KR102392567B1 - A composition for chlamydia diagnosis and a multi-isothermal amplification primer set, and a kit with improved speed, accuracy and portability using the same and a visual diagnosis method using the diagnostic kit - Google Patents

Abstract

The present invention relates to a composition for diagnosing chlamydia, a multi-isothermal amplification primer set, a kit with improved speed, accuracy, and portability using the same and a visual diagnosis method through the diagnostic kit. Specifically, by using a composition and a kit including a primer set capable of detecting Chlamydia bacteria, it is possible to detect Chlamydia bacteria more accurately and to quickly and inexpensively diagnose Chlamydia infectious diseases. In addition, by applying the lab-on-paper technology to the primer set, pretreatment, isothermal amplification, detection and analysis of a sample are performed on one chip, and thus, one sample can be applied to easily and quickly diagnose Chlamydia infectious diseases.

Description

A composition for chlamydia diagnosis and a multi-isothermal amplification primer set, and a kit with improved speed, accuracy, and portability using the same, and a visual diagnosis method through a diagnostic kit SPEED, ACCURACY AND PORTABILITY USING THE SAME AND A VISUAL DIAGNOSIS METHOD USING THE DIAGNOSTIC KIT}

The present invention relates to a composition for chlamydia diagnosis, a multi-isothermal amplification primer set, and a kit with improved speed, accuracy and portability using the same, and a visual diagnosis method using the diagnostic kit. Specifically, by using the primer set included in the composition of the present invention, it is possible to detect Chlamydia bacteria with higher accuracy, to quickly and inexpensively diagnose a chlamydia infection, and to apply it to a lab-on-paper-based diagnostic kit.

Chlamydia infection is a common sexually transmitted disease in humans caused by the bacterium Chlamydia trachomatis. Most people who become infected do not develop symptoms, and even if symptoms do develop, it may take several weeks after infection. It appears in the form of non-gonococcal urethritis in men and cervicitis in women.

The disease is one of the most common sexually transmitted diseases worldwide, and it is estimated that around 1 million people are infected in the United States alone. In addition, chlamydial conjunctivitis or trachoma, which are chlamydial infectious diseases, is one of the most common causes of blindness worldwide. According to the World Health Organization (WHO), in 1995 it was estimated at 15% of cases of blindness, but in 2002 it was estimated at only 3.6%.

In the case of women, even if they are carrying bacteria, in most cases, it is difficult to know exactly because there are no symptoms even if they are carrying bacteria, and in fact, about 70% of them are reported to be asymptomatic. Like women, men often have no symptoms at all or even if they do, they are so weak that they are often unaware of it. Untreated in both men and women, it can rarely lead to infertility and, if chlamydia infects the eye, can lead to permanent blindness. Common antibiotics such as erythromycin can be used to treat chlamydia, but since mass infection is possible in the asymptomatic state, confirmation of chlamydia carrier and prompt treatment are recognized as very important.

On the other hand, as a means of confirming the presence of carriers, a diagnostic method using real-time PCR is known as the fastest and most sensitive diagnostic method, and can generally be diagnosed within 8 hours. Currently, molecular diagnostic methods are rapidly developing along with the development of PCR technology and microchannel technology, and products that can detect within 60 minutes, such as Alere TM I from Alere or Cobas Influenza from Roche, are also commercially available. However, in the case of a methodology capable of rapid molecular diagnosis, expensive analysis equipment or expensive examination costs are required, and several steps are required to implement the entire molecular diagnosis process, so there are still limitations to on-site diagnosis.

Currently, the general molecular diagnostic method uses real-time PCR, which is the most common because of its speed, but it is difficult to use easily because it requires large and expensive equipment for on-site diagnosis or use in primary and secondary medical institutions. Molecular diagnosis requires three steps: sample preparation, nucleic acid amplification reaction, and detection. Although the nucleic acid amplification reaction and detection can be reproduced simultaneously by real-time PCR equipment, the sample The problem of preprocessing still remains.

A technology proposed to solve these difficulties is Lab-on-paper. Lab-on-paper technology refers to a technology based on an integrated system that performs sample pretreatment, isothermal amplification, detection, and analysis on a single chip. With small paper and a chip structure planted in the paper, all reactions can be automated and performed quickly, so it has the advantage of being independent of the detection site and other places.

Korean Patent Registration No. 10-2037411 Korean Patent Application Publication No. 10-2021-0018150

An object of the present invention is to provide a primer set for diagnosing chlamydial infectious diseases.

Another object of the present invention is to provide a composition for diagnosing chlamydia infectious disease comprising the primer set.

Another object of the present invention is to provide a kit for diagnosing chlamydial infectious diseases including the primer set.

Another object of the present invention is to provide a method for diagnosing a chlamydial infection from a biological sample using the primer set.

Another object of the present invention is to provide a lab-on-paper-based chlamydia infectious disease diagnostic kit using the primer set.

Another object of the present invention is to provide a lab-on-paper-based chlamydia infectious disease diagnosis system using the primer set.

Another object of the present invention is to provide an information providing method for diagnosing chlamydia infectious disease using the lab-on-paper-based chlamydia infectious disease diagnosis kit.

The terminology used herein is for the purpose of referring to specific embodiments only, and is not intended to limit the invention. As used herein, the singular forms also include the plural forms unless the phrases clearly indicate the opposite. The meaning of "comprising," as used herein, specifies a particular characteristic, region, integer, step, operation, element and/or component, and other specific characteristic, region, integer, step, operation, element, component, and/or group. It does not exclude the existence or addition of

Although not defined otherwise, all terms including technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention belongs. Commonly used terms defined in the dictionary are additionally interpreted as having a meaning consistent with the related technical literature and the presently disclosed content, and unless defined, are not interpreted in an ideal or very formal meaning. Hereinafter, a system according to a preferred embodiment of the present invention will be described with reference to the accompanying drawings. The terminology used herein is for the purpose of referring to specific embodiments only, and is not intended to limit the invention. As used herein, the singular forms also include the plural forms unless the phrases clearly indicate the opposite. The meaning of "comprising," as used herein, specifies a particular characteristic, region, integer, step, operation, element and/or component, and other specific characteristic, region, integer, step, operation, element, component, and/or group. It does not exclude the existence or addition of

Hereinafter, the present invention will be described.

One embodiment for solving the above problems provides a primer set for diagnosing Chlamydia sp. infectious diseases including six primers. The primer set composed of the six primers may be one represented by the nucleotide sequence of SEQ ID NOs: 1 to 6, respectively.

The Chlamydia bacteria may be specifically Chlamydia trachomatis ( C. trachomatis ). Chlamydial infections can include both sexually transmitted infections and eye infections.

The term "primer" refers to a short polynucleotide having a free 3' hydroxyl group, capable of forming a base pair with a complementary template and serving as a starting point for template strand copying. can The primer can initiate DNA synthesis in the presence of a reagent for polymerization (DNA polymerase or reverse transcriptase) and four different deoxynucleoside triphospates (dNTPs) in an appropriate buffer and temperature.

Each primer in the primer set is specific for a gene it targets, wherein the term “gene-specific” or “complementary” means at least 80%, at least 85%, at least 90%, at least 95%, or 100% to the target gene. It may mean that it can form % base pairing.

In the primer set, each primer may consist of or include one of the base sequences of SEQ ID NOs: 1 to 6, and as long as it specifically maintains binding to the genetic material of Chlamydia, SEQ ID NOs: 1 to 6 It may have 80% or more, 90% or more, 95% or more, 97% or more, or 99% or more homology with the base sequence described as The primers can also be adapted to further include additional features to the extent that they do not change their basic properties to act as a starting point for gene synthesis. Accordingly, the primer includes an additional nucleotide sequence of about 1 to 20 bp, 1 to 15 bp, 1 to 10 bp, or 1 to 5 bp while including the nucleotide sequence of each defined SEQ ID NO: 3' end of the primer, It may be further included at the 5' end or within the nucleotide sequence, and if necessary, it may further include a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means at each end or specific base. can

Examples of the label may be a chromogenic enzyme, a fluorescent material, a radioactive isotope, or a colloid. The chromogenic enzyme may be peroxidase, alkaline phosphatase or acid phosphatase, and the fluorescent material is thiourea (FTH), 7-acetoxycoumarin-3-yl, fluorescein-5-yl, fluorescein-6 -yl, 2',7'-dichlorofluorescin-5-yl, 2',7'-dichlorofluorescin-6-yl, dihydro tetramethylrosamine-4-yl, tetramethylrhodamine-5 -yl, tetramethylrhodamine-6-yl, 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-ethyl or 4,4- Difluoro-5,7-diphenyl-4-bora-3a,4a-diaza-s-indacene-3-ethyl, Cy3, Cy5, poly L-lysine-fluorescein isothiocyanate (FITC) , rhodamine-B-isothiocyanate (RITC), PE (Phycoerythrin) or rhodamine, and the radioactive isotope may be 32P, but is not limited thereto.

The primer set of the present invention may be suitable for use for isothermal amplification. The term “isothermal amplification” refers to amplification of DNA under a single temperature condition. Conventional polymerase chain reaction (PCR) involves denaturation, annealing, and extension steps, respectively. Unlike a special PCR device that requires different temperatures and conditions, the isothermal amplification reaction has the advantage that no special equipment is required. can be amplified up to 10^9, and can be carried out only with a constant temperature device capable of maintaining the above temperature.In addition, the isothermal amplification method has a short execution time and the result can be observed with the naked eye, so the amplification can be easily confirmed .

In one embodiment, the isothermal amplification may be loop-mediated isothermal amplification. The term "loop-mediated isothermal amplification (LAMP)" is an amplification method performed isothermal using an outer primer, an inner primer, and an additional loop primer to enhance the reaction rate. Among the primers used in the LAMP reaction, the outer primer consists of two types of a forward outer (F3) primer and a backward outer (B3) primer, and during the non-cyclic step of the reaction, DNA double-stranded serves to release. The inner primer consists of two types: a forward inner primer (FIP) and a backward inner primer (BIP). It consists of the corresponding nucleotides. These internal primers are not included in the genetic material of the strain, but may be designed to further include a specific base, for example, a series of thymine bases in order to increase the efficiency of the reaction. The additional two types of primers consist of two types of a forward loop (LoopF) primer and a backward loop (LoopB) primer, and are attached to a nucleotide sequence (loop region) to which the inner primer does not bind to mediate the ring. Accelerates the isothermal amplification reaction. In the loop-mediated isothermal amplification method, the inner primer is first bound to the template and extended, and then the outer primer is bound to the outside of each DNA helix and extended. At this time, strand displacement occurs due to the extension of the external primer, and accordingly, the synthesized strand falls off the template, and the separated synthetic strand forms a loop structure from the 5' end, and then also at the 3' end. A ring structure is formed in the same process, and an amplification reaction takes place through this.

The isothermal amplification reaction may be performed at 50 to 75 °C, 55 to 75 °C, 60 to 72 °C, 60 to 72 °C, or 63 to 68 °C. In addition, the isothermal amplification method may be performed for 10 minutes to 60 minutes, 10 minutes to 40 minutes, 20 minutes to 40 minutes, or 25 minutes to 35 minutes. When the primer set is used, the Ct value may be 50 or less, 40 or less, or 30 or less.

In one embodiment, since the primer set has a very high detection sensitivity, when the primer set is used, 100 copies or less, 50 copies or less, 20 copies or less, 10 copies or less, 5 copies or less, based on 25 μl reaction solution, Or it is possible to detect Chlamydia bacteria in samples containing target genes such as DNA or RNA of 1 copy or less, 0.1 copies or more, 0.01 copies or more, or 0.001 copies or more. In addition, it is possible to detect Chlamydia bacteria in a short time under general isothermal amplification reaction conditions. For example, to detect Chlamydia, a set of six primers (F3, B3, FIP, BIP, LF, BF) that binds to the target genetic material, Isothermal Amplification buffer, dNTPs, Bst 3.0 DNA polymerase, etc. are included. Using reagents such as LAMP reaction composition, Phenol red for colorimetric analysis, and SYBR™ Green I (Thermo Fisher Scientific, USA) for real-time fluorescence analysis, using 0.2 to 1.6 μM of each primer in the primer set, 63 to 68 The detection result can be confirmed by performing an isothermal amplification reaction at ℃ for 25 to 35 minutes. In the primer set, it may be preferable to use, specifically, 1.6 μM each for the FIP and BIP primers, 0.2 μM each for the F3 and B3 primers, and 0.4 μM each for the FL and BL primers. Since the isothermal amplification reaction should yield results within a short time in a limited environment called isothermal, the combination of primers and each component ratio are important factors to obtain a significant reaction result.

Another embodiment of the present invention includes a composition or kit for diagnosing a chlamydia infection comprising the primer set.

The composition or kit for diagnosing Chlamydia infection may further include an appropriate reactant and reagent for performing an isothermal amplification reaction. Such reactants and reagents may include, for example, additional primers, dNTPs, and enzymes (DNA polymerase or reverse transcriptase), and for the efficiency of the reaction, inorganic salts such as potassium chloride, magnesium sulfate, and ammonium sulfate or It may further include a surfactant. In one embodiment, the reactants and reagents are 10-20 mM Tris-HCl, 1-10 mM (NH ₄ ) ₂ SO ₄ , 10-50 nM KCl, 0.1-2 mM MgSO ₄ , and 0.01-0.1% Tween- based on the final reaction solution 20, more specifically 20 mM Tris-HCl, 10 mM (NH ₄ ) ₂ SO ₄ , 50 nM KCl, 2 mM MgSO ₄ , and 0.1% Tween-20 may be a solution of pH 7 to 9, preferably pH 8.8 . The reactant or reagent may further include 40 mM to 50 mM sucrose, 0.001 to 0.01% Triton X-100, and 0.1w/w% to 0.3w/w% glycerol. Trehalose may be used instead of the sucrose. The combination of sucrose, Triton X-100, and glycerol helps to maintain reaction efficiency by increasing storage stability of the chlamydia diagnostic composition and kit.

In one embodiment, the composition or kit for diagnosing chlamydial infectious disease includes a reagent such as a material for colorimetric analysis, a material for fluorescence analysis, or a labeling compound for detection in order to increase the convenience of detection and clarity of result analysis and to visually confirm the reaction result. may include more. As such reagents, commonly known or commercially available reagents may be used, for example, but not limited to, WarmStart® LAMP Mix. Such a reagent may include Tris-HCl, (NH ₄ ) ₂ SO ₄ , KCl, MgSO ₄ , and Tween-20 as mentioned above, in order for the reaction to occur efficiently, DNA polymerase, reverse transcription It may further include an enzyme for performing an amplification reaction, such as an enzyme. For colorimetric analysis, Simpliamp ^TM Thermal Cycler/QuantStudio ^TM 3 may be used, and for fluorescence analysis, CFX96 ^TM may be used, but is not limited thereto. In addition, as a method of confirming the detection result of the composition or kit for diagnosing the chlamydia infection, there are electrophoresis, radioactive measurement using a detection label, etc., but is not limited thereto. For colorimetric analysis, a conventional PCR device (Thermocycler) can be used, and for fluorescence analysis, a real-time PCR device capable of detecting a fluorescence material used for analysis can be used.

The composition or kit for diagnosing Chlamydia infection may further include a negative control material or a positive control material in order to accurately read the diagnosis result. As a negative control material, template RNA or DNA of another strain unrelated to Chlamydia can be used, and as a positive control material, a biological sample obtained from a patient infected with Chlamydia or a template RNA or DNA corresponding to a part of the genome of Chlamydia. is available. These control substances can be applied to the gene amplification reaction together with the biological sample or individually in one tube as needed.

Another embodiment of the present invention comprises the steps of: mixing the primer set or a composition comprising the primer set and a biological sample; And it provides a method for diagnosing a chlamydia infection comprising the step of amplifying the gene by performing an isothermal amplification reaction of the mixture. In addition, the method for diagnosing the chlamydial infection may further include colorimetric analysis or fluorescence analysis.

The biological sample is obtained from the subject to be tested, obtained through swabs or nasal lavage from the nasopharynx or oropharynx, bronchial lavage or aspirate, intertracheal aspirate and bronchial biopsy, sputum, bronchoalveolar lavage , saliva, blood, urine, feces, sweat, etc. can be used.

The biological sample may be pre-treated to increase the efficiency of the amplification reaction. Pretreatment may be a 10-fold, 50-fold, 100-fold, 200-fold, or 400-fold dilution with water, and may be a heat treatment after treatment with protenase K, anion exchange chromatography, affinity chromatography, size exclusion chromatography, Genes may be extracted or purified to a certain level from a biological sample using commonly known methods such as liquid chromatography, continuous extraction, centrifugation, or gel electrophoresis, or using commercially available kits. The pretreatment is 50mM Tris-HCl (pH8.0), 150mM NaCl, 5mM EDTA, and lysis buffer containing 1% NP-40, Brij-35 0.1% ~ 0.5w / w%, Tris-HCl 10mM ~ 300mM ( pH7.0 to 8.0), and CaCl ₂ 1 mM to 10 mM, specifically Brij-35 0.3w/w%, Tris-HCl 100 mM (pH7.5), and CaCl ₂ 5 mM It may mean that, specifically, it may mean that only the gene is obtained from the sample by treatment with the solution and then purification by a conventional method. The combination of the pretreatment solution allows the gene to be easily extracted from the sample and can enhance the isothermal amplification reaction efficiency of the primer set of the present invention.

The method for diagnosing chlamydia infectious disease includes detecting the amplified gene. The detection of the amplification product can be performed by fluorescence measurement using a fluorescent substance such as SYBR Green I or a fluorescent marker, color change of an indicator such as phenol red, turbidity, precipitate generation, DNA laddering, capillary electrophoresis, DNA chip, gel electrophoresis, It may be performed through radiometric measurement or phosphorescence measurement, but is not limited thereto.

The kit of the present invention may further include a container containing each reaction reagent, a tool for use in a test, and a user's guide describing optimal conditions for performing the reaction.

Another embodiment of the present invention provides a lab-on-paper-based chlamydia infectious disease diagnostic kit comprising the primer set.

Also, another embodiment of the present invention provides a lab-on-paper-based chlamydia infectious disease diagnosis system including the primer set.

In addition, another embodiment of the present invention provides a method for providing information for diagnosing chlamydia infectious disease using the lab-on-paper-based chlamydia infectious disease diagnosis kit.

If a lab-on-paper chip technology is applied to the primer set, the nucleic acid material is purified while moving to the reaction pad without further purification of the nucleic acid and can be directly applied to the amplification reaction, and a single sample is applied. Thus, it is possible to simultaneously detect multiple target nucleic acids and diagnose related diseases. In order to realize this, the lab-on-paper-based chlamydia infectious disease diagnostic kit and system include a sample pad 120, a buffer pad 121, a first connection pad 131, an initiator pad 132, a reaction pad 140, The heating pad 141 , the blocking pad 142 , the second connection pad 150 , the detection pad 160 , the absorption pad 170 , and the housing structure 110 are included as components.

Specifically, a sample pad for receiving a biological sample; a buffer pad disposed separately from the sample pad and accommodating a rehydration buffer; a first connection pad disposed on the sample pad and connecting the sample pad and the reaction pad; an initiator pad disposed on the buffer pad and connecting the buffer pad and the reaction pad; A primer set specific for Chlamydia according to an embodiment of the present invention, which is disposed under the first connection pad and the initiator pad, capable of specifically binding to a target nucleic acid, and a reagent for an isothermal amplification reaction (LAMP) Including, a reaction pad in which the isothermal amplification reaction occurs; a second connection pad disposed on the reaction pad and carrying the isothermal amplification reactant; a detection pad disposed under the second connection pad and configured to obtain a target nucleic acid amplified from the isothermal amplification reaction product; and an absorption pad disposed on the side of the detection pad and absorbing the remaining sample, and a heating pad disposed under the sample pad, the initiator pad, the reaction pad, and the second connection pad. A diagnostic construct is provided.

In another embodiment, when the structure for diagnosing Chlamydia infection is based on a colorimetric diagnostic method, the structure may include a sample pad for accommodating a biological sample; a buffer pad disposed separately from the sample pad and accommodating a rehydration buffer; a first connection pad disposed on the sample pad and connecting the sample pad and the reaction pad; an initiator pad disposed on the buffer pad and connecting the buffer pad and the reaction pad; a reaction pad disposed under the first connection pad and the initiator pad, comprising a primer capable of specifically binding to a target nucleic acid, and a reagent for an isothermal amplification reaction (LAMP), in which an isothermal amplification reaction occurs; a blocking pad disposed on the reaction pad and configured to maintain a reaction temperature and block evaporation of the sample; a second connection pad disposed on the reaction pad and having gold nanoparticles fixed thereon; a detection pad disposed under the second connection pad and configured to obtain a target nucleic acid amplified from the isothermal amplification reaction product bound to the gold nanoparticles; and an absorption pad disposed on a side of the detection pad to absorb a residual sample, and a heating pad disposed under the sample pad, the initiator pad, the reaction pad, and the second connection pad. In this case, the gold nanoparticles may include streptavidin on the surface.

A system for diagnosing a chlamydial infection includes the structure; a recognition unit disposed on the detection pad, acquiring a fluorescence image from the detection pad, and measuring fluorescence intensity; and an output unit for deriving a significance value using the fluorescence intensity value measured from the recognition unit, and outputting whether or not a disease, virus, or fungal infection is present from the significance value. In case of application to the system, any one of the six forward and reverse primers in the primer set specific for Chlamydia may be labeled with a fluorescent marker.

In one embodiment, the sample pad, the first connection pad, the buffer pad and the initiator pad; reaction pad; a second connection pad; detection pad; And the absorbent pad may be arranged laterally in contact with at least a portion in sequence.

In one embodiment, the sample pad, the first connection pad, the buffer pad, the initiator pad, the reaction pad, the second connection pad, the detection pad, and the absorption pad may be surrounded by a housing structure.

In one embodiment, the reaction pad may have a blocking pad disposed thereon.

In one embodiment, the detection pad may include a plurality of divided wells.

In one embodiment, the sample applied to the sample pad may move laterally to the absorbent pad.

In one aspect, applying a biological sample to the sample pad of the kit or system for diagnosing Chlamydia infection, amplifying the target nucleic acid by isothermal amplification; obtaining a fluorescence image from the amplified target nucleic acid and measuring fluorescence intensity; Determining a significance value using the measured fluorescence intensity value of each target nucleic acid; And outputting whether or not Chlamydia infection from the significance value of each target nucleic acid, provides an information providing method for diagnosing Chlamydia infection.

Hereinafter, each component will be described in detail.

sample pad

The sample pad 120 accommodates a sample containing a nucleic acid material. The sample is isolated from the human body and includes, but is not limited to, blood, serum, plasma, saliva, sweat, urine, cell culture solution, tissue suspension, and the like. The sample may be mixed with a cell lysis buffer, and if necessary, after mixing with the cell lysis buffer, it may be further purified by commonly known methods such as centrifugation, filtration, and precipitation. Preferably, after the sample is mixed with a cell lysis buffer, the step of purifying for application to the sample pad outside the structure for detecting nucleic acids is not included.

The cell lysis buffer (Lysis buffer) may be one containing Tris (tris (hydroxymethyl) aminomethane) in an amount of 5 mM to 80 mM, 5 mM to 50 mM, or 10 mM to 50 mM . Tris may specifically be Tris-HCl, and as a buffer in a buffer for cell lysis, it is possible to reduce abrupt pH fluctuations.

The cell lysis buffer may have a pH of 8.0 to 9.0. If the pH is less than 8.0, the stability of the nucleic acid material may be reduced or the transfer rate may be reduced.

The cell lysis buffer may contain potassium chloride (KCl) in an amount of 5 mM to 50 mM, 5 mM to 40 mM, or 10 mM to 20 mM. A high concentration of potassium chloride exceeding 50 mM is helpful for cell lysis, but may reduce the aqueous solubility of the eluted nucleic acid material, so that a large amount of addition buffer must be added or the time taken to move to the reaction pad may increase. On the other hand, if potassium chloride is less than 5 mM, cells may not be lysed properly.

The cell lysis buffer may contain magnesium sulfate (MgSO ₄ ) in an amount of 1 mM to 30 mM, 1 mM to 20 mM, or 2 mM to 16 mM. When magnesium sulfate is included in an appropriate amount, it has been confirmed that the stability and movement speed of the nucleic acid material increase, and since it does not affect the viscosity, it does not interfere with the flow of the fluid, which is advantageous for pre-treatment of samples for paper chip analysis.

The cell lysis buffer may contain ammonium sulfate ((NH ₄ ) ₂ SO ₄ ) in an amount of 5 mM to 50 mM, 5 mM to 40 mM, or 10 mM to 20 mM. A high concentration of ammonium sulfate exceeding 50 mM may precipitate cell lysates, and pH may become unstable when ammonium sulfate is less than 5 mM.

The cell lysis buffer may be one containing a protease from 0.01 mg/ml to 0.1 mg/ml, or from 0.03 mg/ml to 0.07 mg/ml. The protease decomposes the high molecular protein so that the high molecular protein does not block the pores of the substrate or paper through which the nucleic acid moves, and increases the stability of the nucleic acid material by inhibiting the RNase and DNase activity. The protease may be proteinase K (proteinase K).

The surfactant may be TritonX-100 or Tween20 (polysorbate 20), 0.01w/w% to 0.2w/w%, preferably 0.05w/w% to 0.1w based on the weight of the buffer for cell lysis It can be included as /w%.

The cell lysis buffer may be used in a 1:1 ratio to the volume of the sample.

The cell lysis buffer may not contain glycerol. Glycerol is sometimes added to prevent protein precipitation, but glycerol increases viscosity to decrease fluidity of cell lysates, and may interfere with the movement of nucleic acid substances.

The cell lysis buffer may not contain a reducing agent. Reducing agents, such as dithiothreitol (DTT) and mercaptoethanol, help to denaturate proteins and increase the aqueous solubility of cell lysates, but when present in the solution flowing into the paper chip, they do not interfere with fluorescence or detection reaction. can be

and a heating pad 141 disposed under the sample pad and configured to heat the sample pad. In order to efficiently dissolve the sample by the cell lysis buffer, the heating pad is heated at a temperature of 60 to 80° C. for 1 to 5 minutes, preferably for 5 minutes, thereby removing viruses, strains, or cells from the sample pad. It promotes dissolution of the containing sample.

When the composition for cell lysis is applied, cell lysis is promoted in the sample pad 120 made of a polysulfone membrane (eg, Vivid GF) or a nitrocellulose membrane, and nucleic acids can be more easily detected. The polysulfone membrane and the nitrocellulose membrane may have a structure in which two or more are stacked. The polysulfone membrane may be asymmetric, and the polysulfone membrane and the nitrocellulose membrane may be made of a porous material having pores of 0.5 μm to 1 μm. It is advantageous that the pores are rather large, and many biological samples have a viscosity. In particular, when the sample is treated with a composition for cell lysis, the viscosity may increase significantly as the nucleic acid material and protein are eluted out of the cell. Therefore, it is preferable that the pore size of the sample pad has a size suitable for rapidly absorbing the sample.

By using the cell lysis buffer, nucleic acids can be more easily detected in a lateral flow manner. The term “lateral flow type” refers to a method in which a sample flows from an applied point to a target point by capillary or diffusion in the horizontal direction without using gravity. Since the cell lysate contains a large amount of hydrolytic enzymes capable of degrading the nucleic acid material, the yield of the nucleic acid material may decrease if it stays in the migration path for a long time. Therefore, in order to be applied to a lateral flow nucleic acid detection construct, the flow chart should be excellent and the cell lysate should not be precipitated to block the migration path while the sample is moving. In addition, it should not form a salt with a nucleic acid material to decrease precipitation or movement speed. The composition of the cell lysis buffer of the present invention does not include glycerol or a reducing agent, but does not precipitate cell lysate or nucleic acid material, and can move nucleic acid material laterally to the reaction pad in a high yield.

first connection pad

The first connection pad 131 is disposed on the sample pad in partial contact with the sample pad, and connects the sample pad and the reaction pad with a structure having a relatively narrow width compared to the sample pad.

The first connection pad is a material made of a cellulose film, and may have pores of 0.005 μm to 0.015 μm.

buffer pad

The buffer pad 121 is a pad for dropwise adding a rehydration buffer, and serves to apply water pressure to the structure. The buffer pad may be disposed separately from the sample pad in order to minimize movement of cell lysis debris such as protein to the reaction pad and to induce movement of only the isothermal amplification reactant to the detection pad by applying water pressure after the reaction is completed.

The rehydration buffer applied to the buffer pad is an addition buffer, for example, 5 mM to 80 mM Tris-HCl, 20 mM to 70 mM potassium chloride, 0.5 mM to 5 mM magnesium sulfate, 1 mM to 30 mM ammonium sulfate, and 0.01 It may be an isothermal buffer or phosphate buffer (50 mM Na ₂ HPO ₄ , pH 7.2) containing w/w% to 0.2 w/w% Tween® 20 to TritonX-100 and having an acidity of pH 8.0 to 9.0. The isothermal buffer may more specifically include 20 mM Tris-HCl, 10 mM (NH ₄ ) ₂ SO ₄ , 50 mM KCl, 2 mM MgSO ₄ , and 0.1% Tween® 20, and the acidity may be pH 8.8. The addition buffer may not contain a protease, glycerol, or a reducing agent.

The buffer pad is a porous material having pores of 0.5 μm to 1 μm to sufficiently receive the rehydration buffer, and includes cotton, wool, paper, nitrocellulose, cellulose acetate, glass fiber, polysulfone, polyacrylic, polynitrile, polypiperazine, polyamide, polyethersulfone, polyvinylidenefluoride, polyethyleneimine, polydimethylsiloxane or mixtures thereof.

initiator pad

The initiator pad 132 is disposed on the buffer pad in partial contact with the buffer pad, and connects the buffer pad and the reaction pad with a structure having a relatively narrow width compared to the buffer pad.

The initiator pad is a material made of a cellulose film, and may have pores of 0.005 μm to 0.015 μm. A portion of the initiator pad in contact with the buffer pad or the reaction pad may be coated with low melting point agarose or wax. The coating can accelerate lateral flow by blocking back flow to the buffer pad.

A heating pad 141 for heating may be disposed under the initiator pad. When an additional buffer is added to the buffer pad while heating the initiator pad at the end of the isothermal amplification, the low-melting agarose or wax of the initiator pad melts and water pressure is generated in the reaction pad, so that the isothermal amplification result can be easily transferred to the detection pad. make it move The heating may be performed at 60 to 80 ℃.

reaction pad

The reaction pad is a component corresponding to the paper chip in the lab-on-paper, and isothermal amplification reagent including dNTP, DNA polymerase, reverse transcriptase, fluorescent marker, isothermal amplification reaction buffer, etc. for the amplification reaction is fixed. Therefore, the solution containing the nucleic acid material is soaked into the reaction pad by the addition buffer applied to the sample pad, and the contact material between the isothermal amplification reagent and the sample moves to the reaction pad and is heated by the heating pad under the reaction pad. When heated to 60 to 70 ℃ isothermal amplification reaction or reverse transcription isothermal amplification reaction occurs.

The isothermal amplification reaction reagent may specifically include dNTP, isothermal amplification buffer, and reverse transcription / DNA / RNA polymerase, etc., which are mixed in the reaction pad and dried, or applied to the surface of the reaction pad in a powder type, for example , may be fixed by heating in an oven at about 40 ° C for about 30 minutes.

The reaction pad 140 may partially contact the first connection pad and the initiator pad, and may be disposed below and to the side of the first connection pad and the initiator pad. A heating pad 141 may be disposed under the reaction pad 140 to heat it to a temperature at which an isothermal amplification reaction can occur. The heating pad may include a heating wire or a heating plate for heating. The reaction temperature and time in the reaction pad can be adjusted according to the amplification efficiency of the primer set.

In the reaction pad, a blocking pad 142 is disposed on the reaction pad to increase the efficiency of the isothermal amplification reaction, so that it may play a blocking role. It is possible to increase the efficiency of the reaction by maintaining the isothermal amplification reaction temperature and blocking the evaporation of reagents by a blocking pad laminated with a series of arranged pads. The blocking pad may be a non-porous membrane or a structure capable of blocking the reaction pad from external air.

A plurality of wells exist in the reaction pad, and wells exist in the reaction pad as a primer set for the isothermal amplification reaction in each well, so that the isothermal amplification reaction can occur more intensively. Specifically, the well may have a hydrogel layer formed at the bottom, and the primer set may be fixed to the hydrogel layer. For intensive amplification of a specific target nucleic acid, a set of primers specifically binding to different target nucleic acids may be immobilized in each well.

The hydrogel layer containing the primer may be formed, for example, by the following method. UV-photocrosslinkable poly(ethylene glycol) diacrylate (PEGDA, Sigma-Aldrich, MW700) 20% v/v, poly(ethylene glycol) (PEG, Sigma-Aldrich, MW600) 40 by total volume of hydrogel solution % v/v and photoinitiator 2-hydroxy-2-methylpropiophenone (Sigma-Aldrich) 5% v/v and buffer (PBS buffer, pH7.5) 35%, mixed with a primer set Prepare a hydrogel solution. The poly(ethylene glycol) is preferably included in order to increase the porosity of the hydrogel microparticles. Then, the hydrogel solution is applied to the inner surface of each well of the reaction pad, and UV exposure (360 nm wavelength, 35 mJ/cm ² ) for 1 minute to form a hydrogel coating layer. Since the hydrogel layer has pores, it binds to the primers in the hydrogel layer and the amplification reaction can occur intensively within the pores.

Any one of the forward and reverse primers in the primer set is Cy3, Cy5, TAMRA, TEX, TYE, HEX, FAM, TET, JOE, MAX, ROX, VIC, Cy3.5, Texas Red, Cy5.5, TYE, It may be labeled with one or more detectors selected from the group consisting of BHQ, Iowa Black RQ, and IRDye. The detector may serve as a fluorescent marker, and in order to independently detect the target nucleic acid, it may be labeled differently for each target nucleic acid.

In the primer set, any one of the forward and reverse primers may be biotin-bound. When the diagnostic construct is based on fluorescence analysis, biotin can bind to streptavidin immobilized on the surface of the detection unit, and thus finally binds to streptavidin on the detection pad and captures, then the fluorescence detection result is visualized. Biotin may be designed to exist at positions opposite to the fluorescent marker in the amplified target nucleic acid. For example, when the fluorescent marker is bound to the 5' end of the forward primer, biotin may be bound to the 5' end of the reverse primer. can

When the diagnostic construct is based on colorimetric diagnostics, biotin bound to the other of the forward and reverse primers in the primer set can bind to streptavidin, so it exists in a form bound to the amplified target nucleic acid. As it passes through the second connection pad, it binds to streptavidin on the surface of the gold particle and is captured by the detection pad, so that the detection result is visualized.

The reaction pad may have a pore size of 0.001 μm to 0.005 μm, preferably 0.005 μm, so that the nucleic acid can sufficiently react while allowing the flow of the sample and the addition buffer to be free.

The reaction pad is made of a material of a cellulose acetate membrane, and has a pore size of 0.001 μm to 0.005 μm, preferably, 0.005 μm so that the nucleic acid can sufficiently react while allowing the flow of the sample and the addition buffer to be free. may have

The reaction pad may contain 40 mM to 50 mM sucrose, 0.001 to 0.01% Triton X-100, and 0.1w/w% to 0.3w/w% glycerol. Instead of the sucrose, trehalose may be used. This can increase the storage stability of the isothermal amplification reagent and primer set when exposed to moisture or oxygen. The storage stability may mean that it can be stored for 3 weeks or more without decomposition or by-products at 25°C to 30°C.

second connection pad

The second connection pad 150 may be disposed above and laterally on the detection pad in partial contact with the reaction pad. The second connection pad 150 moves the nucleic acid amplified from the reaction pad to the detection pad. The second connection pad is made of cotton, wool, paper, nitrocellulose, glass fiber, polysulfone, polyacryl, polynitrile, polypiperazine, polyamide, polyethersulfone, poly As a porous material that is vinylidene fluoride, polyethyleneimine, polydimethylsiloxane or a mixture thereof, it may be a porous material having a pore size of 0.01 μm to 0.05 μm, preferably, 0.05 μm.

When the diagnostic structure is based on a colorimetric diagnostic method, the second connection pad 150 may partially contact the reaction pad and be disposed above and laterally on the reaction pad. The second connection pad 150 includes gold nanoparticles, and the gold nanoparticles bind to the nucleic acid amplified in the reaction pad and move to the detection pad. The gold nanoparticles may preferably have streptavidin immobilized on the surface.

The connection pad is disposed on the reaction pad and connects the reaction pad and the detection pad with a structure having a relatively narrow width compared to the reaction pad or the detection pad.

The second connection pad may be made of a cellulose material, and the second connection pad at a portion in contact with the reaction pad may be coated with low melting point agarose or wax. When the pad is coated, the movement of the isothermal amplification reactant of the reaction pad is blocked, but when the second connection pad is heated, the coating melts and the isothermal amplification reactant moves laterally again, thereby preventing the loss of unreacted dielectric material in the sample. .

A heating pad 141 for heating may be disposed under the second connection pad. When the addition buffer is added at the end of the isothermal amplification, the result of the isothermal amplification from the reaction pad is easily transferred to the detection pad. The heating may be performed at 60 to 80° C. for 1 minute to 5 minutes, preferably for 2 minutes.

detection pad

The detection pad 160 may partially contact the second connection pad and be disposed below and on the side of the second connection pad. A receptor capable of binding to a detector is fixed to the detection pad 160 . The receptor may be an antibody, protein, or fragment thereof capable of specifically binding to a detector.

The detection pad may include a plurality of detection zones, and the detection zones may be divided into lines or wells. In each detection zone, each receptor is independently fixed, for example, by stamping with an ink of polyethylene phthalate component to make a detection zone, and then stamping again with ink containing the receptor or, in the case of a well, a solution containing the receptor EDC (1-Ethyl-3- [3-dimethylaminopropyl] carbodiimide) or NHS (N-hydroxysulfosuccinimide) can be applied. Dozens to hundreds of detection zones are formed in one reaction pad, and target nucleic acids as many as the number of detection zones formed by applying a single sample can be detected. 5 is for explaining in detail the structure of the detection zone formed on the reaction pad, and is not meant to limit the number.

The detection pad is nitrocellulose, and may have a pore size of 0.001 μm to 0.005 μm, preferably 0.005 μm, so that the sample can move laterally to the absorption pad.

heating pad

A heating pad 141 may be disposed under the sample pad, the initiator pad, the reaction pad, and the second connection pad. The heating pad is a metal plate having thermal conductivity, and may be made of a material such as iron, stainless steel, aluminum, silver, or copper. The heating pad may be connected with a heating wire, and each heating wire may be independently connected to a heating pad under the sample pad, the reaction pad, the initiator pad, and the second connection pad to control the heating pad.

The sample pad, the first connection pad, the initiator pad, the reaction pad, the second connection pad, the detection pad, and the absorption pad may have a housing 110 at the bottom so that the sample or buffer is not lost, and the entire structure is a support. Alternatively, it may be surrounded by a case made of a non-porous material.

The absorbent pad absorbs the sample and buffer, thereby blocking the reverse flow and contributing to induce lateral fluidity. The absorbent pad is a porous material. Cotton, wool, paper, nitrocellulose, cellulose acetate, glass fiber, polysulfone, polyacrylic, polynitrile, polypiperazine, polyamide, polyethersulfone, polyvinylidene fluoride, polyethyleneimine , polydimethylsiloxane, or a mixture thereof. The absorbent pad is preferably glass fiber and may have a pore size of 0.1 to 0.5 μm.

the sample pad, the first connection pad, the buffer pad, and the initiator pad; reaction pad; a second connection pad; detection pad; and the absorbent pad are sequentially disposed laterally in partial contact with each other. Specifically, the sample pad, the first connection pad, the buffer pad, and the initiator pad are separated from the reaction pad and disposed on one side of the reaction pad, and the second connection pad, the detection pad, and Absorbent pads are sequentially disposed.

While the sample reaches the absorption pad, the nucleic acid material can be purified by filtering the cell lysate in addition to the nucleic acid material, and the lateral fluidity of the sample moving in a direction parallel to the ground can be realized. In cells, nucleic acids exist in the form of binding proteins such as histones, polymerases, nucleases, and transcription factors. Many proteins lose their binding to nucleic acids by a surfactant such as a cell lysis composition, but by the time they reach the reaction pad by distilled water or additional buffer added so that the cell lysate can move to the reaction pad, the surfactant is diluted so that the external environment can restore the protein's charge. In this case, the protein may bind to the nucleic acid material again to reduce the contact area with the polymerase or interfere with the amplification reaction. Therefore, it is preferable that most of the cell components capable of binding to nucleic acids are purified and removed from the reaction pad.

recognition unit

The recognition unit 200 acquires a fluorescence image from the detection pad and measures fluorescence intensity from the acquired fluorescence image. The fluorescence intensity may be calculated as a ratio of an actual measured value based on a maximum measurable value, and in order to excite a plurality of fluorescent markers and recognize a fluorescence image, a light source in various wavelength bands, for example, 400 to 700 λ wavelength band, and It may include a filter for selective acquisition of each excitation light. The recognition unit independently recognizes a plurality of detection zones formed on the reaction pad, calculates the fluorescence intensity of each detection zone, and transmits "the difference between the fluorescence intensity value measured in the corresponding detection zone and the fluorescence intensity value of the negative control group" to the output part .

output

The output unit 210 derives a significance value by using the difference in the fluorescence intensity values transmitted from the recognition unit 200 . As for the significance value, the maximum measurable value in the recognition unit is set to 1, and when the difference in fluorescence intensity is 0.3 or more, the significance value is output as "positive for the target nucleic acid of the corresponding detection area with a probability of 70% or more", and fluorescence When the difference between the intensity values is 0.5 or more, the significance value may be output as "positive with a probability of 90% or more for the target nucleic acid of the corresponding detection zone". The output unit finds a disease, virus or fungal infection symptom related to a positively output target nucleic acid using the derived significance value based on big data including genetic information related to disease, virus or fungal infection, and finally It enables the diagnosis of disease, viral or fungal infection of the subject from which the sample was obtained. When the difference between the fluorescence intensity values is less than 0.3, the significance value may be output as “negative”.

The target nucleic acid may be related to a disease, virus or fungal infection symptom already known when the primer set is produced. As another example, after preparing a reaction pad by randomly applying a commercially available or commercially available primer set , after deriving the significance value obtained from the sample based on big data, it is possible to match the nucleotide sequence to which the corresponding primer set specifically binds and the symptoms of a related disease, virus, or fungal infection.

Big data can be obtained from publicly available biological databases, and in the case of nucleotide sequences, there are Genebank, EMBL (The European Molecular Biology Laboratory), DDBJ (DNA Data Bank of Japan), etc. , KEGG (Kyoto Encyclopedia of Genes and Genomes), and WikiPathways as metabolic circuit databases, but are not limited thereto.

Hereinafter, a method for detecting a nucleic acid using the nucleic acid detection structure will be described.

The sample to be detected for nucleic acid may include mixing the sample with a cell lysis buffer before application to the sample pad. When mixed with the cell lysis buffer, the nucleic acid material present in the cell may be eluted, thereby increasing the amount of detectable nucleic acid material in the sample.

5 mM to 80 mM Tris-HCl, potassium chloride 5 mM to 50 mM, magnesium sulfate 1 mM to 30 mM, ammonium sulfate 5 mM to 50 mM, protease 0.01 mg/ml to 0.1 mg/ml, TritonX- 100 or Tween20 0.01w/w% to 0.2w/w%, a cell lysate mixed with a cell lysis buffer having a pH of 8.0 to 9.0 is added dropwise, and by operating a heating pad below the sample pad for heating the sample pad Increase the efficiency of sample dissolution. By heating the heating pad under the sample pad at a temperature of 60 to 80° C. for 2 minutes, dissolution of the sample including strains, viruses, and cells is promoted in the sample pad.

Buffer can also be added to the buffer pad. The buffer serves to purify the nucleic acid material while allowing the nucleic acid material to move to the reaction pad. The buffer serves to purify the nucleic acid material while allowing the nucleic acid material to move to the detection pad. Since the buffer contains an appropriate amount of the buffer component, it is possible to prevent precipitation of protein or nucleic acid material due to abrupt salinity or pH change that may occur when distilled water is added. Each pad of the nucleic acid detection structure of the present invention is made of a porous material having small pores so that the nucleic acid can be purified while moving laterally. Therefore, if the protein or nucleic acid material is complexed or aggregated to block the pores, the sample movement speed may decrease and the yield of the nucleic acid material may decrease.

The addition buffer may be, for example, 5 mM to 80 mM Tris-HCl, 20 mM to 70 mM potassium chloride, 0.5 mM to 5 mM magnesium sulfate, 1 mM to 30 mM ammonium sulfate, and 0.01 w/w% to 0.2 w/w % Tween® 20 to TritonX-100 and may be an isothermal buffer having an acidity of pH 8.0 to 9.0 or a phosphate buffer (50 mM Na ₂ HPO ₄ , pH 7.2). The isothermal buffer may more specifically include 20 mM Tris-HCl, 10 mM (NH ₄ ) ₂ SO ₄ , 50 mM KCl, 2 mM MgSO ₄ , and 0.1% Tween® 20, and the acidity may be pH 8.8. The addition buffer may not contain a protease, glycerol, or a reducing agent.

Chlamydia infection can be specifically detected using the primer set of the present invention, and rapid and accurate on-site detection is possible using an isothermal amplification reaction.

In addition, the isothermal amplification reaction does not require expensive equipment and professional manpower required to meet a specific temperature and condition for performing the amplification reaction, so it can be performed efficiently and at a low cost, so a large number of test subjects can be diagnosed early. can do.

In addition, when the primer set of the present invention is applied to a lab-on-paper-based kit, the sample preparation, nucleic acid amplification reaction, and detection are not separately performed, and the sample can be detected by one application. can be done at once. Since each step is not separately performed, the entire process is simplified, and various samples or devices are not required, and it can be easily performed even by non-technical technicians.

1 is an illustration of the overall structure of the structure for detecting multiple nucleic acids of the present invention and the result when using a sample from a patient infected with Chlamydia.
2 is a schematic diagram of the principle of obtaining a target nucleic acid on the detection pad 160 . 2A is a case based on fluorescence analysis, and FIG. 2B is an example based on colorimetric analysis.
3 is a side structural diagram of a structure for detecting multiple nucleic acids of the present invention. In the case of fluorescence-based analysis, the recognition unit 200 and the output unit 210 may be further included.
4 is a perspective view of a structure for detecting multiple nucleic acids of the present invention.
5 is an enlarged structural diagram of the detection pad 160 .
6 is an illustration showing the appearance of a structure for detecting multiple nucleic acids of the present invention surrounded by a case.
7 is an example showing the detection result of Chlamydia bacteria in the case of colorimetric diagnosis with a blood sample.

Hereinafter, examples and the like will be described in detail to help the understanding of the present invention. However, the embodiments according to the present invention may be modified in various other forms, and the scope of the present invention should not be construed as being limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

Preparation Example 1: Primer Preparation

A primer was designed and manufactured to detect Chlamydia bacteria using loop-mediated isothermal amplification (LAMP). In order to obtain a primer set candidate group, the genetic information of Chlamydia was confirmed through blast analysis, and sequences expected to have the highest efficiency among them were derived in the upper order. Specifically, the entire nucleotide sequence of each type of Chlamydia was obtained from GenBank (National Center for Biotechnology Information, NC_000117.1), and the purified DNA standard of Chlamydia (C. trachomatis) was prepared by ATCC (American Type Culture Collection, USA). ), and a primer for specifically amplifying the gene of the Chlamydia pathogen was designed using the Primer Explorer V5 program of the Eiken website (http://primerexplorer.jp/e/). Primers for specific amplification were identified using NCBI's basic local alignment search tool (BLAST), and all designed primers were synthesized from Bionics.

The selected candidate group was a set of 5, and the primer candidate group included an external primer, an internal primer, and a loop primer, and 4 thymines were included in the FIP primer and the BIP primer to promote loop formation and speed up the reaction.

Test Example 1: Selection of a primer set

The following tests were performed on the primer set candidates derived in Preparation Example 1 to finally select a primer set.

(1) Isothermal amplification reaction

The reverse transcription loop-mediated isothermal amplification reaction was performed using a reaction solution in which the following solution was mixed in a 25 μl PCR tube; 1 μl each of the forward and backward outer primers (F3 and B3, 0.2 μM), 1 μl each of the inner primers (FIP and BIP, 1.6 μM), and loop primer: LF and LB, 0.4 μM) 1 μl each, 2X isothermal amplification reaction solution 12.5 μl, SYBR Green I (25X) or Phenol red (250 μM) 1 μl, purified water (DW) 3.5 μl, and purified DNA standard solution 2.0 In terms of μl, a LAMP reaction mixture was prepared in 25 μl for each reaction.

2X Master Mix (isothermal amplification reaction solution) was prepared and used by our company. Based on the final reaction solution, 20mM Tris-HCl, 10mM (NH ₄ ) ₂ SO ₄ , 50nM KCl, 2mM MgSO ₄ , and 0.1% Tween-20, pH 8.8 becomes this Bst 3.0 DNA polymerase and dNTPs were purchased from New England Biolabs (USA). Phenol red, a reagent for colorimetric analysis, was purchased from Sigma-Aldrich (USA), and SYBR™ Green I, a fluorescent dye, was purchased from Thermo Fisher Scientific (USA). Distilled water added to the preparation of the reaction solution and the reaction was produced and used through an ultrapure water manufacturing device (New-P.NIX® Power, Daehan Science, Korea).

Purified water was used as a negative control, and the LAMP reaction was performed using Simpliamp ^TM Thermal Cycler (colorimetric analysis)/QuantStudio ^TM 3 and CFX96 ^TM (fluorescence analysis) at a temperature of 65° C. for 30 minutes. DNA concentration was measured using a spectrophotometer (Epoch, Agilent Biotek, USA), and the instruments used for the isothermal amplification reaction were Simpliamp ^TM Thermal Cycler for colorimetric analysis (Thermo Fisher Scientific, USA) and QuantStudio ^TM 3 for fluorescence analysis ( Thermo Fisher Scientific, USA) and Bio-Rad CFX96 ^™ (BIO-RAD, USA) were used.

primer 10X concentration (STOCK) (μM) 1X concentration (FINAL) (μM) FIP 16 1.6 BIP 16 1.6 F3 2 0.2 B3 2 0.2 FL 4 0.4 BL 4 0.4

(2) Whether non-specific reactions (false negatives and false positives) occur

Using negative/positive controls and samples of other sexually transmitted infections (Neisseria gonorrhoeae and Treponema pallidum, respectively), primer pairs that did not cause non-specific reactions in all test items were selected. The concentration of the sample used for the test was 10 copies/rxn based on the standard, and the reaction time was 30 minutes.

Primer pairs confirmed to have a false diagnosis rate of less than 0.3% were selected as a result of repeating each of three different samples three times.

(3) colorimetric analysis

Specifically, using Test Example 1 and 10 copies/rnx of DNA of each strain as a template, prepare a mixture for the amplification reaction as in Test Example 1-(1), 30 minutes, 35 minutes, 40 minutes, 50 minutes, and The section was divided into 60 minutes and an isothermal amplification reaction was performed. The method of selecting the reaction time is based on the time at which the color of the reaction solution changes from red to yellow in more than 93/100 reactions based on one test, and 3 different samples for each primer are used 3 times each. Reproducibility was ensured as a result of repeated testing.

(4) Fluorescence analysis

The reaction efficiency of the primer was confirmed by setting the sample concentration to 10 copies/rnx and 1 cycle to 1 minute. In the method of selecting the reaction time, the C _t value of 30 or less was selected based on the fluorescent substance detection value threshold of 500 in 93/100 or more reactions based on one test.

Reproducibility was ensured as a result of repeating three different samples for each designed primer three times each.

(5) Sensitivity of isothermal amplification reaction (detection limit)

Purchasing the purified DNA standard of Chlamydia from ATCC (American Type Culture Collection, USA), dividing the concentration (copy number) of each material into 1,000, 100, 50, 25, and 10 copy/rxn, the isothermal amplification reaction was performed. The detection limit was confirmed. The concentration showing 93/100 or more reactions based on one test with a reaction time of 30 minutes was set as the limit of detection (LOD).

Reproducibility was ensured as a result of repeating three different samples for each designed primer three times each.

(6) Primer selection

The results are summarized in Table 2, and each primer nucleotide sequence of the primer set of Example 2, which is the selected primer that satisfies all conditions, is shown in Table 3.

pathogen Chlamydia trachomatis base sequence pair Example 1 Example 2 Example 3 Example 4 Example 5 reaction time 32 C _t 28 C _t 32 C _t 27 C _t 29 C _t reaction specificity 95% 99% 99% 94% 92% reaction sensitivity 25 copies/rxn 10 copies/rxn 25 copies/rxn 25 copies/rxn 10 copies/rxn

pathogen base sequence (5'-3') note Ct-F3 GAACAGATGCAGCGACAG SEQ ID NO: 1 Ct-B3 TGGGTTTAGAGTAGTGAATATC SEQ ID NO: 2 Ct-FIP TTAACTCCAATGTAAGGAGTTTTCAATGCCTCTATTGACTACCAT SEQ ID NO: 3 Ct-BIP GGTCTAGAGCAAGTTTTGATGCCGCAAGATAGCTTCAGCCAATT SEQ ID NO: 4 Ct-LF CATATTCAAATCCGTATAGCTCAGCC SEQ ID NO: 5 Ct-LB ATTCGTATAGCTCAGCC SEQ ID NO: 6

※ Ct, Chlamydia trachomatis; F3, forward primer; B3, backward primer; FIP, forward inner primer; BIP, backward inner primer; LF, forward loop primer; LB, backward loop primer

Test Example 2: Confirmation of efficiency change with or without 4T

Efficiency change was confirmed when it had the nucleotide sequence as shown in Table 3, but four thymines were not added. Specifically, Example 2 was prepared as a primer set, and Comparative Example 1 was prepared using the four thymine-free primer sets in Example 2. Then, specificity and efficiency were tested as in Test Example 1 using each primer set, and the results are shown in Table 4 below.

base sequence pair Example 2 Comparative Example 1 reaction time 28 C _t 38 C _t reaction specificity 99% 93% reaction sensitivity 10 copies/rxn 50 copies/rxn

As a result, Example 2 satisfies all of the above test items, while Comparative Example 1 confirmed that the efficiency was significantly reduced.

Test Example 3: Assessing the analytical ability using a virtual sample

In order to evaluate whether analysis is possible in an actual clinical specimen, a virtual specimen was prepared and the analysis ability of the primer set according to the present invention was evaluated.

Specifically, blood samples from 3 healthy people were collected and divided, and the chlamydia genetic material was mixed at 10 copies/25 μl per blood sample to make a hypothetical patient sample. A negative control group was prepared without mixing the genetic material, and the efficiency was compared with Comparative Example 1. A mixed solution for the amplification reaction was prepared using the above sample, and an isothermal amplification reaction was performed.

The results are shown in Table 5 below.

base sequence pair Example 2 Comparative Example 1 reaction time 29 C _t 39 C _t reaction specificity 99% 93% reaction sensitivity 10 copies/rxn 50 copies/rxn

As a result, it was confirmed that the primer set works even in a virtual sample, and it was confirmed that a chlamydia infection can be diagnosed using the primer set of the present invention without separately purifying the genetic material of the pathogen from the sample.

Preparation Example 2. Preparation of a structure for detecting lab-on-paper nucleic acid

(1) Structures for fluorescence analysis

In order to prepare a structure for detecting lab-on-paper nucleic acid, 0.5 μm polysulfone as the sample pad 120 and buffer pad 121, 0.01 μm cellulose as the first connection pad 131 or initiator pad 132, and a reaction pad ( 140) was 0.005 µm cellulose acetate, the second connection pad 150 was 0.05 µm cellulose, the detection pad 160 was 0.005 µm nitrocellulose, and the absorption pad 170 was 0.5 µm glass fiber.

The reaction pad 140 was prepared by overlapping a cellulose acetate membrane to make a pad, immersing it in a solution containing 45 mM sucrose, 0.005 w/w% TritonX-100, and 0.2 w/w% glycerol, and then drying it. Then, a well was formed with a fine drill, and a hydrogel layer including the primer set of Example 2 was formed on the bottom of the well. To form the hydrogel layer, first, based on the total volume of the hydrogel solution, UV-photocrosslinkable poly(ethylene glycol) diacrylate (PEGDA, Sigma-Aldrich, MW700) 20% v/v, poly(ethylene glycol) ( PEG, Sigma-Aldrich, MW600) 40% v/v and photoinitiator 2-hydroxy-2-methylpropiophenone (Sigma-Aldrich) 5% v/v and buffer (PBS buffer, pH7.5) 35% and a hydrogel solution was prepared by mixing each primer set here. The poly(ethylene glycol) is preferably included in order to increase the porosity of the hydrogel microparticles. Then, the hydrogel solution was applied to the inner surface of each well of the reaction pad, and UV exposure for 1 minute (360 nm wavelength, 35 mJ/cm ² ) to form a hydrogel coating layer.

Then, on the surface of the reaction pad 140, dNTP (1.4 mM, dATP, dCTP, dGTP, and dTTP), an isothermal amplification buffer (1X, 20 mM Tris-HCl, 10 mM (NH ₄ ) ₂ SO ₄ , 50 mM KCl, 2 mM MgSO ₄ ) , and 0.1% Tween-20, pH7.5) and Bst 3.0 DNA polymerase (320U/ml) were applied, and fixed by heating in an oven at about 38° C. for about 30 minutes.

The detection pad 160 forms a well with a diameter of 5 mm with a fine drill, a polyethylene phthalate ink is applied thereto, and a solution containing an antibody capable of binding to FAM, HEX, and Cy5 is added dropwise thereon, and then NHS (N-hydroxysulfosuccinimide) solution was applied and reacted to fix the antibody.

The initiator pad 132 and the second connection pad 150 were coated with a 5% low-melting-point agarose (Lonza, NuSieve GTG Agarose) solution on the portion in contact with the reaction pad.

Then, the components of each structure are arranged as shown in FIG. 3 , and a heating pad is used at the lower ends of the sample pad 120 , the initiator pad 132 , the reaction pad 140 , and the second connection pad 150 . A copper plate to which a hot wire is connected is disposed at (141), and a polyacrylic film is disposed as a blocking pad (142) on the upper portion of the reaction pad.

(2) Structure for colorimetric diagnosis

If the structure is to be applied to the colorimetric diagnostic method, the reaction pad 140 is manufactured in the same manner as above, and gold nanoparticles are fixed to the second connection pad 150 . Specifically, the gold nanoparticles fixed to the second connection pad 150 were prepared as colloidal particles as follows. When the 0.1% HAuCl ₄ solution begins to boil while stirring and heating, a 0.5% sodium citric acid solution is added to reduce the solution to form gold particles, and 1 mg of streptavidin is added per 100 ml of the gold particle solution to condensate. made it The condensate was precipitated by centrifugation at 10,000 g, dissolved in physiological saline (PBS) containing 0.1% BSA, and stored so that the OD450 value became 10.

The second connection pad 150 was manufactured as follows. Specifically, several layers of cellulose membrane were prepared and cut, and 0.4 M Tris (pH 6.5), 0.2% Tween-20, 1% sodium caseinate, 0.1% sodium azide, and 0.05% Proclin It was soaked in a solution prepared in 300 and kept wet. The prepared gold condensate was prepared by dialysis into a solution having the same composition as the solution. Then, the cellulose membrane was treated with the dialyzed gold condensate and dried to complete the second connection pad 150 .

The detection pad 160 is designated by stamping a detection zone with polyethylene phthalate ink, and after stamping again with a solution containing an antibody capable of binding to a fluorescent marker such as FAM, HEX, and Cy5 thereon, NHS (N- hydroxysulfosuccinimide) solution was applied and reacted to fix the antibody. The following process is the same as in Preparation Example 2-(1).

Test Example 4. Extraction and Amplification of Nucleic Acids Using Blood Samples

(One) Preparation of test samples and paper chips

It was confirmed whether nucleic acids could be extracted from a blood sample using the lab-on-paper nucleic acid detection structure of the present invention and amplified to exhibit fluorescence.

First, human blood was purchased from Innovative Research (IWB1K2E10ML, USA) as whole blood and prepared, and the primer of 18S rRNA as a positive control was purchased from Tocris (#7325, USA). It was confirmed through the data sheet that the whole blood used was not infected with any virus or bacteria. One test sample was prepared by mixing 10 copies/25 μl of each Chlamydia DNA standard in the human blood.

The primer set of Example 2 was used as the primer set for the detection of the strain mixed in blood, and the F3 primer in each primer set bound a fluorescent marker to the 5' end, and human 18s RNA as a positive control (A) was FAM. , and Example 2 (B) was labeled with HEX, and a sample without a target genetic material template was used for the negative control group (C).

(2) Nucleic Acid Detection from Samples

Take 50 μl of the sample, Lysis buffer (20mM Tris HCl (pH 8.8), 15mM MgSO ₄ , 15mM KCl, 15mM (NH ₄ ) ₂ SO ₄ , 0.1 w/w% Tween20, 0.05 mg/ml Protease (Protenase) K)) 50 μl was added and lightly tapped, followed by incubation at room temperature for about 5 minutes. Then, while the heating pad 141 under the sample pad 120 is operated at 60° C., it is slowly added dropwise within 5 minutes to the sample pad 120 of the nucleic acid detection structure prepared in Preparation Example 2, and the addition buffer ( 250 μl of 20 mM Tris-HCl, 10 mM (NH ₄ ) ₂ SO ₄ , 50 mM KCl, 2 mM MgSO ₄ , 0.1% Tween® 20, pH 8.8) was slowly added dropwise to the sample pad for about 2 minutes, followed by reaction The heating pad under the pad was heated to 65° C. and reacted for 30 minutes. Then, the heating pad under the initiator pad and the second connection pad was heated to 65° C., and 250 μl of the addition buffer was slowly added dropwise to the buffer pad for 2 minutes.

Then, using the Chemi-Doc XRS + imaging system (Bio-Rad Laboratories, Hercules, CA, USA) set with a light source filter in the wavelength band of 400 to 700 λ, which is the recognition unit 200, in the wavelength band corresponding to each fluorescent marker. A fluorescence image was obtained, fluorescence was measured from the fluorescence image, and the fluorescence intensity was calculated as a maximum value of 1 and a minimum value of 0, and the fluorescence intensity value was obtained according to the following equation.

Fluorescence intensity value = I - I _N

( I _N : fluorescence intensity of negative control, I : fluorescence intensity of sample)

The significance values derived based on the detected fluorescence intensity values are calculated as shown in Table 6 below.

Fluorescence intensity value significance value A 0.78 90% or more positive (normal operation) B 0.73 90% or more positive C 0.05 voice

Judging based on the significance value, the structure as a positive control (A) operated normally, and the result of being infected with Chlamydia bacteria (B) is output.

On the other hand, when colorimetric diagnosis was performed using samples A and B, the F3 primer in each primer set was labeled at the 5' end as a detector, and human 18s RNA as a positive control was labeled with FAM and HEX in Example 2, and each detection pad was It has a detection zone including a receptor specific for FAM and a receptor specific for HEX according to each detection line. As shown in Figure 7, it was confirmed that the structure works normally by confirming the positive control (FAM) band in both the negative control group including the test sample and the diluted blood sample, and Chlamydia bacteria (test group, HEX) was detected in the test sample. On the other hand, by confirming that only the positive control (FAM) was observed in the negative control sample, it can be confirmed that the primer set of the present invention and the diagnostic kit including the same also work in colorimetric diagnosis.

110: housing structure
120: sample pad
121: buffer pad
131: first connection pad
132: initiator pad
140: reaction pad
141: heating pad
142: blocking pad
150: second connection pad
160: detection pad
170: absorbent pad
161: detection zone
200: recognition unit
210: output unit

SEQUENCE LISTING <110> NUTRIGENE <120> Composition comprising primer set for diagnosis of Chlamydia infection disease, and molecular diagnosis method and kit based on Lab-on-paper <130> NUTRIGENE_2021-10(3) <160> 6 <170> PatentIn version 3.2 <210> 1 <211> 18 <212> DNA <213> <220> <223> Chlamydia forward primer <400> 1 gaacagatgc agcgacag 18 <210> 2 <211> 22 <212> DNA <213> <220> <223> Chlamydia backward primer <400> 2 tgggtttaga gtagtgaata tc 22 <210> 3 <211> 45 <212> DNA <213> <220> <223> Chlamydia forward inner primer <400> 3 ttaactccaa tgtaaggagt tttcaatgcc tctattgact accat 45 <210> 4 <211> 44 <212> DNA <213> <220> <223> Chlamydia backward inner primer <400> 4 ggtctagagc aagttttgat gccgcaagat agcttcagcc aatt 44 <210> 5 <211> 26 <212> DNA <213> <220> <223> Chlamydia forward loop primer <400> 5 catattcaaa tccgtatagc tcagcc 26 <210> 6 <211> 17 <212> DNA <213> <220> <223> Chlamydia backward loop primer <400> 6 attcgtatag ctcagcc 17

Claims (8)

delete delete delete delete delete a sample pad for receiving a biological sample;
a buffer pad disposed separately from the sample pad and accommodating a rehydration buffer;
a first connection pad disposed on the sample pad and connecting the sample pad and the reaction pad;
an initiator pad disposed on the buffer pad, a portion in contact with the buffer pad or the reaction pad coated with low-melting agarose or wax, and connecting the buffer pad and the reaction pad;
a reaction pad disposed under the first connection pad and the initiator pad, the reaction pad comprising a primer set capable of specifically binding to a target nucleic acid and a reagent for an isothermal amplification reaction (LAMP), in which an isothermal amplification reaction occurs;
a second connection pad disposed on the reaction pad and carrying the isothermal amplification reactant;
a detection pad disposed under the second connection pad and configured to obtain a target nucleic acid amplified from the isothermal amplification reaction product; and
and an absorption pad disposed on the side of the detection pad and absorbing the remaining sample,
a heating pad disposed under the sample pad, the initiator pad, the reaction pad, and the second connection pad;
The primer set is specific to chlamydia, and includes a primer represented by the nucleotide sequence of SEQ ID NOs: 1 to 6,
A kit for diagnosing chlamydial infections. The kit for diagnosing Chlamydia infection according to claim 6, wherein, in the primer set, any one of the forward and reverse primers is labeled with a fluorescent marker. The method according to claim 6, wherein the sample pad, the first connection pad, the buffer pad and the initiator pad; reaction pad; a second connection pad; detection pad; And the absorbent pad is sequentially at least partially in contact with and arranged laterally, a kit for diagnosing chlamydia infection.

Images