CN109988827A - The detection method and its primer sets of ALS correlation SOD1 gene mutation - Google Patents
The detection method and its primer sets of ALS correlation SOD1 gene mutation Download PDFInfo
- Publication number
- CN109988827A CN109988827A CN201711493145.XA CN201711493145A CN109988827A CN 109988827 A CN109988827 A CN 109988827A CN 201711493145 A CN201711493145 A CN 201711493145A CN 109988827 A CN109988827 A CN 109988827A
- Authority
- CN
- China
- Prior art keywords
- seq
- als
- primer
- sod1 gene
- correlation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to molecular biology gene technology field and medical domains, specifically disclose a kind of detection method and its primer sets for being used for the SOD1 gene mutation of amyotrophic lateral sclerosis (ALS) correlation.The present invention analyzes ALS correlation SOD1 gene mutation regional sequence, designs corresponding primer, passes through multiplexed PCR amplification to sample genomic dna specific region sequence, is finally detected with Ion Torrent semiconductor chip sequencing technologies.The advantages that detection method of the invention has flux big, specificity and high sensitivity, as a result stable, reproducible, and detection speed is fast.For amyotrophic lateral sclerosis science of heredity in terms of detection, test, analysis and assessment provide a quick, reliable and accurate new way, to provide fundamental basis for the clinical diagnosis of such disease.
Description
Technical field
The present invention relates to molecular biology gene technology field and medical domain, it is related to withering to flesh with molecular biology method
The primer sets that contracting lateral schlerosis (ALS) correlation SOD1 gene mutation is detected in particular to use Ion Torrent semiconductor
Chip sequencing technologies carry out the relevant primer group and its kit of qualitative and quantitative analysis to ALS correlation SOD1 gene mutation.
Background technique
Amyotrophic lateral sclerosis (amyotrophic lateral sclerosis, ALS) be also motor neuron disease
It (MND), is a kind of lethal neurodegenerative disease for selecting the upper and lower motor neuron of assault sexually, with cortex, brain stem, spinal cord
Motor neuron progressive death causes myasthenia, amyotrophia and breathing myoparalysis to be characterized.There is progressive exacerbation in patient
Myasthenia and muscular atrophy, 3 ~ 10 years after being ill internal cause respiratory failures of Duo Qi are dead.ALS can be divided into scattered by its mode of onset
Hair property ALS(Sporadic ALS, SALS) and familial ALS (Familial amyotrophic lateral sclerosis
, FALS), SALS accounts for 90% ~ 95%, FALS and accounts for 5% ~ 10%, and the two has no obvious area in clinical manifestation.
ALS, which is mostly that adult is hidden, attacks onset, and chronic carry out sexual development has the symptom and body of up and down motion neuronal damage concurrently
Sign, shows as myasthenia, amyotrophia and pyramidal sign, general insentience obstacle and stool and urine obstacle.
Pathogenesis about ALS has more theory, wherein causing to SOD1 gene (CuZn-superoxide dismutase gene)
Interpretation of the cause, onset and process of an illness most study, but specific pathogenesis is still unclear, and current common recognition is that SOD1 gene mutation leads to protein toxic function
Obtain (Toxic gain of function) rather than function forfeiture (Loss of function).Familial amyotrophic funiculus lateralis
The family for having 15% ~ 20% in hardening (family amyotrophic lateral sclerosis, FALS) is that SOD1 gene is prominent
Become family, up to the present, it has been found that SOD1 gene has more than a mutational site more than 150 in FALS patient.
The SOD1 assignment of genes gene mapping contains 5 exons in 21q22.11, genomic DNA overall length 11kb, encodes 153 a kind of
The SOD1 albumen of amino acid.The albumen is a kind of radicals scavenging enzyme, the high expression in nerve fiber, liver, red blood cell, mainly
Function is the superoxide radical in scavenger-cell.The SALS of about 20% FALS and 5% is related with the gene mutation, and predominantly point is prominent
Become, wherein missense mutation accounts for the overwhelming majority.
The method of detection ALS correlation SOD1 gene mutation site has PCR-SSCP, classical sequencing etc. at present, and there are flux
Low, the problems such as cost is expensive, PCR product length is also had certain limitations.
Ion Torrent semiconductor chip sequencing technologies are the sequencing technologies of a new generation, its core technology is using half
Conductor technology establishes direct connection between chemistry and digital information.It is fixed on the microballoon in the micropore of semiconductor chip
DNA chain then successively mixes mononucleotide dGTP, dCTP, dATP, dTTP.With the incorporation of each base, H is released+, H+?
They can be detected when passing through each hole bottom, by H+Detection, real-time interpretation base.Since its chemistry sequencing is former
It is simple to manage nature, literalness nucleotide, without laser or optical detection apparatus, thus can reach minimum sequencing deviation and go out
The sequencing of color covers equilibrium degree, and an instrument can be suitble to the scientific research of various sequencing throughput demands, in a relatively short period of time
Obtain true and reliable experimental result.
Ion Torrent semiconductor chip sequencing technologies are compared with tradition Sanger method and two generation sequencing technologies, Ion
Torrent technology has following advantage: system is without laser light source, no optical system, no photographic system；Use unmarked nucleotide
And enzyme is sequenced, background interference is low；By to H+Detection, base interpretation accuracy can be improved；Sequencing throughput is big, fast
Degree is fast, and it is thousands of times or more of traditional Sanger sequencing approach flux, together that the sequencing detection for completing 1G flux, which only needs 2 ~ 3 hours,
When compensate for too long defect of existing high-flux sequence method working time in two generations.
It is still prominent dedicated for ALS correlation SOD1 gene without report Ion Torrent semiconductor chip sequencing technologies at present
The detection of change.
Summary of the invention
The purpose of the invention is to make up the deficiencies in the prior art, provides and determine for ALS correlation SOD1 gene mutation
Property, the method for quantitative detection and its primer.
To solve the above problems, the present invention takes following technical scheme:
It is gained knowledge and relevant bioinformatics software using biological information, it is related to the ALS that can be retrieved in public database
SOD1 gene mutation regional sequence, with 5.0 software design PCR primer of Primer Express Software.
It is by SEQ ID NO:1 in sequence table and SEQ ID NO:2 for detecting the primer of SOD1 gene order segment 1
The primer pair of composition.
Upstream primer: the SEQ ID of 5 '-agtagaattaggaaccaggacctcggc -3 ' No:1；
Downstream primer: the SEQ ID of 5 '-cctcgcaaacaagcctcc -3 ' No:2.
It is by SEQ ID NO:3 in sequence table and SEQ ID NO:4 for detecting the primer of SOD1 gene order segment 2
The primer pair of composition.
Upstream primer: the SEQ ID of 5 '-agtagaattactccaacttcgcacttttctta -3 ' No:3；
Downstream primer: the SEQ ID of 5 '-cagcacagcacaacaccca -3 ' No:4.
It is by SEQ ID NO:5 in sequence table and SEQ ID NO:6 for detecting the primer of SOD1 gene order segment 3
The primer pair of composition.
Upstream primer: the SEQ ID of 5 '-agtagaattagggagttttagcagtgtttctttt -3 ' No:5；
Downstream primer: the SEQ ID of 5 '-gctatcgccattattacaagagtta -3 ' No:6.
It is by SEQ ID NO:7 in sequence table and SEQ ID NO:8 for detecting the primer of SOD1 gene order segment 4
The primer pair of composition.
Upstream primer: the SEQ ID of 5 '-agtagaattagccctaatccatctgatgctt -3 ' No:7；
Downstream primer: the SEQ ID of 5 '-ttatgcttatccttttatgaaaacttac -3 ' No:8.
It is by SEQ ID NO:9 in sequence table and SEQ ID NO:10 for detecting the primer of SOD1 gene order segment 5
The primer pair of composition.
Upstream primer: the SEQ ID of 5 '-agtagaattaaagagtgactgcggaactaagg -3 ' No:9；
Downstream primer: the SEQ ID of 5 '-gggctcagactacatccaagg -3 ' No:10.
PCR amplification is carried out to sample to be detected with above-mentioned primer sets using the method for multiplex PCR.
It is micro- that pcr amplification product is subjected to the amplification building of sublibrary, ISP(Ion Sphere Particles, Ion
Ball) template preparation, be sequenced in Ion Torrent PGM system, and related sequencing sequence is analyzed with software.
The present invention is using multiple PCR method combination Ion Torrent semiconductor chip sequencing technologies simultaneously to ALS correlation
SOD1 gene mutation carries out parallel detection, it is advantageous that flux is big, specificity and high sensitivity are as a result stable, reproducible,
Detect fireballing advantage.
Specific embodiment
The present invention is described further in conjunction with specific embodiments.It should be understood that these embodiments are for illustration purposes only, without
For limiting the scope of the invention.
Embodiment 1, for ALS correlation SOD1 detection in Gene Mutation primer sets design.
It is gained knowledge and relevant bioinformatics software using biological information, to the ALS that can be retrieved in public database
Related SOD1 gene mutation regional sequence, with 5.0 software design PCR primer of Primer Express Software, primer sequence
It is classified as follows.
It is by SEQ ID NO:1 in sequence table and SEQ ID NO:2 for detecting the primer of SOD1 gene order segment 1
The primer pair of composition.
Upstream primer: the SEQ ID of 5 '-agtagaattaggaaccaggacctcggc -3 ' No:1；
Downstream primer: the SEQ ID of 5 '-cctcgcaaacaagcctcc -3 ' No:2.
It is by SEQ ID NO:3 in sequence table and SEQ ID NO:4 for detecting the primer of SOD1 gene order segment 2
The primer pair of composition.
Upstream primer: the SEQ ID of 5 '-agtagaattactccaacttcgcacttttctta -3 ' No:3；
Downstream primer: the SEQ ID of 5 '-cagcacagcacaacaccca -3 ' No:4.
It is by SEQ ID NO:5 in sequence table and SEQ ID NO:6 for detecting the primer of SOD1 gene order segment 3
The primer pair of composition.
Upstream primer: the SEQ ID of 5 '-agtagaattagggagttttagcagtgtttctttt -3 ' No:5；
Downstream primer: the SEQ ID of 5 '-gctatcgccattattacaagagtta -3 ' No:6.
It is by SEQ ID NO:7 in sequence table and SEQ ID NO:8 for detecting the primer of SOD1 gene order segment 4
The primer pair of composition.
Upstream primer: the SEQ ID of 5 '-agtagaattagccctaatccatctgatgctt -3 ' No:7；
Downstream primer: the SEQ ID of 5 '-ttatgcttatccttttatgaaaacttac -3 ' No:8.
It is by SEQ ID NO:9 in sequence table and SEQ ID NO:10 for detecting the primer of SOD1 gene order segment 5
The primer pair of composition.
Upstream primer: the SEQ ID of 5 '-agtagaattaaagagtgactgcggaactaagg -3 ' No:9；
Downstream primer: the SEQ ID of 5 '-gggctcagactacatccaagg -3 ' No:10.
Barcode sequence of the end of upstream primer 5 ' of each detection sequence segment comprising one section of sample information for identification
5’- agtagaatta-3’。
Embodiment 2, ALS correlation SOD1 gene mutation detection.
1) acquisition of sample genomic dna
The DNA in mucous membrane of mouth cast-off cells is extracted with cell cracking method, is suspended in 1mL physiological saline, 2000 × g centrifugation
10min；Supernatant is abandoned, every pipe adds 1mL physiological saline to wash repeatedly 1 time, then 2000 × g is centrifuged 10min；Supernatant is abandoned, every pipe adds 400
μ L cell lysis buffer solution (10mmol/L Tris-HCl, PH8.0; 0.1mol EDTA, PH8.0;0.5%SDS), it is placed on
30min is incubated in 50 DEG C of water-baths；It then cools to room temperature, adds isometric phenol-chloroform-isoamyl alcohol (volume ratio 25:24:1),
It mixes, 5000 × g is centrifuged 10min；Upper strata aqueous phase is shifted into another centrifuge tube, repeats extracting 1 time；Upper strata aqueous phase is retransferred to arrive
In another Eppendorf pipe, add the 3M NaAc (PH5.2) of 1/10 volume, mixes；95% cold ethyl alcohol of 2.5 times of volumes is added, mixes
It is even, -20 DEG C of precipitating DNA30min；10000 × g is centrifuged 15min, abandons supernatant；Add the cold ethyl alcohol cleaning precipitating of 1mL70%, 10000 × g
It is centrifuged 15min, abandons supernatant；37 DEG C of incubator 30min drying；DNA precipitating is dissolved in 20 μ L TE buffers, 1 μ L RNA enzyme is added,
37 DEG C of 30min are placed in -20 DEG C of preservations.
2) amplification and sequencing of PCR
The sample genomic dna extracted using step 1) is template, under the guidance of the primer described in embodiment 1, carries out multiplex PCR expansion
Increase (95 DEG C of 5 min;95 DEG C of 15 s, 60 DEG C of 1 min, totally 40 recycle), the amplified production of acquisition successively carries out amplicon
The building in library, ISP(Ion Sphere Particles, Ion microballoon) template preparation and chip loading and in Ion
It is sequenced in Torrent PGM system.
3) it analyzes and obtains conclusion
Sequencing result is analyzed with IGV2.0 software, counts the reading sequence of following five SOD1 genetic fragments as a result, according to inspection
It surveys result and judge it to each mutational site as wild type or mutability, for example wild type, then result prompts for " mutation yin
Property ", for example saltant type, then result prompts for " mutation is positive ".
As there is " mutation positive " in all detection sites as a result, if this conclusion for detecting are as follows: " subject is examined
××× (mutational site) mutation is detected in SOD1 gene, prompts amyotrophic lateral sclerosis ALS ".
As be " mutation negative " in all detection sites as a result, if this conclusion for detecting are as follows: " subject is examined
Mutation is not detected in SOD1 gene ".
Detection one, sample, testing result and conclusion see the table below.
Sequence table
<110>Shanghai joins Co., Ltd, lucky medical test institute
<120>detection method and its primer sets of ALS correlation SOD1 gene mutation
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
agtagaatta ggaaccagga cctcggc 27
<210> 2
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
cctcgcaaac aagcctcc 18
<210> 3
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
agtagaatta ctccaacttc gcacttttct ta 32
<210> 4
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
cagcacagca caacaccca 19
<210> 5
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
agtagaatta gggagtttta gcagtgtttc tttt 34
<210> 6
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
gctatcgcca ttattacaag agtta 25
<210> 7
<211> 31
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
agtagaatta gccctaatcc atctgatgct t 31
<210> 8
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ttatgcttat ccttttatga aaacttac 28
<210> 9
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
agtagaatta aagagtgact gcggaactaa gg 32
<210> 10
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
gggctcagac tacatccaag g 21
Claims (3)
1. a kind of detection method and its primer sets of the SOD1 gene mutation of ALS correlation, specific steps are as follows:
It is gained knowledge and relevant bioinformatics software using biological information, it is related to the ALS that can be retrieved in public database
SOD1 gene mutation regional sequence, with 5.0 software design PCR primer of Primer Express Software；
PCR amplification is carried out to sample to be detected using the method for multiplex PCR；
Pcr amplification product is carried out to the building of amplification sublibrary, ISP(Ion Sphere Particles, Ion microballoon) mould
The preparation of plate is sequenced in Ion Torrent PGM system, and is analyzed with software related sequencing sequence.
2. a kind of detection method and its primer sets of the SOD1 gene mutation of ALS correlation as described in claim 1, feature exist
In the PCR primer group includes the primer for 5 SOD1 gene order segments, and sequence is respectively as follows: SEQ ID No:
1-SEQ ID No:10:
5'- agtagaattaggaaccaggacctcggc -3'SEQ ID No: 1；
5'- cctcgcaaacaagcctcc -3' SEQ ID No: 2；
5'- agtagaattactccaacttcgcacttttctta -3' SEQ ID No: 3；
5'- cagcacagcacaacaccca -3' SEQ ID No: 4；
5'- agtagaattagggagttttagcagtgtttctttt -3' SEQ ID No: 5；
5'- gctatcgccattattacaagagtta -3' SEQ ID No: 6；
5'- agtagaattagccctaatccatctgatgctt -3' SEQ ID No: 7；
5'- ttatgcttatccttttatgaaaacttac -3' SEQ ID No: 8；
5'- agtagaattaaagagtgactgcggaactaagg -3' SEQ ID No: 9；
5’- gggctcagactacatccaagg -3’ SEQ ID No:10。
3. existing for a kind of method and its primer sets for detecting the SOD1 gene mutation of ALS correlation, feature as described in claim 1
In the primer sets form a kind of kit for detecting the SOD1 gene mutation of ALS correlation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711493145.XA CN109988827A (en) | 2017-12-30 | 2017-12-30 | The detection method and its primer sets of ALS correlation SOD1 gene mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711493145.XA CN109988827A (en) | 2017-12-30 | 2017-12-30 | The detection method and its primer sets of ALS correlation SOD1 gene mutation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109988827A true CN109988827A (en) | 2019-07-09 |
Family
ID=67110130
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711493145.XA Pending CN109988827A (en) | 2017-12-30 | 2017-12-30 | The detection method and its primer sets of ALS correlation SOD1 gene mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109988827A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114317726A (en) * | 2022-02-24 | 2022-04-12 | 杭州惠煜医疗科技有限公司 | Gene marker for detecting amyotrophic lateral sclerosis, detection method and application |
-
2017
- 2017-12-30 CN CN201711493145.XA patent/CN109988827A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114317726A (en) * | 2022-02-24 | 2022-04-12 | 杭州惠煜医疗科技有限公司 | Gene marker for detecting amyotrophic lateral sclerosis, detection method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106191311B (en) | A kind of multiple liquid phase genetic chip method and reagent of quick detection cavy LCMV, SV, PVM, Reo-3 virus | |
| CN106399304B (en) | A kind of SNP marker relevant to breast cancer | |
| CN112226440B (en) | Pathogenic mutation of hereditary primary infertility and detection reagent thereof | |
| CN109988827A (en) | The detection method and its primer sets of ALS correlation SOD1 gene mutation | |
| CN110042153A (en) | A kind of detection method and its primer sets of SMN1 gene mutation | |
| CN109943569B (en) | Isolated nucleic acid encoding IFNLR1 mutant and application thereof | |
| CN105838720A (en) | PTPRQ gene mutant and application thereof | |
| CN110628898B (en) | BAZ1B susceptibility SNP locus detection reagent and kit prepared by same | |
| CN110878346B (en) | Gene mutant and application thereof | |
| CN115478101A (en) | Kit and method for detecting multiple gene site copy number variation of autism patient | |
| CN114032303A (en) | Oligonucleotide and method for detecting new mutation of gene ABCB11 | |
| CN109797210A (en) | A kind of detection method and its primer sets that Y chromosome is micro-deleted | |
| CN110144390A (en) | A kind of detection method and its primer sets of PAH gene mutation | |
| CN106636351B (en) | One kind SNP marker relevant to breast cancer and its application | |
| CN106868128B (en) | Biomarker for auxiliary diagnosis of breast cancer and application thereof | |
| CN109811052A (en) | A kind of kit and gene panel detecting idiopathic azoospermatism | |
| CN110628897B (en) | KFS pathogenic gene new mutation and application thereof | |
| CN110144388A (en) | A kind of detection method and its primer sets of SLC25A13 gene mutation | |
| CN110144403B (en) | New mutation SNP site of breast cancer treatment gene RBM12B and application thereof | |
| CN110643700B (en) | Application of KFS related gene mutation in preparation of detection kit | |
| CN113151445B (en) | Mutation site of ATRX gene related to mental retardation diseases and detection kit | |
| CN106834476A (en) | A kind of breast cancer detection kit | |
| CN106834491B (en) | Breast cancer prognosis-related gene mutation detection kit and its application method | |
| CN107828889B (en) | PCR amplification primer and kit for qualitative detection of HLA-DRB1 x 03 gene | |
| CN110042154A (en) | A kind of detection method and its primer sets of NOTCH3 gene mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190709 |