of unexplained fever marker US29-3p、miR-UL70-5p、miR-US5-2-3p、miR-UL122-3p、miR-US4-5p、miR-US25-2-3p、miR- One of US33-3p, miR-UL1148d or a variety of.

Detection reagent

Detection reagent of the invention includes probe combinations, nucleic acid chip.

Probe refers to gene probe, i.e. nucleic acid probe, is one section with detection label, and known to sequence, with purpose base Because of complementary nucleic acid sequence (DNA or RNA).Gene probe is hybridized in conjunction with target gene by molecule, generates hybridization signal, energy Target gene is shown from the genome of great writing brush.

Nucleic acid chip also known as DNA chip, genetic chip (gene chip) or gene microarray (microarray), refer to Fabricated in situ oligonucleotides or directly a large amount of DNA probe is solidified in an orderly manner in a manner of micro- printing on solid support In support surface, then the heredity of sample can be obtained by the detection and analysis to hybridization signal with the sample hybridization of label Information.In other words, genetic chip is by micro-processing technology, by the DNA fragmentation of ten hundreds of or even million meters particular sequences (gene probe) regularly 2cm is fixed in arrangement²The supports such as silicon wafer, slide on, constitute a two-dimensional DNA probe battle array Column, it is quite similar with the electronic chip on electronic computer so referred to as genetic chip.

Preferably, the probe of two or more miRNA selected from the group below of probe combinations of the invention or genechip detection: miR-US4-3p、miR-US29-3p、miR-UL70-5p、miR-US5-2-3p、miR-UL122-3p、miR-US4-5p、miR- US25-2-3p, miR-US33-3p, miR-UL1148d, or combinations thereof.

Main advantages of the present invention include:

(a) marker that special HCMV miRNA provided by the invention generates heat as acatalepsia reason has detection The advantages that pedigree is wide, high sensitivity, testing cost is low, materials are convenient, sample is easy to store, this method can be widely used for general investigation of desease Equal related works, become the effective means of early diagnosis disease.

(b) marker for improving single is difficult to by the HCMV miRNA in serum/plasma as new disease markers Low specificity brought by the individual difference overcome and muting sensitivity significantly improve the clinical recall rate of disease and realize disease Early stage diagnosis and treatment.

(c) the kit investment practice for detecting serum/plasma HCMV miRNA based on this preparation uses, Jin Jinxu The probe library of the serum or blood plasma of patient without any other tissue by most simplifying is wanted to detect serum/plasma HCMV MiRNA level can expand the diagnostic method of unexplained fever, have epochmaking clinical application potentiality and value.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part, such as Sambrook et al., molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the normal condition proposed by manufacturer.Unless otherwise stated, no Then percentage and number are weight percent and parts by weight.

Universal method

For the embodiment of the present invention, universal method is as follows:

1. serum/plasma sample requires and processing method

The requirement of 1.1 samples

(1) sample type: serum.

Serum is preferably limosis vein blood separation.It must be separated in blood sampling half an hour, collect serum, and extremely by serum transfers In the sterile eppendorf tubes of disposable no RNA enzyme.

(2) serum sample, which sets room temperature, can stablize preservation 24 hours, and 2 DEG C -8 DEG C can stablize preservation 7 days, -20 DEG C of long-term preservations.

(3) RNA solution that serum sample extracts, the water that RNA is dissolved in RNAase-free are placed in -80 DEG C of preservations

1.2 processing methods:

(1) whole blood sample is processed into serum: acquires venous blood 2ml, it is not anticoagulant in 5ml cleaning centrifuge tube.Stand 30 After minute, 5000rpm is centrifuged 5 minutes, takes its supernatant.If sample does not use immediately, -18 DEG C or less are needed to save.This kit Required serum sample volume is 300 μ l.

(2) RNA of serum sample is extracted

With the RNA of phenol chloroform method extracting serum sample.

Plasma sample is extracted, is saved, processing method is identical as serum operation.

2.Real-time PCR method

TaqMan method, fluorescent dye determination can be used in Real-time PCR method.

Specific steps are as follows:

2.1 collect serum/plasma sample, prepare cDNA sample

(1) it takes 100ul sample to be added in 300ul water, 200ul (ph=4.7-5.5) acidic phenol is added after mixing well, 200ul chloroform is added after acutely concussion mixes, rear 16000g room temperature fullys shake again and is centrifuged 15 minutes.

(2) careful Aspirate supernatant (about 400ul) is added in 800ul isopropanol, adds pH=5.2,3M sodium acetate 40ul, after mixing well after -20 DEG C of standing 1h, 16000g, 4 degree are centrifuged 20 minutes.

(3) after sufficiently abandoning supernatant, 75% ethyl alcohol 1ml is added, for several times, 16000g, 4 degree are centrifuged 20 minutes gentle inversion.

(4) supernatant is sufficiently abandoned, after drying at room temperature, 20ul DEPC water dissolution precipitating is added, -80 degree save.

The reaction system of reverse transcription includes

The 10 μ L of reaction system of RT-PCR includes: 25 × buffer of μ L AMV, 0.5 μ L AMV, 1 μ L dNTPs Mixture (10mmol), 1 μ L RT-PRIMER, 2 μ L RNA, 3.5 μ L DEPC water.

Response procedures:

Step 1:16℃30min

Step 2:42℃30min

Step 3:85℃5min

Step 4:4℃forever。

2.2 design miRNA primers

2.3PCR reaction

TaqMan probe method, comprising the following steps:

(1) serum/plasma sample is collected；

(2) serum/plasma total serum IgE is extracted by phenol chloroform method；

(3) TaqMan microRNA probe, AMV reverse transcriptase, stem ring RT primer are utilized, total serum IgE reverse transcription is at cDNA.

(4) it is quantified using TaqMan PCR kit and 7300 fluorescence quantitative PCR instrument of Applied Biosystems PCR。

(5) data processing method is △ CT method, and CT is set as recurring number when reaction reaches thresholding, a series of known concentrations Synthesize miRNA reverse transcription and amplification, the absolute magnitude of each miRNA is depicted as standard curve, serum/plasma miRNA serum expression with U6snRNA is as standardization internal reference or exogenous plant tiny RNA MiR2911 as outer ginseng.It extracts in serum/plasma sample RNA carries out reverse transcription reaction, and the amount of miRNA more contained therein is reacted by quantitative PCR.

Fluorescent dye determination (EVA GREEN), the following steps are included:

(1) serum/plasma sample is collected；

(2) serum/plasma total serum IgE is extracted by phenol chloroform method；

(3) AMV reverse transcriptase, stem ring RT primer are utilized, total serum IgE reverse transcription is at cDNA.

(4) determined using fluorescent dye EVA GREEN PCR kit and 7300 fluorescence quantitative PCR instrument of ABI Prism PCR is measured, reaction condition is 95 DEG C, 5 minutes progress 1 circulation → 95 DEG C, 15 seconds, and 60 DEG C, 1 minute carry out 40 circulations.

(5) data processing method is △ CT method, and CT is set as recurring number when reaction reaches thresholding, then each small ribose Nucleic acid can indicate relative to the expression quantity of standard internal reference with equation 2- Δ CT, wherein Δ CT=CT sample-CT internal reference.It is a series of The synthesis miRNA reverse transcription and amplification of known concentration, the absolute magnitude of each miRNA are depicted as standard curve, serum/plasma MiRNA expression is using U6snRNA as standardizing internal reference or exogenous plant tiny RNA MiR2911 as outer ginseng.Extract serum/blood RNA in sample is starched, reverse transcription reaction is carried out, the amount of miRNA more contained therein is reacted by quantitative PCR.

2.4 analyzing and processing data

Specifically, it detects and compares serum/plasma sample relative to the amount of miRNA in normal serum/blood plasma Variation.All measurement datas useIt indicates.Statistical analysis processing is carried out using 16.0 software package of SPSS, between multiple groups Compare using variance analysis F examine, comparison among groups use independent samples t-test, P < 0.05 be with statistical significance , ﹡ represent p < 0.05 , ﹡ ﹡ represents the , ﹡ ﹡ of p < 0.01 ﹡ and represents p < 0.001.

Embodiment 1

The screening of response miRNA in unexplained fever patients serum/blood plasma

Present invention collection (the useless serum collected from clinical laboratory, Nanjing hospital general) normal person 10, vasculitis patient 4, It unexplained fever person 10, is sent out using method detection normal control, vasculitis patient, the unknown cause of Real-time PCR The expression of HCMV miRNA in hot person's serum/plasma.

As a result as shown in Figure 1, a variety of HCMV miRNA expressions are right higher than normal in vasculitis patients serum/blood plasma According to such as: miR-UL36-3p, miR-UL36-5p, miR-US4-3p, miR-US4-5p, miR-US22-3p, miR-US-29-3p, miR-US33-5p,miR-UL59；A variety of HCMV response miRNA expressions are higher than just in pyrexiaof unknown etiology person's serum/plasma Often control, such as: miR-UL36-3p, miR-UL36-5p, miR-US4-3p, miR-US4-5p, miR-US22-3p, miR-US- 29-3p,miR-US33-5p,miR-UL59.The result shows that HCMV miRNA may play a significant role in above-mentioned disease, Play a significant role for the diagnosis, monitoring and pathogenesis of disease.

Embodiment 2

The verifying of unexplained fever patient indicia miRNA

In order to which the effect to HCMV miRNA is verified, normal person, unexplained fever in embodiment 1 are further analyzed Patient (patient shows as generating heat, and pathogenic factor is unclear) HCMV miRNA expression, patient basis are shown in Table 1.

Table 1 tests patient basis used

Then, with Real-time round pcr to whole HCMV miRNA in above-mentioned patients serum/blood plasma (totally 26 kinds, MiRbase 19.0) level detected.

As a result as shown in Fig. 2, a variety of HCMV miRNA in patients serum/blood plasma, such as hcmv-miR-UL148D, hcmv- miR-UL22-5p、hcmv-miR-UL36-3p、hcmv-miR-US33-5p、hcmv-miR-US5、hcmv-miR-UL122-5p、 Hcmv-miR-US25-5p, expression are higher than normal control, this result reconfirms that HCMV miRNA may be in above-mentioned disease In play a significant role, play a significant role for the diagnosis, monitoring and pathogenesis of disease.In Fig. 2, what ordinate indicated It is the difference of recurring number, general recurring number poor one indicates twice of variation.Unexplained fever (fever Unknown origin, FUO Medicine standard) are as follows: 1) heating continuing time >=3 week；2) body temperature it is multiple > 38.3 DEG C；3) the complete medical history in warp >=1 week is ask It asks, cannot still be made a definite diagnosis after physical examination and Routine Test Lab inspection.

Embodiment 3

Verifying/identification to response miRNA

For further inquire into HCMV miRNA physiological function and with some pyrexiaof unknown etiologies, the unknown immunity disease of reason The relationship of sick (vasculitis, rheumatic fever, primary biliary cirrhosis etc.) occurrence and development.With bioinformatics method (http://www.targetscan.org/) predicts the potential source of people target gene of HCMV miRNA

Bioinformatics Prediction the results are shown in Table 2 and Fig. 3, find the table of the controllable a variety of human source genes of HCMV coding miRNA It reaches.

The 2 controllable source of people target gene number of Bioinformatics Prediction HCMV miRNA of table and potential target gene

From table 2 and Fig. 3 can be seen that by above-mentioned target gene carry out analysis shows that, a variety of HCMV miRNA target genes It is related (such as BCL2L11, CDC42, PDCD4, CCNT2, CD80) to Apoptosis, proliferation and immune response, and also there are many The function of the potential target gene of HCMV miRNA and endothelial cell especially vascular endothelial cell maintains and cell physiological is closely related (being shown in Table 2 acceptance of the bid RED sectors and Fig. 3), and have the controllable same vessel endothelial function correlation target of multiple HCMV response miRNA Gene (including BVES, CEACAM, VEGFA etc.), the results showed that, HCMV miRNA may have weight for human body or host's function It acts on；HCMV itself may take part in the disease developments such as some autoimmune diseases such as vasculitis, have great Value of clinical studies.

In summary result of study, the invention demonstrates that after HCMV infection human body, can secrete it is some itself miRNA and entrance The circulatory system such as serum/plasma, HCMV, which carrys out miRNAs, in these serum/plasmas can be used as HCMV infection medical diagnosis on disease mark Object, meanwhile, the expression of the also controllable a variety of human genes of HCMV miRNA has the function of important physiological and pathological, may participate in a variety of The occurrence and development of disease.

Embodiment 4

The measurement of HCMV miRNA express spectra and Clinical Value Analysis in unexplained fever patients serum

It collects larger samples and measures and analyze for studying HCMV miRNA express spectra in unexplained fever patients serum, Including 106 control groups (age-sex's matching)；109 unexplained fever patients, wherein 63 male patients, 46 female Property patient.109 unexplained fever patients include: 58 infectious disease patients, and 19 rheumatism immunological diseases patients, 5 swollen Tumor Disease, 13 miscellaneous diseases patients, 14 are not made a definite diagnosis person.

109 unexplained fever patients, age, sick time are shown in Fig. 4.From fig. 4, it can be seen that patient age section is The case where 18-98 years old, fever time day was differed from 21 days to 764, and patient is prompted to meet unexplained fever.

Utilize HCMV miRNA in the method detection normal control of Real-time PCR, unexplained fever person's serum Expression.

MiR2911 is joined outside the standardization as Real-time PCR.In the present embodiment, add in RNA extraction process Enter 20 μ L 106fmol/L artificial synthesized external source plant MIR2911 (sequence 5 '-GGCCGGGGGACGGGCUGGGA-3 ', SEQ ID NO.:11) be used as outer ginseng, for correcting RNA extraction efficiency and error, and by miRNA to be measured and MIR2911 simultaneously into Row detection sets unified threshold value according to amplification curve, and carries SDS 2.0 with instrument and analyze software to amplification after amplification Curve is analyzed, and the Ct value of miRNA to be measured and outer ginseng MIR2911 are obtained.According to the Ct value meter of miRNA to be measured and MIR2911 The relative expression quantity of serum miRNA in sample to be tested and control is calculated, calculation formula is 2- Δ Ct, and wherein Δ Ct=Ct is to be measured miRNA-CtMIR2911.Sequence information is shown in Table 3.

3 HCMV miRNA sequence information of table

HCMV miRNA ID	Sequence	SEQ ID NO.
			miR-US4-3p	ugacagcccgcuacaccucu	SEQ ID NO.:1
miR-US29-3p	cccacgguccgggcacaauca	SEQ ID NO.:2
			miR-UL70-5p	ugcgucucggccucguccaga	SEQ ID NO.:3
miR-US5-2-3p	uaugauaggugugacgaugucu	SEQ ID NO.:4
			miR-UL112-3p	aagugacggugagauccaggcu	SEQ ID NO.:5
miR-US4-5p	uggacgugcagggggaugucug	SEQ ID NO.:6
			miR-US25-2-3p	auccacuuggagagcucccgcggu	SEQ ID NO.:7
miR-US33-3p	ucacgguccgagcacauccaa	SEQ ID NO.:8
			miR-UL1148d	ucguccuccccuucuucaccg	SEQ ID NO.:9

As a result as shown in figure 5, compared with the control group, miR-US4-3p, miR-US29-3p in unexplained fever person, miR-UL70-5p、miR-US5-2-3p、miR-UL122-3p、miR-US4-5p、miR-US25-2-3p、miR-US33-3p、 The expression of miR-UL1148d is higher than normal control, this result reconfirms that HCMV miRNA may be sent out in above-mentioned disease Important function is waved, is played a significant role for the diagnosis, monitoring and pathogenesis of disease.

Further the HCMV miRNA that expression raises in verifying analysis unexplained fever person's serum, concrete outcome are shown in Fig. 6.From fig. 6, it can be seen that compared with the control group, the expression of miR-US4-3p, miR-UL70-5p are approximately higher than control group 5 Times, the expression of miR-US29-3p, miR-UL122-3p, miR-US33-3p are approximately higher than 3 times of control group, miR-US5-2- The expression of 3p, miR-US4-5p, miR-US25-2-3p are approximately higher than 4 times of control group, and the expression of miR-UL1148d is about Higher than 2.5 times of control group.Further confirm that HCMV miRNA may play a significant role in above-mentioned disease, for disease Diagnosis, monitoring and pathogenesis play a significant role.

Embodiment 5

The correlation of HCMV miRNA and hematologic parameter

The correlation of the present embodiment analysis HCMV miRNA and hematologic parameter.It is thin by testing and analyzing leucocyte, lymph Born of the same parents, c reactive protein content and the correlation of HCMV miRNA expression, verifying HCMV miRNA participates in some autoimmunities Property the disease developments such as disease such as inflammation, there is great value of clinical studies.

Utilize the content of low cytometric analysis detection leucocyte.As a result as shown in fig. 7, HCMV miRNA expression increases Height, quantity of leucocyte increase.The quantity of HCMV miRNA expression and leucocyte is positively correlated.Further prompt may be HCMV Infection, passes through the mutation analysis HCMV infection of leucocyte.

Utilize the content of automatic blood analyzer detection lymphocyte.As a result as shown in figure 8, lymphocyte quantity increases Add, HCMV miRNA expression reduces.The quantity of HCMV miRNA expression and lymphocyte is negatively correlated.Further prompt It may be HCMV infection, because virus infection lymphocyte can reduce.Using these responses miRNA can auxiliary diagnosis infector, Has higher diagnostic value.

Utilize the content of specific protein analysis-e/or determining c reactive protein.Working principle be serum C-reactive protein (CRP) with Anti-human CRP antibody combines in reagent, forms immune complex, and absorbance increases together, measures at wavelength 340nm and 700nm Immune complex turbidity.According to absorbance incrementss, can in quantitative detection serum CRP content.

As a result as shown in figure 9, the content of c reactive protein increases, HCMV miRNA expression is reduced.HCMV miRNA table Up to the horizontal content negative correlation with c reactive protein.Explanation is HCMV and immune response or inflammation-related, utilizes these responses MiRNA can auxiliary diagnosis infector, have higher diagnostic value.

Embodiment 6

The controllable immune response of response miRNA inhibitor

By the inhibitor of the response miRNA, miR-UL36-3p of HCMV, artificial synthesized miR-UL36-3p inhibitor transfect into Cell.The random artificial synthesized miRNA inhibitor of transfection is as control (being purchased from Life Technologies company).It is small to transfect 48 Shi Hou extracts RNA and detects miR-UL36-3p content, and confirmation miR-UL36-3p expression is effectively lowered.

The sequence of random artificial synthesized miRNA inhibitor: guagggaacguaccaccuccc (SEQ ID NO.:10).Really After recognizing, HCMV infection cell is used.After infection 7 hours, target gene PDCD4 content is detected using western blot method method.Journey Sequence apoptosis factor 4 (Programmed cell death 4, abbreviation PDCD4) is a kind of new tumor suppressor gene and one Kind gene relevant to Apoptosis.The result shows that inhibiting miR-UL36-3p expression, PDCD4 expression can be made to be substantially reduced. HCMV miRNA plays a significant role in host's pathological processes, participates in regulation vivo immunization reaction etc..

Embodiment 7

The application of serum/plasma marker for the fever of acatalepsia reason

The purposes of HCMV miRNA of the present invention, be used to prepare the detection reagent of unexplained fever, detection chip or Kit.

Wherein, the nucleic acid chip of unexplained fever is detected, comprising: solid phase carrier；And orderly it is fixed on the solid phase Oligonucleotide probe on carrier, the oligonucleotide probe specificity capture HCMV miRNA of the present invention.

The nucleic acid chip of the detection unexplained fever of the invention can screen steady change in serum with high throughput MiRNA probe, while by the overall variation prediction of miRNA in serum and diagnosing the illness.We pass through the method for sequencing first Or quantifying PCR method determines the miRNA for having more than one to copy in serum, then synthesizes the reverse complemental probe of these miRNA, Again these probes with chip point sample instrument SmartArrayTM point system in a 75 × 25mm, by the glass slide of chemical modification On.Sample of the point system on chip further includes the external standard of 30 bases longs manually prepared as interior target U6, tRNA, sun Property control Hex etc..Entire dot matrix is divided into 4 sub- battle arrays, and each Asia battle array has 23 rows, and 21 column, point spacing is 185 μm, and the diameter of point is about It is 130 μm, every probe is in triplicate.

Chip operation process are as follows: (1) extract total serum IgE in serum/plasma, denaturing formaldehyde gel electrophoresis detects the quality of total serum IgE； (2) separation of miRNA: 50-100 μ g total serum IgE Ambion ' s miRNA Isolation Kit (Cat#.1560) is taken to separate miRNA；(3) fluorescent marker of miRNA sample: fluorescent marker is carried out using T4RNA connection labelling method, then again with anhydrous Ethanol precipitation is used for chip hybridization after drying；(4) RNA hybridization and cleaning: is dissolved in (15% formamide in 16 μ L hybridization solutions； 0.2%SDS；3×SSC；50 × Denhardt ' s solution), in 42 DEG C of hybridized overnights.After hybridization, first on 42 DEG C of left sides The right side contains 0.2%SDS, washes 4 minutes in the liquid of 2 × SSC, and then room temperature is washed 4 minutes in 0.2 × SSC liquid, after slide drying It can be used to scan；(5) chip scanning: chip is scanned with LuxScan 10K/A twin-channel laser scanner；(6) data It extracts and analyzes: chip image being analyzed using LuxScan3.0 image analysis software, picture signal is converted into number Signal finally selects difference expression gene with SAM analysis.

Quantitative PCR technique and biochip technology double verification is poor under unexplained fever and normal physiological condition The big a kind of serum/plasma miRNA serum probe of different expression degree, is used to prepare biochip, method is same as above.This chip and conventional core Piece is compared, and manufacture craft and operating process do not have significant improvement, but this chip simplifies probe library, thus will greatly reduce core It is the cost of manufacture of piece and production time, easily prepared.The specific aim and practicability of chip are also increased simultaneously.This chip is put into Practice, it is thus only necessary to which the serum/plasma of patient can help to instruct without any other tissue in early detection disease Diagnosing and treating.

In addition, the purposes of nucleic acid chip of the present invention, is used to prepare the kit of detection unexplained fever.Detection is not Contain nucleic acid chip of the present invention or HCMV miRNA of the present invention in the kit of bright reason fever.

For the diagnosis of unexplained fever, therapeutic evaluation and the screening of active pharmaceutical ingredient, evaluating drug effect The manufacture craft and operating process of miRNA kit are based on quantitative and semi-quantitative round pcr and biochip technology.

The miRNA for having more than one to copy in normal serum/blood plasma is determined by the method or PCR method that are sequenced first. Then big by quantitative PCR technique and biochip technology screening expression quantity and difference degree under disease and normal physiological condition A kind of serum/plasma miRNA serum, as predict whether occur unexplained fever and diagnose lesion degree index.Finally The quantity of corresponding serum/plasma miRNA serum is filtered out, this is simplifying for the optimization made on the basis of chip probe library. This kit includes serum/plasma miRNA serum primer, the reagents such as Taq enzyme, dNTP.The value of this kit be only to need serum/ Blood plasma detects the variation tendency of miRNA by the probe library most simplified without other tissue samples, then is become by the variation Gesture predicts the pathologic stage of a possibility that unexplained fever occurs or the fever of acatalepsia reason.Therefore this kit is put into Practice, can increase the possibility of acatalepsia reason fever, and diagnosing and treating is instructed in help.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Sequence table

<110>Jiangsu Mingma Biology Technology Co., Ltd.

<120>marker of unexplained fever, detection method and its application

<130> P2017-2436

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 1

ugacagcccg cuacaccucu 20

<210> 2

<211> 21

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 2

cccacggucc gggcacaauc a 21

<210> 3

<211> 21

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 3

ugcgucucgg ccucguccag a 21

<210> 4

<211> 22

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 4

uaugauaggu gugacgaugu cu 22

<210> 5

<211> 22

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 5

aagugacggu gagauccagg cu 22

<210> 6

<211> 22

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 6

uggacgugca gggggauguc ug 22

<210> 7

<211> 24

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 7

auccacuugg agagcucccg cggu 24

<210> 8

<211> 21

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 8

ucacgguccg agcacaucca a 21

<210> 9

<211> 21

<212> RNA

<213>homo sapiens (Homo sapiens)

<400> 9

ucguccuccc cuucuucacc g 21

<210> 10

<211> 21

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 10

guagggaacg uaccaccucc c 21

<210> 11

<211> 20

<212> RNA

<213>artificial sequence (Artificial Sequence)

<400> 11

ggccggggga cgggcuggga 20

Claims

1. the purposes of a kind of FUO specific marker object and its detection reagent, which is characterized in that be used to prepare diagnostic reagent or diagnosis Kit, the diagnostic reagent or kit judge whether test object suffers from unexplained fever, and/or (ii) for (i) Judge that the risk (neurological susceptibility) of unexplained fever occurs for test object, wherein the FUO specific marker object is selected from the group A:

miR-US4-3p、miR-US29-3p、miR-UL70-5p、miR-US5-2-3p、miR-UL122-3p、miR-US4-5p、 MiR-US25-2-3p, miR-US33-3p, miR-UL1148d, or combinations thereof.

2. purposes as described in claim 1, which is characterized in that the FUO specific marker object includes any two in group A Kind, three kinds, or more miRNA.

3. purposes as described in claim 1, which is characterized in that the diagnostic reagent or diagnostic kit is for detecting blood Sample, plasma sample or serum sample, preferably peripheral blood sample.

4. a kind of marker combination for detecting unexplained fever, which is characterized in that the described marker combination comprising two kinds or A variety of miRNA:miR-US4-3p, miR-US29-3p, miR-UL70-5p, miR-US5-2-3p, miR- selected from the group below UL122-3p, miR-US4-5p, miR-US25-2-3p, miR-US33-3p, miR-UL1148d, or combinations thereof.

5. a kind of diagnostic kit, which is characterized in that the kit contains:

(a) detection reagent of the combination of marker described in claim 4 is detected；With

(b) specification, the specification indicate the kit and judge whether test object suffers from unknown cause hair for (i) Heat, and/or (ii) judge that the risk (neurological susceptibility) of unexplained fever occurs for test object.

6. kit as claimed in claim 5, which is characterized in that the detection reagent includes nucleic acid chip or probe groups It closes.

7. a kind of probe combinations, which is characterized in that the probe combinations include to detect two or more miRNA selected from the group below Probe: miR-US4-3p, miR-US29-3p, miR-UL70-5p, miR-US5-2-3p, miR-UL122-3p, miR-US4- 5p, miR-US25-2-3p, miR-US33-3p, miR-UL1148d, or combinations thereof.

8. probe combinations as claimed in claim 7, which is characterized in that the probe is fluorescence probe.

9. a kind of nucleic acid chip, which is characterized in that the nucleic acid chip includes probe combinations described in fourth aspect present invention.

10. a kind of purposes of FUO specific marker object adjusting control agent, which is characterized in that for treating unexplained fever, wherein The FUO specific marker object be miRNA:miR-US4-3p, miR-US29-3p selected from the group below, miR-UL70-5p, MiR-US5-2-3p, miR-UL122-3p, miR-US4-5p, miR-US25-2-3p, miR-US33-3p, miR-UL1148d or A combination thereof.