CN110042153A - A kind of detection method and its primer sets of SMN1 gene mutation - Google Patents
A kind of detection method and its primer sets of SMN1 gene mutation Download PDFInfo
- Publication number
- CN110042153A CN110042153A CN201810040639.0A CN201810040639A CN110042153A CN 110042153 A CN110042153 A CN 110042153A CN 201810040639 A CN201810040639 A CN 201810040639A CN 110042153 A CN110042153 A CN 110042153A
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- smn1 gene
- sma
- primer sets
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to molecular biology gene technology field and medical domains, specifically disclose a kind of for detecting the method and its primer sets of SMN1 gene mutation.The present invention analyzes the nucleic acid sequence of spinal muscular atrophy (SMA) correlation SMN1 gene extron 7 and 8 deletion mutation region of exon, design corresponding primer, multiplexed PCR amplification is passed through to sample genomic dna specific site, is finally detected with Ion Torrent semiconductor chip sequencing technologies.The advantages that detection method of the invention has flux big, specificity and high sensitivity, as a result stable, reproducible, and detection speed is fast.For SMA science of heredity in terms of detection, test, analysis and assessment provide a quick, reliable and accurate new way, to provide fundamental basis for the clinical diagnosis of such disease.
Description
Technical field
The present invention relates to molecular biology gene technology field and medical domain, it is related to molecular biology method to SMN1
The primer sets of gene mutation site detection, in particular to it is prominent to SMN1 gene with Ion Torrent semiconductor chip sequencing technologies
Displacement point carries out the relevant primer group and its kit of qualitative and quantitative analysis.
Background technique
Spinal muscular atrophy (Spinal Muscular Atrophy, SMA) is that the most common lethal autosome is hidden
One of property hereditary disease.Illness rate is 1/6000~1/10000, occupies the second of lethal autosomal recessive hereditary diseases.Spinal cord
Property muscular atrophy be sometimes referred to as " progressive spinal myodystrophia disease " or " spinal muscular atrophy ".
In neuromuscular hereditary disease, SMA belongs to typical neurogenic urinary incontinence disease and in infancy and childhood
The most common neurogenic urinary incontinence of morbidity leads to the disease of Delayed motor.SMA patient causes to transport due to inhereditary material defect
Dynamic neuronal development obstacle falls to main performance with locomitivity so that symmetry limb muscle is powerless.Most of SMA patients exist
It falls ill in 2 years old, patient will not walk, stand, and severe patient can not even come back, and completely lose locomitivity.Most of SMA suffer from
Person is dead because of extremely weak and respiratory failure between 2-10 years old, and patient with severe symptoms can only survive some months.It therefore is a kind of
Seriously endanger the hereditary disease of life.SMA according to age of onset difference, can be divided into SMA I, SMA II, SMA III, SMA IV and
SMA V-type.
SMA is primarily due to caused by the SMN homozygous Deletion of 5q11.2-13.3.SMA patient can be diagnosed to be SMN1
Gene has the situation of large fragment deletion to occur and (include at least whole section of exon7 even exon8).Wherein most SMA type I
Homozygous deletion mutation (homozygous deletion) has occurred in the SMN1 gene of patient；Many SMA type II patients its
Deletion mutation occurs for a set of SMN gene, and another set of SMN gene changes, and (conversion, SMN1 gene conversion are at SMN2 base
Cause)；The patient of SMA type III, two sets of SMN1 genes may all be transformed into SMN2 gene.SMN base is not found as minority
Because of large fragment deletion or the SMA patient of conversion, then some micromutations may occur on SMN gene and cause a disease.It follows that by
The copy number that SMN1 gene is detected by DNA molecular diagnostic techniques, can be used as whether diagnosis is the one of SMA patient or carrier
Item important evidence.
United States Medicine science of heredity has some clinical guidelines and the preventative strategies of common genetic disease is illustrated, and SMA is
Recommend one of the disease that all Mr. and Mrs are carried out with screening.According to a large amount of data research, SMA Disease-causing gene is taken in crowd
Band rate about just has a SMA carrier in 1/40, that is, every 40 normal persons.There is a batch to District of Shanghai pregnant woman to grind
It is also similar to study carefully data.
The deletion condition of SMN1 gene extron 7 and exon 8 in SAM patient, occurs exon 7 and exon 8 lacks
(Zhan Renqun 87%) or the individually ratio (the 7% of Zhan Renqun ratio) of exon 7 missing, occur the ratio about 94% of Exon deletion
[1], so the deletion condition of detection SMN1 gene extron 7 and exon 8 is diagnosis spinal muscular atrophy key evidence.
Detection SAM correlation SMN1 gene extron 7 and the method for 8 deletion mutation of exon mainly have MLPA, PCR- at present
The problems such as RFLP, DHPLC etc., there are complicated for operation, flux is low, cost is expensive.
Ion Torrent semiconductor chip sequencing technologies are the sequencing technologies of a new generation, its core technology is using half
Conductor technology establishes direct connection between chemistry and digital information.It is fixed on the microballoon in the micropore of semiconductor chip
DNA chain then successively mixes mononucleotide dGTP, dCTP, dATP, dTTP.With the incorporation of each base, H is released+, H+?
They can be detected when passing through each hole bottom, by H+Detection, real-time interpretation base.Due to its chemistry sequencing principle
Naturally simple, literalness nucleotide, without laser or optical detection apparatus, thus can reach minimum sequencing deviation and outstanding
Sequencing cover equilibrium degree, an instrument can be suitble to the scientific research of various sequencing throughput demands, obtain in a relatively short period of time
Obtain true and reliable experimental result.
Ion Torrent semiconductor chip sequencing technologies are compared with tradition Sanger method and two generation sequencing technologies, Ion
Torrent technology has following advantage: system is without laser light source, no optical system, no photographic system；Use unmarked nucleotide
And enzyme is sequenced, background interference is low；By to H+Detection, base interpretation accuracy can be improved；Sequencing throughput is big, fast
Degree is fast, and it is thousands of times or more of traditional Sanger sequencing approach flux, together that the sequencing detection for completing 1G flux, which only needs 2 ~ 3 hours,
When compensate for too long defect of existing high-flux sequence method working time in two generations.
At present still without report Ion Torrent semiconductor chip sequencing technologies dedicated for the inspection of SMN1 gene mutation
It surveys.
Summary of the invention
The purpose of the invention is to make up the deficiencies in the prior art, provide for the qualitative, quantitative of SMN1 gene mutation
The method and its primer of detection.
To solve the above problems, the present invention takes following technical scheme:
It is gained knowledge and relevant bioinformatics software using biological information, it is related to the SAM that can be retrieved in public database
8 deletion mutation site of SMN1 gene extron 7 and exon, with 5.0 software design PCR of Primer Express Software
Primer.
It is by SEQ ID NO:1 in sequence table and SEQ ID NO for detecting the primer of SMN1 gene order segment 1:
The primer pair of 2 compositions.
Upstream primer: the SEQ ID of 5 '-agtagaattaagactatcaacttaatttctgatca -3 ' No:1；
Downstream primer: the SEQ ID of 5 '-ccttccttctttttgattttgttt -3 ' No:2.
It is by SEQ ID NO:3 in sequence table and SEQ ID NO for detecting the primer of SMN1 gene order segment 2:
The primer pair of 4 compositions.
Upstream primer: the SEQ ID of 5 '-agtagaattagtaataaccaaatgcaatgtgaa -3 ' No:3；
Downstream primer: the SEQ ID of 5 '-ctacaacacccttctcacag -3 ' No:4.
It is by SEQ ID NO:5 in sequence table and SEQ ID NO for detecting the primer of SMN1 gene order segment 3:
The primer pair of 6 compositions.
Upstream primer: the SEQ ID of 5 '-agtagaattacctttattttccttacagggttt -3 ' No:5；
Downstream primer: the SEQ ID of 5 '-agtaatgtgagcaccttccttct -3 ' No:6.
It is by SEQ ID NO:7 in sequence table and SEQ ID NO for detecting the primer of SMN1 gene order segment 4:
The primer pair of 8 compositions.
Upstream primer: the SEQ ID of 5 '-agtagaattaggaatgggtaactcttcttgatta -3 ' No:7；
Downstream primer: the SEQ ID of 5 '-ttctcaactgcctcaccacc -3 ' No:8.
PCR amplification is carried out to sample to be detected with above-mentioned primer sets using the method for multiplex PCR.
It is micro- that pcr amplification product is subjected to the amplification building of sublibrary, ISP(Ion Sphere Particles, Ion
Ball) template preparation, be sequenced in Ion Torrent PGM system, and related sequencing sequence is analyzed with software.
The present invention is using multiple PCR method combination Ion Torrent semiconductor chip sequencing technologies simultaneously to SAM correlation
SMN1 gene extron 7 and 8 deletion mutation site of exon carry out parallel detection, and the range of the detection covers about 90% or more
SAM patient's SMN1 gene delection situation.Testing result can be used for the auxiliary diagnosis or screening of SAM.It is advantageous that flux is big,
Specificity and high sensitivity, it is as a result stable, it is reproducible, detect fireballing advantage.
Specific embodiment
The present invention is described further in conjunction with specific embodiments.It should be understood that these embodiments are for illustration purposes only, without
For limiting the scope of the invention.
Embodiment 1, for SMN1 detection in Gene Mutation primer sets design.
It is gained knowledge and relevant bioinformatics software using biological information, to the SAM that can be retrieved in public database
8 deletion mutation site of related SMN1 gene extron 7 and exon, is set with 5.0 software of Primer Express Software
PCR primer is counted, primer sequence is as follows.
It is by SEQ ID NO:1 in sequence table and SEQ ID NO for detecting the primer of SMN1 gene order segment 1:
The primer pair of 2 compositions.
Upstream primer: the SEQ ID of 5 '-agtagaattaagactatcaacttaatttctgatca -3 ' No:1；
Downstream primer: the SEQ ID of 5 '-ccttccttctttttgattttgttt -3 ' No:2.
It is by SEQ ID NO:3 in sequence table and SEQ ID NO for detecting the primer of SMN1 gene order segment 2:
The primer pair of 4 compositions.
Upstream primer: the SEQ ID of 5 '-agtagaattagtaataaccaaatgcaatgtgaa -3 ' No:3；
Downstream primer: the SEQ ID of 5 '-ctacaacacccttctcacag -3 ' No:4.
It is by SEQ ID NO:5 in sequence table and SEQ ID NO for detecting the primer of SMN1 gene order segment 3:
The primer pair of 6 compositions.
Upstream primer: the SEQ ID of 5 '-agtagaattacctttattttccttacagggttt -3 ' No:5；
Downstream primer: the SEQ ID of 5 '-agtaatgtgagcaccttccttct -3 ' No:6.
It is by SEQ ID NO:7 in sequence table and SEQ ID NO for detecting the primer of SMN1 gene order segment 4:
The primer pair of 8 compositions.
Upstream primer: the SEQ ID of 5 '-agtagaattaggaatgggtaactcttcttgatta -3 ' No:7；
Downstream primer: the SEQ ID of 5 '-ttctcaactgcctcaccacc -3 ' No:8.
Barcode sequence of the end of upstream primer 5 ' of each detection sequence segment comprising one section of sample information for identification
5’- agtagaatta -3’。
Embodiment 2, SMN1 gene mutation detection.
1) acquisition of sample genomic dna
The genomic DNA of whole blood sample is extracted with Qiagen DNA extraction agent box.
2) amplification and sequencing of PCR
The sample genomic dna extracted using step 1) is template, under the guidance of the primer described in embodiment 1, carries out multiplex PCR expansion
Increase (95 DEG C of 5 min;95 DEG C of 15 s, 60 DEG C of 1 min, totally 40 recycle), the amplified production of acquisition successively carries out amplicon
The building in library, ISP(Ion Sphere Particles, Ion microballoon) template preparation and chip loading and in Ion
It is sequenced in Torrent PGM system.
3) it analyzes and obtains conclusion
Sequencing result is analyzed with IGV2.0 software, counts the reading sequence of SMN1 genetic fragment as a result, according to testing result really
Whether random sample originally has SMN1 gene mutation, and if any mutation, then prompt is mutated concrete condition, such as " subject in interpretation of result
Homozygous deletion occurs for SMN1 gene extron 7 "；Such as without mutation, then " subject's SMN1 exon 7 is prompted in structural analysis
Homozygous deletion does not occur with exon 8, prompts normal ".
This detection detects 1 sample altogether, and testing result and conclusion see the table below.
Sequence table
<110>Shanghai joins Co., Ltd, lucky medical test institute
<120>a kind of detection method and its primer sets of SMN1 gene mutation
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 35
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
agtagaatta agactatcaa cttaatttct gatca 35
<210> 2
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ccttccttct ttttgatttt gttt 24
<210> 3
<211> 33
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
agtagaatta gtaataacca aatgcaatgt gaa 33
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ctacaacacc cttctcacag 20
<210> 5
<211> 33
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
agtagaatta cctttatttt ccttacaggg ttt 33
<210> 6
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
agtaatgtga gcaccttcct tct 23
<210> 7
<211> 34
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
agtagaatta ggaatgggta actcttcttg atta 34
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
ttctcaactg cctcaccacc 20
Claims (3)
1. a kind of method and its primer sets for detecting SMN1 gene mutation, specific steps are as follows:
It is gained knowledge and relevant bioinformatics software using biological information, it is related to the SMA that can be retrieved in public database
8 deletion mutation site of SMN1 gene extron 7 and exon, with 5.0 software design PCR of Primer Express Software
Primer；
PCR amplification is carried out to sample to be detected using the method for multiplex PCR；
Pcr amplification product is carried out to the building of amplification sublibrary, ISP(Ion Sphere Particles, Ion microballoon) mould
The preparation of plate is sequenced in Ion Torrent PGM system, and is analyzed with software related sequencing sequence.
2. a kind of method and its primer sets for detecting SMN1 gene mutation as described in claim 1, which is characterized in that described
PCR primer group includes the primer for 4 SMN1 gene order segments, and sequence is respectively as follows: SEQ ID No:1-SEQ ID
No:8:
5'- agtagaattaagactatcaacttaatttctgatca -3' SEQ ID No: 1；
5'- ccttccttctttttgattttgttt -3' SEQ ID No: 2；
5'- agtagaattagtaataaccaaatgcaatgtgaa -3' SEQ ID No: 3；
5'- ctacaacacccttctcacag -3' SEQ ID No: 4；
5'- agtagaattacctttattttccttacagggttt -3' SEQ ID No: 5；
5'- agtaatgtgagcaccttccttct -3' SEQ ID No: 6；
5'- agtagaattaggaatgggtaactcttcttgatta -3' SEQ ID No: 7；
5’- ttctcaactgcctcaccacc -3’ SEQ ID No: 8。
3. for a kind of method and its primer sets for detecting SMN1 gene mutation as described in claim 1, which is characterized in that described
Primer sets form it is a kind of detect SMN1 gene mutation kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810040639.0A CN110042153A (en) | 2018-01-16 | 2018-01-16 | A kind of detection method and its primer sets of SMN1 gene mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810040639.0A CN110042153A (en) | 2018-01-16 | 2018-01-16 | A kind of detection method and its primer sets of SMN1 gene mutation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110042153A true CN110042153A (en) | 2019-07-23 |
Family
ID=67272932
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810040639.0A Pending CN110042153A (en) | 2018-01-16 | 2018-01-16 | A kind of detection method and its primer sets of SMN1 gene mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110042153A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111172254A (en) * | 2020-03-19 | 2020-05-19 | 浙江中创生物医药有限公司 | Detection method and kit for SMN1 gene mutation |
| CN113308538A (en) * | 2021-06-29 | 2021-08-27 | 广东博奥医学检验所有限公司 | SMA detection method based on sanger sequencing |
-
2018
- 2018-01-16 CN CN201810040639.0A patent/CN110042153A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111172254A (en) * | 2020-03-19 | 2020-05-19 | 浙江中创生物医药有限公司 | Detection method and kit for SMN1 gene mutation |
| CN111172254B (en) * | 2020-03-19 | 2023-09-08 | 浙江中创生物医药有限公司 | Detection method and kit for SMN1 gene mutation |
| CN113308538A (en) * | 2021-06-29 | 2021-08-27 | 广东博奥医学检验所有限公司 | SMA detection method based on sanger sequencing |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111440884B (en) | Intestinal flora for diagnosing sarcopenia and application thereof | |
| CN108603232A (en) | Monitor treatment or the progress of myeloma | |
| CN106434870A (en) | ncRNA and uses thereof | |
| CN110029158A (en) | A kind of marfan's syndrome detection panel and its application | |
| CN106591273A (en) | Gene new mutations relevant to IEM (Inborn Errors of Metabolism) and detection kit | |
| KR20160080165A (en) | Neurodegenerative disease diagnostic composition and method using the same | |
| JP2021501592A (en) | Gene regulation | |
| US20230058214A1 (en) | Identification of Unique Blood-Based Gene Expression Profiles in Children with Regressive Autism Spectrum Disorder (ASD) and Ileocolitis | |
| CN110042153A (en) | A kind of detection method and its primer sets of SMN1 gene mutation | |
| CN108715893B (en) | SNP markers related to radioactive brain injury caused by radiotherapy and application thereof | |
| CN105803054A (en) | Kit and use thereof in detection of orofacial clefts related genes | |
| CN109825574A (en) | A kind of multiple gene detection kit and its application method for antiepileptic medication guide | |
| CN112251507A (en) | Microorganism relevant to cerebral apoplexy diagnosis and treatment effect evaluation | |
| CN105442053B (en) | A kind of DNA library of checkout and diagnosis ion channel disease Disease-causing gene and its application | |
| CN104232650B (en) | The new Disease-causing gene of idiopathic calcification of basal ganglion and its encoding proteins matter and application | |
| CN104120186B (en) | Congenital hypothyroidism polygenes sequencing primer and detection method | |
| WO2021230379A1 (en) | Method for detecting parkinson disease | |
| CN105838720A (en) | PTPRQ gene mutant and application thereof | |
| Jeon et al. | Transcriptomic profiles and their correlations in saliva and gingival tissue biopsy samples from periodontitis and healthy patients | |
| CN114381525A (en) | Group of molecular markers for glioma prognosis typing and typing method and application thereof | |
| CN110144390A (en) | A kind of detection method and its primer sets of PAH gene mutation | |
| CN113846157B (en) | Application of human SERPINA3 gene in wine dependence screening | |
| CN104250649B (en) | The new Disease-causing gene of the white first syndrome of the few hair of Keratoderma and its encoding proteins matter and application | |
| CN109022592A (en) | SNP marker and its application for four kinds of common strain rats identifications | |
| CN112048552B (en) | Intestinal flora for diagnosing myasthenia gravis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20190723 |