KR20180081445A - Method for rapidly detecting nucleic acid and rapid diagnosic method of disease using thereof - Google Patents

Abstract

The present invention relates to a method for rapidly detecting a target nucleic acid and a method for rapidly diagnosing a disease by using the same. The method for rapidly detecting a target nucleic acid comprises the following steps: (a) performing a polymerase chain reaction (PCR) with a fluorescent probe bound to double-stranded nucleic acid by using a primer having a tag attached thereto (a tagged primer) with a sequence complementary to some regions of a target nucleic acid sequence; (b) inducing a binding reaction between the tag and a capture element by treating, with the PCR product generated in step (a), a solid phase in which the capture element to be attached to the tag is agglomerated at a predetermined position; and (c) detecting fluorescence from the solid phase of step (b). In the present invention, provided is a method for checking a PCR result in a fast and rapid manner. Accordingly, a user can perform diagnosis in a rapid manner in an emergency and on-site by analyzing the result within a short time even in the absence of a specialist and certain facilities. In particular, the method of the present invention can be combined with the recent development of a portable PCR device and can provide a synergy effect.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for rapidly detecting a nucleic acid,

The present invention relates to a rapid detection method for nucleic acids and a method for rapidly diagnosing diseases using the same. More particularly, the present invention relates to a method for detecting nucleic acid using a tagged primer having a sequence complementary to a partial region of a target nucleic acid sequence, , Performing a polymerase chain reaction (PCR) with a fluorescent probe that binds to the double-stranded nucleic acid; (b) treating the PCR product produced in step (a) to a solid phase on which the capture component to which the tag is attached is integrated at a specific position to induce a binding reaction between the tag and the capture component; And (c) detecting fluorescence from the solid phase in the step (b), and a method for rapidly diagnosing disease using the method.

Respiratory viruses are the leading cause of acute respiratory infections and are the most common disease, regardless of age or gender. It is known that infants, elderly people, people with impaired cardiorespiratory function and immune function can cause aftereffects and lead to death. Diseases associated with respiratory viruses most commonly begin with cold symptoms, ranging from pharyngitis, chronic asthma deterioration, and pneumonia. Early detection of these respiratory viruses can prevent the abuse of unnecessary antibiotics, and can detect the type of virus early and treat patients appropriately. In particular, when a pandemic caused by a new or mutated influenza virus occurs, as in the case of the new influenza H1N1 virus, the current vaccine development technology can not develop a vaccine within a short time, Therapeutics have limited efficacy limitations at the beginning of infection (at least 48 hours after infection).

In order to maximize the efficacy of the antiviral treatment until the development of the preventive vaccine when pandemic influenza occurs, it is necessary to promptly determine the presence or absence of the infection in real time, It is necessary to develop a device capable of early diagnosis. The development of such devices is very effective in reducing the anxiety of the public and reducing the medical expenses, which are very effective in national and social aspects.

Previously, these methods for detecting respiratory viruses include cell culture methods and rapid antigen test. In the case of cell culture, it takes more than 5 ~ 9 days to confirm the result of the test, and it is difficult to diagnose and treat the respiratory virus infection early. In order to secure this disadvantage, the result is confirmed within 24 ~ 72 hours, And R-mix viral culturing methods similar to those described above. However, early diagnosis and treatment are also limited. The rapid antigen test can confirm the results in a short time, but the sensitivity is lower than that of the conventional culture method, and thus there is a problem that the false negative is high.

More specifically, for a caregiver who is waiting for the results of a confirmation of the infection of a doctor or a swine influenza patient who needs to determine the rapid use of the antiviral agent and the anti-flu virus to the patient, The most common method is the Rapid Influenza Diagnostic Test (RIDT), an antibody-based immunochromatography (rapid antigen test) that detects influenza antigens. However, RIDT is less sensitive than the viral culture method, which is a cold standard for diagnosis of influenza viruses, or the real-time RT-PCR method, which is currently being used. (For seasonal influenza, (Sensitivity of 50-70% compared to viral culture) has been pointed out as a precautions for diagnosis of influenza before the development of new influenza. In fact, since the development of new influenza in 2009, the sensitivity and specificity for the diagnosis of new influenza in various cohorts using various RIDTs have been evaluated. As a result, the range of sensitivity (11-70%) has been shown, Has been shown to be inadequate for the diagnosis of new influenza as it shows insufficient sensitivity to be used in confirming the patient's new influenza infection.

As a result, the diagnosis of influenza virus through RIDT has the advantage of obtaining rapid results, but the sensitivity is lower than that of the viral culture and Realtime RT-PCR because of the nature of the test method. (Review of the rapid diagnostic tests for influenza, influenza, and influenza in the influenza center of the Center for Disease Control and Prevention, 2012, pp.1-5).

However, in the case of using the above-mentioned PCR, PCR is a molecular diagnostic method having relatively high reliability, but there is a problem that it is required to depend on a specific expert in deriving, analyzing and analyzing the result by PCR products.

[Non-Patent Document 1] Review of rapid diagnosis test for diagnosis of influenza in influenza virus infection department center of disease management headquarters in Ehwa, 2012, pp.1-5

Accordingly, the present inventors have conducted studies to devise a disease detection method that is easy to elicit a result and has a short inspection time as in the case of the conventional rapid antigen diagnosis method, while having high accuracy and reliability in the detection of the presence or absence of disease, The present inventors confirmed that it is possible to quickly and easily detect disease with high sensitivity using the detection method, and the present invention has been completed.

Accordingly, an object of the present invention is to provide a method for detecting a target nucleic acid, comprising the steps of: (a) carrying out PCR using a tagged primer having a sequence complementary to a partial region of a target nucleic acid sequence, ); (b) treating the PCR product produced in step (a) to a solid phase on which the capture component to which the tag is attached is integrated at a specific position to induce a binding reaction between the tag and the capture component; And (c) detecting fluorescence from the solid phase of step (b).

Another object of the present invention is to provide a nucleic acid sample obtained from a patient's sample by using a tagged primer having a sequence complementary to a partial region of a disease marker nucleic acid, (PCR) with a fluorescent probe that hybridizes with the probe; (b) treating the PCR product produced in step (a) to a solid phase on which the capture component to which the tag is attached is integrated at a specific position to induce a binding reaction between the tag and the capture component; And (c) detecting fluorescence from the solid phase of step (b).

In order to achieve the above object, the present invention provides a method for detecting a target nucleic acid, comprising the steps of: (a) using a tagged primer having a sequence complementary to a partial region of a target nucleic acid sequence, Performing a polymerase chain reaction (PCR); (b) treating the PCR product produced in step (a) to a solid phase on which the capture component to which the tag is attached is integrated at a specific position to induce a binding reaction between the tag and the capture component; And (c) detecting fluorescence from the solid phase of step (b).

In order to accomplish another object of the present invention, the present invention provides a method for detecting a disease marker nucleic acid, comprising the steps of: (a) using a tagged primer having a sequence complementary to a region of a disease marker nucleic acid to a nucleic acid sample obtained from a patient sample; (PCR) with a fluorescent probe that binds to a double-stranded nucleic acid; (b) treating the PCR product produced in step (a) to a solid phase on which the capture component to which the tag is attached is integrated at a specific position to induce a binding reaction between the tag and the capture component; And (c) detecting fluorescence from the solid phase of step (b).

Hereinafter, the present invention will be described in detail.

According to the present invention,

(a) Purification of the target nucleic acid sequence With some areas  Tagged with a complementary sequence You can use a tagged primer  (PCR) with a fluorescent probe that binds to a double-stranded nucleic acid;

(b) treating the PCR product produced in step (a) to a solid phase on which the capture component to which the tag is attached is integrated at a specific position to induce a binding reaction between the tag and the capture component; And

(c) detecting fluorescence from the solid phase in step (b)

The method comprising the steps of:

The term " objective nucleic acid " in the present invention means a substance of a plurality of nucleic acid materials constituting a specific sequence, which is a substance to be detected in the present invention whether or not it is present in the sample. The nucleic acid material may be DNA, RNA, PNA (peptide nucleic acid), LNA (locked nucleic acid) or the like, but is most preferably DNA or RNA. More specifically, the target nucleic acid includes DNA, cDNA, genomic DNA, oligonucleotide, and the like, wherein the target nucleic acid is derived from a living organism or the like or produced in vitro or in vivo. The RNA includes genomic RNA, mRNA, oligonucleotide And the like.

In the present invention, the target nucleic acid functions as a marker, and the presence or absence of the specific disease (or condition) can be confirmed by detecting the presence or absence of the target nucleic acid in the sample.

The objective nucleic acid detection method of the present invention is applicable to the detection of various diseases (or conditions), and the type of the disease is not particularly limited, but examples thereof include infectious diseases; (Including mutagenic diseases) which are associated with genetic mutations and which are useful as cancer, inflammatory diseases, metabolic diseases, neurological diseases, musculoskeletal diseases, gastrointestinal diseases, allergic diseases, immune related diseases, endocrine diseases, Genitourinary system diseases, respiratory diseases, and skin diseases. Depending on the type of disease to be detected, a person skilled in the art can easily construct the target nucleic acid as a disease marker.

When the target nucleic acid is a disease marker, the disease marker nucleic acid includes, but is not limited to, a foreign gene from an infectious agent or an internally mutated nucleic acid (gene) of an individual.

The type of the infectious agent is not particularly limited as long as it is a known pathogenic microorganism, and includes, for example, a virus, a bacterium, a fungi or a parasite. For example, the virus may be selected from the group consisting of influenza virus, respiratory syncytial virus (RSV), zicavirus, metanomovirus, adenovirus, parainfluenza virus, rhinovirus, adenovirus, measles virus, rotavirus, HIV virus, , Coxsackie virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, and the like. For example, the bacteria may be selected from the group consisting of Pseudomonas, Excherichia, Klebsiella, Enterobacter, Proteus, Serratia, Candida, But are not limited to, Staphylococci, Streptococci, Chlamydia, bacteria of the genus Mycoplasma, and the like.

The inherently mutant nucleic acid refers to a mutation in an endogenous gene of an individual in a specific disease (or condition), and may be a naturally occurring gene in a subject, such as known cancer markers Or may be generated by intracellular (intracellular) introduction of the exogenous gene. As used herein, the term " mutation " refers to a mutation that occurs at the level of a gene as compared to a control in which mutation has not been induced, resulting in a difference in phenotype (particularly disease state) It includes both mutations as well as artificially introduced mutations. Mutations include all mutations that occur at random or at specific locations, additions, deletions, and / or substitutions of nucleotides that make up the gene, and the like.

Preferably, the disease marker nucleic acid may be a foreign gene from an infectious agent or an internal mutant nucleic acid by introduction of the foreign gene.

The specific sequence of the target nucleic acid or disease marker nucleic acid can be determined by a person skilled in the art according to the specific disease to be informed in diagnosis and the like. For example, it is disclosed in the art that hemagglutinin or neuraminidase-encoding nucleic acid, an antigen protein of influenza virus, can be used as a target nucleic acid for diagnosis of influenza infection.

In the present invention, the term " sample " means an analyte containing a target nucleic acid to be detected, for example, one obtained from a specimen of an individual (or patient) suspected of having a specific disease. The sample may be the sample itself, or may be a workpiece subjected to arbitrary treatment such as grinding, extraction, refining or the like. The sample means a material necessary for the examination, and includes, but is not limited to, tissue, cell, whole blood (blood), serum, plasma, saliva, sputum, cerebrospinal fluid or urine. Preferably blood or saliva.

In step (a), the target nucleic acid sequence With some areas  Tagged with a complementary sequence You can use a tagged primer  using, Double strand  Bound to a nucleic acid Fluorescent probe and  Together with polymerase chain reaction PCR ).

The term " primer " in the present invention refers to a short nucleic acid sequence having a free 3 'terminal hydroxyl group, which can form a base pair with a complementary template and function as a starting point for template strand copy Quot; means a nucleic acid sequence. Primers can initiate DNA synthesis in the presence of four nucleoside triphosphates that differ from the reagents for polymerization (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. The primer is a pair of sense and antisense nucleic acids (i.e., forward primer and reverse primer) consisting of 5 to 50 nucleotides, preferably 10 to 30 nucleotides, and changes the basic properties of the primer acting as a starting point of DNA synthesis Additional features can be incorporated unless otherwise noted.

The term " complementary " means having complementarity enough to selectively hybridize to the above-mentioned target nucleic acid sequence under any specific hybridization or annealing conditions, and may be optionally hybridized to the desired nucleic acid sequence And may have one or more mismatch nucleotide sequences. Preferably, the primer may be perfectly complementary to the target nucleic acid sequence.

In the present invention, the primer is characterized in that a tag is attached to the 5 'end, and the tag collectively refers to a substance that attaches or binds to a capture element in step (b) described later.

The tag may be attached to or included in the primer by any suitable method, the tag itself may be directly attached to the primer or through a linker molecule. The bond may be a covalent bond or a noncovalent bond, and the method of attaching the specific substance of the tag material may be readily determined by those skilled in the art.

The tag allows the primer attached with the tag to bind the nucleic acid sequence elongated to the starting point directly or indirectly with the capture component (or receptor) attached to the solid support by PCR. The capture component is typically highly specific for interaction with the tag or is selected (or designed) to remain engaged during the next processing step. The tag can position the stretched nucleic acid sequence at a spatially defined location on the solid support, starting with the tagged primer. Thus, different tags can position different nucleic acid sequences at different spatially defined locations on a solid support.

The tag can be determined by a person skilled in the art according to the trapping component material used together. The tag or the trapping component is not limited thereto but specifically includes a polynucleotide, a polypeptide, a peptide nucleic acid, a locked nucleic acid, , Polysaccharides, antibodies, affibodies, antibody mimetics, cell receptors, ligands, lipids, any fragments or derivatives of such structures. Generally, a tag is constructed so as not to internally interact with itself or with a primer molecule attached to the tag.

The combination of the capture component and the tag substance that specifically binds thereto is preferably such that the binding between the tag and the capture component is selected from the group consisting of a biotin-avidin linkage, a biotin-streptavidin linkage, a biotin-extrastavidin linkage, a biotin- May be due to the complementary binding between -SNAP binding, benzyl cytosine-CLIP binding, enzyme-substrate binding, antigen-antibody binding, metal-histidine binding, metal compound-protein binding, protein- protein binding or nucleic acid, A biotin-avidin bond, a biotin-streptavidin bond, a biotin-extravidin bond or a biotin-neutravidin bond.

When the tag is biotin, the capture component may be a biotin binding protein such as avidin, streptavidin, neutravidin, extravidin. Conversely, the capture component may be biotin and the tag be a biotin binding protein.

When the tag is polyhistidine, the entrapped component is poly-histidine when chelated with a metal ion such as nickel, cobalt, iron or nitrilotriacetic acid (NTA) And any other metal ion capable of forming a coordination compound with chelated nitrilotriacetic acid. Similarly, tag and catch components can be reversed.

As used herein, the term "protein" may be used interchangeably with "polypeptide" or "peptide" and refers to a polymer of amino acid residues, as is commonly found in natural state proteins.

 In the present invention, "nucleic acid" or "polynucleotide" refers to deoxyribonucleotides or ribonucleotides in the form of single- or double-stranded. Unless otherwise constrained, also includes known analogs of natural nucleotides that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides.

The term 'PCR (polymerase chain reaction)' or 'nucleic acid amplification reaction' in the present invention means a reaction for amplifying a specific target nucleic acid molecule using a thermostable DNA polymerase. In PCR, in addition to the DNA polymerase, a primer (forward primer, reverse primer), oligonucleotide mixture (dNTP mixture) which is an oligonucleotide capable of specifically hybridizing to a target nucleic acid, reaction buffer solution containing divalent ions such as Mg2 + Is used. Nucleic acid molecules (DNA or RNA) produced or elongated by the PCR reaction are referred to herein as "amplification products" or "PCR products".

The type of the PCR is not particularly limited as long as it is known as a PCR method for amplifying a specific genetic material (target nucleic acid) desired to be detected. For example, reverse transcriptase polymerase chain reaction (PCR) is used to synthesize complementary DNA using reverse transcriptase (PCR), single PCR, nested PCR, multiplex PCR, micro PCR and RNA, chain reaction, RT-PCR).

The PCR reaction conditions adopted in the detection method of the present invention can be selected by adopting or partially modifying conventional PCR reaction conditions according to the kind of PCR such as single PCR, nested PCR, multiplex PCR, micro PCR, etc., It falls within the category that can be easily configured by those skilled in the art.

The PCR in the step (a) of the present invention is characterized in that it is carried out together with a fluorescent probe which binds to a double-stranded nucleic acid.

The fluorescent probe that binds to the double-stranded nucleic acid specifically binds to a double strand of nucleic acid when the nucleic acid sequence is stretched. The type of fluorescent dye known in the art is not particularly limited. For example, SYBR TOY-PRO-3, TOTO, YOYO, YOPRO-1, green, Picogreen, Evagreen, Hoechst 33258, Hoechst 33342, ethidium bromide, acridine orange, propidium iodide, mithramycin And the like.

The fluorescent probe that binds to the double-stranded nucleic acid is provided in a PCR reaction mixture together with a tagged primer, a DNA polymerase, a dNTP mixture, and the like. The double-stranded nucleic acid sequence (DNA Or RNA sequence) to generate a fluorescent signal. The presence or absence of the target nucleic acid (target gene) can be determined from the fluorescence signal.

the amplification reaction of the target nucleic acid sequence takes place through step (a), a fluorescence probe is attached to the nucleic acid sequence stretched by the double strand and a tagged PCR product is generated at the 5 'end.

 (b) is a step of inducing a binding reaction between the tag and the capture component by treating the PCR product generated in the step (a) on a solid phase on which the capture component to which the tag is attached is integrated at a specific position.

The types of the trapped components and the tags, their combinations and coupling relationships are as described above.

In the present invention, the term 'accumulation' refers to a state in which a large amount of trapped components are gathered in a specific shape fixed at a specific position of a solid phage, and the trapped component includes a line, a dot ) Can be integrated in various shapes.

Characterized in that the solid phase constitutes part or all of a " test strip ". The term test strip may be used herein interchangeably with terms such as an assay strip.

The solid phage is generally used for immunochromatographic analysis and is not particularly limited as long as it is a solid support means such as a pad or a membrane known in the art.

As long as the test strip is constituted by using a capture component that specifically binds to the tag used in the step (a), a specific production form and a production method are not limited, and a sample pad, a conjugate pad pad and an absorbent pad. The test strip may be referenced to immunochromatography test strip construction methods known in the art.

Typically, the immunochromatographic assay includes an assay strip containing any reactant capable of reacting with the analyte to be detected and exhibiting a detection signal, or a device-type analyzer in which the analyte strip is mounted in a plastic case It is generally used. Typical analytical strips include a sample (sample) pad that contains a liquid sample (sample), a conjugate that is conjugated to a ligand, such as an antigen or antibody, that generates a signal that can be detected by the naked eye or by using a sensor A porous membrane pad (conjugate pad) on which an analyte in a specimen and / or a binding agent (antibody or antigen) specifically binding to the conjugate are immobilized, and a hygroscopic pad for ultimately housing a liquid specimen, These functional pads are connected and attached in a partially overlapping manner in the order listed above and are continuously arranged. When the analytical strip is used inside the plastic case, a sample inlet for dropping a specimen (sample) is provided at the position of the specimen (sample) pad on the upper part of the case, A result confirmation window for confirming the result is formed. As described above, in the immunochromatographic analysis using the analytical strip, when a liquid sample is dropped onto a sample (sample) pad, the liquid sample moves through the conjugate pad and the porous membrane pad (conjugate pad) by capillary phenomenon, Is accommodated in the moisture absorption pad. At this time, if the conjugate contained in the conjugate pad moves together with the liquid specimen and the substance to be analyzed exists in the specimen, the conjugate binds to the binding agent immobilized on the porous membrane pad through the analyte (usually, (hereinafter referred to as " competition reaction "), the presence or absence of analytes in a sample is visually or by using a sensor Can be detected.

In the present invention, the test strip used in step (b) does not require a separate conjugate pad in comparison with the test strip conventionally used in immunochromatography. This is because when the PCR is carried out in step (a) It is caused by preprocessing the probe to combine. Thus, in a conventional assay strip, when a conjugate that is fixed in a dried form on a conjugate pad is mixed with a liquid sample moving by capillary action, the bond with the conjugate is not uniform, And denaturation of the antibody (typically protein) used as the conjugate may occur, thereby reducing the problem of poor accuracy and reproducibility of the assay.

Therefore, the test strip of the present invention may preferably be formed by successively connecting a sample pad, a conjugate pad, and an absorbent pad. And a capture component composing a complex with the tag particle is fixed to the conjugate pad. The conjugate pad may preferably be immobilized on a nitrocellulose membrane or PVDF membrane, but is not limited thereto.

The treatment of the PCR product includes all of the forms in which the trapped component is directly processed or indirectly treated in a solid phase, that is, a conjugate pad integrated at a specific position. The indirect treatment may preferably be such that the PCR product is dripped onto a sample pad on a test strip (analytical strip) and the PCR product is passed through the conjugate pad by capillary action on the pad.

Through the binding reaction between the tag and the capture component, the tagged PCR product is specifically present only at the corresponding position along the shape of the capture component present on the test strip, and the fluorescence probe attached to the PCR product The fluorescence signal of a specific intensity is emitted.

(c) is a step of detecting fluorescence from the solid phase in the step (b).

Detection of fluorescence can be readily determined by those skilled in the art depending on the type and nature of the fluorescent probe used in step (a). As the light source, for example, a Mecury lamp, a metal halide lamp, a Xenon lamp, a UV lamp, an LED lamp, a halogen lamp, and a laser may be used according to the kind of the fluorescent probe. The light source can be used to irradiate light of a specific wavelength suitable for light emission or coloring of the fluorescent probe.

The 'method for rapid detection of target nucleic acid' of the present invention is based on the PCR method, and the amplification result for the PCR product is detected locally through a specific coloring (fluorescence) reaction on the test strip, It is advantageous that the analysis can be performed very quickly visually. Normally, test strips are compact, portable, easy to use and convenient. This is in contrast to the case where a specific analysis device such as electrophoresis or ELISA is used in the conventional analysis of the PCR product, thereby requiring a considerable additional analysis time and a specialized manpower. When the electrophoresis method is used, it is necessary not only to prepare a gel, but also a special device for flowing electricity, and it takes a relatively long time to separate the nucleic acid according to the molecular weight. The ELISA method also requires a separate ELISA kit and reader device. The devices used in these methods are usually used in specialized laboratories. They are used in the field immediately when an on-site diagnosis or other emergency diagnosis is needed There is a problem that it is difficult to apply. The present invention, on the other hand, is advantageous for field applications because of the use of test strips and has synergistic effects in terms of rapid and accurate detection of disease, particularly when used in emergency sites, such as portable PCR devices (eg, Arram Bio Palm PCR).

The method for the rapid detection of a target nucleic acid of the present invention, which comprises the steps (a), (b) and (c) above, may be carried out further comprising the following step (d);

(d) determining that the target nucleic acid is present if the fluorescence detection result of step (c) matches the position at which the capture component is integrated in step (b).

The step (d) is for discriminating the fluorescence signal from the specific amplification of the target nucleic acid and the nonspecific fluorescence signal. When the fluorescence signal is detected at a predetermined position, that is, by hybridization between nucleic acids other than the target nucleic acid This is a step that excludes possible false positive reactions. The PCR product with the tag is specifically present only in the corresponding position along the shape of the capturing component present on the test strip, so that the fluorescence signal of a specific intensity is emitted only at the position.

The nucleic acid rapid detection method of the present invention described above is advantageous in that it can quickly provide information for diagnosis of a disease when the target nucleic acid to be detected is a marker indicating a specific disease (or condition).

Therefore,

(a) for a nucleic acid sample obtained from a patient ' s sample, Marker  Nucleic acid With some areas  Tagged with a complementary sequence You can use a tagged primer  using, Double strand  Bound to a nucleic acid Fluorescent probe and  Together with polymerase chain reaction PCR );

(b) treating the PCR product produced in step (a) to a solid phase on which the capture component to which the tag is attached is integrated at a specific position to induce a binding reaction between the tag and the capture component; And

(c) detecting fluorescence from the solid phase in step (b)

A method for quickly providing information for diagnosis of a disease .

Also,

(d) determining that a disease marker nucleic acid is present if the fluorescence detection result of step (c) matches the position at which the capture component is integrated in step (b);

. ≪ / RTI >

The above disease marker and steps (a) to (d) are as described above.

The present invention provides a method for quickly and quickly confirming PCR results using a tag-labeled primer, a fluorescent probe that binds to a double-stranded nucleic acid, and a test strip to which a specific capture component is fixed, The results can be analyzed in a short time without any special equipment, so that the diagnosis can be made in emergency and in the field. By streamlining the process of analyzing the results, it is possible to analyze the results easily in the field and diagnose in an emergency situation. In addition, it is possible to analyze the results with high confidence even if the expert does not accompany the PCR. Therefore, the advantages of PCR can be used regardless of the time and space limitations. This can be combined with the development of portable PCR devices, especially recently, to produce synergistic effects.

According to the present invention, it is possible to prevent the spread of the virus and prevent the spread of the virus by making a diagnosis in a short time for patients suspected of having infectious diseases such as Mersin or Zikavirus, Of the patients. In addition, it takes usually one week to receive a confirmation from a patient at the time of diagnosis of a sexually transmitted disease infected person to a specialist. Even in such a case, the spread of the disease can be prevented by early diagnosis and confirmation through the present invention. In addition, it can minimize the damage of livestock farmers due to the spread of disease by rapidly conducting field inspections against livestock diseases such as AI, and it is expected to have various ripple effects by responding to demands that require urgent diagnosis and field diagnosis.

1 shows the binding relationship between a target nucleic acid (a template nucleic acid) and a primer in a PCR using a primer in which Biotin is attached (labeled) as a tag.
Fig. 2 shows a schematic diagram in which the PCR product is attached to a test line to which avidin (capture component) is immobilized.
3 is a schematic view showing the principle of detecting fluorescence on a test strip in the present invention.
Fig. 4 shows the result of testing specific detection of the SIT1 gene nucleic acid according to the present invention in a sample mixed with various nucleic acids.
Figure 5 shows the results of specific detection of the SIT1 gene nucleic acid on a test strip according to the present invention.

Hereinafter, the present invention will be described in detail.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

≪ Example 1 >

PCR and immunochromatography based rapid nucleic acid detection method

<1-1> Preparation of avidin-based test strip

A nitrocellulose membrane (180 sec Nitrocellulose, Millipore, Germany) and an absorbent pad (Millipore, Germany) used as a detection layer were attached to a plastic pad (Millipore, Germany) and then a Dispenser System 1 mg / mL solution of Avidin (A9275-1MG, Sigma-Aldrich, USA) dissolved in distilled water was applied to the membrane at a rate of 6 cm / sec to form a test line, respectively. The membrane was dried and then cut into cutters at intervals of 3 mm. The sample pad (C068, Millipore, Germany) was immersed in an aqueous solution of 0.5% Tween 20, 5% sucrose, 5% dextran and 0.05% sodium azide, And cut. Finally, the test strip of the present invention was formed in such a manner that an absorbing pad was attached to the other end of the sample strip at one end, centering on the nitrocellulose membrane, which was used to detect the detection line with Avidin (see FIG. 3 ).

<1-2> Production of biotinylated nucleic acid by polymerase chain reaction (PCR)

From the sample mixed with nucleic acid of various genes, it was tried to detect whether the gene of SIT1 (NCBI sequence ID: XM_005660221, SEQ ID NO: 1) was present. To as shown in Table 1, using a biotinylated forward primer and reverse primer sets having a dsDNA sequence portion complementary to a sequence of the gene was performed SIT1 PCR (see Fig. 1). As a PCR instrument, Applied Biosystems veriti was used. Using the TOYOBO SYBR Green Realtime PCR Mastet Mix (QPK-201) PCR reaction solutions were prepared as shown in Table 2 below. The PCR reaction conditions were denatured at 95 ° C for 2 minutes, followed by denaturation (95 ° C for 20 seconds), binding (55 ° C for 40 seconds) and extension (72 ° C for 1 minute) for a total of 35 replicates.

Sequence (5 '-> 3') Forward primer
(SEQ ID NO: 2) Biotin-GCTGCAGAAGAGGTGATGTGCTA Reverse primer
(SEQ ID NO: 3) TGAGATGGGTCGGTCACAACT

PCR  Reaction liquid composition Volume SYBR Green Realtime PCR Mastet Mix 10 μl Forward primer 0.4 μl Reverse primer 0.4 μl DNA 2 μl (30 ng) DW   7.2 μl Total 20 μl

<1-3> Specific detection of target nucleic acid on test strip

The PCR product prepared in <1-2> was treated on the test strip prepared in Example <1-1> to induce a binding reaction between biotin contained in the PCR product and avidin immobilized on the strip (See FIG. 2 ), a fluorescence pattern by SYBR green dye was detected and analyzed. To the sample pad portion, add 150 μl DW (distilled water) to 20 μl of the PCR product After 1 minute, 470 nm LED light was irradiated to the pad to confirm the emission signal of SYBr green (see FIG. 3 ).

As a result, as shown in FIG. 4 , it was confirmed that an instant fluorescence signal appears at the site where avidin is integrated.

In addition, as shown in FIG. 5 , an immediate fluorescence signal appeared at the site where avidin was integrated, and it was confirmed that the target nucleic acid was specifically detected at a specific detection position on the test strip of the present invention.

Thus, the above example shows that the PCR result can be confirmed quickly and quickly according to the method of the present invention.

As described above, the present invention provides a method for detecting a target nucleic acid, comprising the steps of: (a) using a tagged primer having a sequence complementary to a partial region of a target nucleic acid sequence, (PCR); (b) treating the PCR product produced in step (a) to a solid phase on which the capture component to which the tag is attached is integrated at a specific position to induce a binding reaction between the tag and the capture component; And (c) detecting fluorescence from the solid phase in the step (b), and a method for rapidly diagnosing disease using the method.

The present invention provides a method for quickly and quickly confirming the PCR result, thereby providing reliable analysis results in a short period of time without experts and specific facilities, thereby enabling quick diagnosis in the emergency field. This can be combined with the development of portable PCR devices, especially recently, to produce synergistic effects. According to the present invention, it is possible to prevent the spread of the virus and prevent the spread of the virus by making a diagnosis in a short time for patients suspected of having infectious diseases such as Mersin or Zikavirus, Of the patients. In addition, it takes usually one week to receive a confirmation from a patient at the time of diagnosis of a sexually transmitted disease infected person to a specialist. Even in such a case, the spread of the disease can be prevented by early diagnosis and confirmation through the present invention. In addition, it is possible to minimize the damage of livestock farmers due to the spread of diseases by rapidly conducting field inspections against livestock diseases such as AI, and it is anticipated to have various ripple effects by responding to demands that require urgent diagnosis and field diagnosis, It is highly likely to use the award.

<110> BAE, Jin Hyun <120> Method for rapidly detecting nucleic acid and rapid diagnosic          method of disease using <130> NP16-0159P <150> KR 10-2017-0002346 <151> 2017-01-06 <160> 3 <170> KoPatentin 3.0 <210> 1 <211> 414 <212> DNA <213> Artificial Sequence <220> SIT1 (Signaling Threshold Regulating Transmembrane Adapter 1, NCBI          sequence ID: XM_005660221) <400> 1 gctgcagaag aggtgatgtg ctataccagt ctgcagctgc ggcctcctca gggccggatc 60 cccagccctg caagccccat caaatactca gaggtggtgc tggactctga gccagagccc 120 caggcttcag gtcctgagcc ggagctctac gcctcagtgt gtgcccagac ccgcagagcc 180 cgggcttcct ttccagacca ggcctacgcc aacagccagc ctgcacccag ctgagatgga 240 gggcctggca cactggggca cgcatctccc ccacctcctc tgttgcaggg gttactgcta 300 ccctgtctga ggtgtgactg ttttccaacc ccccctgaag acaagcagcc attgcccagt 360 cacagggggg gtgttccctt aacttctttt ctgagttgtg accgacccat ctca 414 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> Forward primer for SIT1 (biotin tagged) <400> 2 gctgcagaag aggtgatgtg cta 23 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for SIT1 <400> 3 tgagatgggt cggtcacaac t 21

Claims (10)

(a) performing a polymerase chain reaction (PCR) with a fluorescent probe that binds to a double-stranded nucleic acid using a tagged primer tagged with a sequence complementary to a partial region of the target nucleic acid sequence;
(b) treating the PCR product produced in step (a) to a solid phase on which the capture component to which the tag is attached is integrated at a specific position to induce a binding reaction between the tag and the capture component; And
(c) detecting fluorescence from the solid phase in step (b)
And detecting the target nucleic acid.
The method of claim 1,
(d) determining that the target nucleic acid is present if the fluorescence detection result of step (c) coincides with the position where the capture component is integrated in step (b);
Wherein the method further comprises the step of detecting the target nucleic acid.
The method of claim 1, wherein the binding of the tag and the capture component is selected from the group consisting of a biotin-avidin linkage, a biotin-streptavidin linkage, a biotin-extralavin linkage, a biotin-neutravidin linkage, a benzylguanine- Characterized in that it is due to complementary binding between an enzyme-substrate bond, an antigen-antibody bond, a metal-histidine bond, a metal compound-protein bond, a protein-protein bond or a nucleic acid.
The method of claim 1, wherein the tag is selected from the group consisting of a polynucleotide, a polypeptide, a peptide nucleic acid, a locked nucleic acid, an oligosaccharide, a polysaccharide, an antibody, An antibody mimic, a cell receptor, a ligand, a lipid, a biotin, an avidin, a strepavidin, an extra- Wherein the at least one compound is at least one selected from the group consisting of Extravidin, Neutravidin, Metal and Histidine.
The method of claim 1, wherein the capture component is selected from the group consisting of a polynucleotide, a polypeptide, a peptide nucleic acid, a locked nucleic acid, an oligosaccharide, a polysaccharide, an antibody An antibody mimic, a cell receptor, a ligand, a lipid, a biotin, an avidin, a strepavidin, an antibiotic, Characterized in that it is at least one selected from the group consisting of Extravidin, Neutravidin, Metal and Histidine.
The fluorescent probe according to claim 1, wherein the fluorescent probe that binds to the double-stranded nucleic acid is selected from the group consisting of SYBR green, Picogreen, Evagreen, Hoechst 33258, Hoechst 33342, ethidium bromide, acridine orange, propidium iodide, mithramycin, TO- Lt; RTI ID = 0.0 &gt; YOPRO-1. &Lt; / RTI &gt;
(a) using a tagged primer having a sequence complementary to a region of a disease marker nucleic acid to a nucleic acid sample obtained from a patient's sample, a fluorescent probe that binds to the double-stranded nucleic acid is polymerized Performing an enzyme chain reaction (PCR);
(b) treating the PCR product produced in step (a) to a solid phase on which the capture component to which the tag is attached is integrated at a specific position to induce a binding reaction between the tag and the capture component; And
(c) detecting fluorescence from the solid phase in step (b)
/ RTI &gt; a method for rapid diagnosis of a disease.
8. The method of claim 7,
(d) determining that a disease marker nucleic acid is present if the fluorescence detection result in step (c) matches the position where the capture component is integrated in step (b);
The method further comprising the step of diagnosing the disease.
The method of claim 7, wherein the disease is selected from the group consisting of infectious diseases, cancer, inflammatory diseases, metabolic diseases, neurological diseases, musculoskeletal diseases, digestive system diseases, allergic diseases, immune related diseases, endocrine diseases, cardiovascular diseases, Mechanical diseases and skin diseases. &Lt; RTI ID = 0.0 &gt; 21. &lt; / RTI &gt;
8. The method of claim 7, wherein the disease marker nucleic acid is an internal mutant nucleic acid of a foreign gene or individual from an infectious source.

Images